Journal of Virological Methods 208 (2014) 6–10
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Development of a SYBR Green I based duplex real-time PCR for detection of bovine herpesvirus-1 in semen Sachin S. Pawar a , Chetan D. Meshram a , Niraj K. Singh b , Mohini Saini c , B.P. Mishra a , Praveen K. Gupta a,∗ a
Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar, India School of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India c Center for Wildlife, Indian Veterinary Research Institute, Izatnagar, India b
a b s t r a c t Article history: Received 3 March 2014 Received in revised form 12 July 2014 Accepted 18 July 2014 Available online 29 July 2014 Keywords: Bovine herpesvirus-1 Duplex real-time PCR Bovine semen SYBR Green I
Bovine herpesvirus-1 (BoHV-1) is a viral pathogen found in infected bull semen, which is transmitted to inseminated cows by artificial insemination. BoHV-1 infection can cause reproductive disorders leading to significant economic loss to cattle industry. To detect BoHV-1 in semen, in this study, a SYBR Green I based duplex real-time PCR was developed. The assay included primers from BoHV-1 glycoprotein C (gC) and bovine growth hormone (bGH) genes for simultaneous detection in single tube. The result was interpreted by analysing melting temperature (Tm ) peaks obtained after melt curve analysis of the amplified products at the end of reaction. The Tm peaks for BoHV-1-gC indicated presence of BoHV-1 while the bGH peak indicated reaction without inhibition. The sensitivity of the assay was to detect ten BoHV-1 genome copies per reaction. The analytical sensitivity was to detect 0.21 TCID50 infectious BoHV1 in spiked semen. The assay was validated with 80 semen samples collected from breeding bulls. The diagnostic sensitivity and specificity of the assay was 100% with OIE recommended TaqMan probe based real-time PCR. © 2014 Elsevier B.V. All rights reserved.
Bovine herpesvirus-1 (BoHV-1) is a viral pathogen of cattle belonging to the genus Varicello virus of the sub-family Alphaherpesvirinae within the family Herpesviridae. BoHV-1 infects cattle of all ages and breeds, causes infectious bovine rhinotracheitis (IBR), infectious pustular vulvovaginitis (IPV) in cows and infectious balanoposthitis (IBP) in bulls (Gibbs and Rweyemamu, 1977). It is distributed worldwide and leads to significant economic loss to cattle industry due to decrease in milk yield, reduced fertility and abortions (Turin et al., 1999). After clinical infection, BoHV1 establishes latency (Jones et al., 2000) and infected cattle are considered as lifelong carriers and potential shedders of the virus (Wang et al., 2007). Breeding bulls play an important role in dissemination of the disease as the virus is excreted in semen from infected bulls both during the acute phase of infection and latency (Van der Oirschot, 1995) and transmit the disease by natural service or artificial insemination (Wyler et al., 1989). It was observed that shedding of BoHV-1 was not always associated with clinical signs of
∗ Corresponding author at: Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar 243122, India. Tel.: +91 581 2301584; fax: +91 581 2301940. E-mail address: [email protected] (P.K. Gupta). http://dx.doi.org/10.1016/j.jviromet.2014.07.027 0166-0934/© 2014 Elsevier B.V. All rights reserved.
the disease (Van der Oirschot et al., 1993) and vaccination may not completely prevent the virus shedding in semen (Eaglesome and Garcia, 1997). Hence, it is of utmost importance to screen bovine semen for presence of BoHV-1 before use in artificial insemination to avoid large-scale spread of BoHV-1 infection. World Organization for Animal Health, Office International des Epizooties (OIE) recommends screening of every batch of bovine semen before using for artificial insemination (OIE, 2010). Several diagnostic tests, including virus isolation (Rocha et al., 1998), dot-blot hybridization (Xia et al., 1995), PCR (Van Engelenburg et al., 1995; Gupta et al., 2006) and nested PCR (Rocha et al., 1998) have been developed for detection of BoHV-1 in bovine semen. To enhance the sensitivity and specificity of BoHV-1 detection, TaqMan probe based real-time PCR assays have been reported (Wang et al., 2007, 2008; Chandranaik et al., 2010; Diallo et al., 2011; Horwood and Mahony, 2011; Rana et al., 2011; Wernike et al., 2011; Thonur et al., 2012). However, the nucleic acid amplification based assays may lead to false negative results due to presence of seminal inhibitors in semen (Van Engelenburg et al., 1995). Therefore, inclusion of an internal positive control (IPC) in the assay is recommended (Hoorfar et al., 2004; Amer and Almajhdi, 2011). In this study, we report a nucleic acid amplification assay based on SYBR Green I duplex real-time PCR to detect BoHV-1 in bovine
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
7
Table 1 Details of primers and probe used in the study. Assay/test
Primer name
Genomic position a
Sequence (5 –3 )
Reference
SYBR Green I duplex real-time PCR
IBR-F IBR-R bGH-F bGH-R
17434–17453 17533–17555a 1124–1144b 1238–1258 b
TGTGACTTGGTGCCCATGTC GGCGACAACTATATTTTCCCTTC AAGAGTTTGTAAGCTCCCGAG CCCTAACCACATCCCTACTTG
In this study
TaqMan real-time PCR
gBF gBR TaqMan Probe
57499–57519a 57595–57575a 57525–57545a
TGTGGACCTAAACCTCACGGT GTAGTCGAGCAGACCCGTGTC FAM-AGGACCGCGAGTTCTTGCCGC-TAMRA
Wang et al. (2007)
a b
BoHV-1 glycoprotein C (gC) gene, genomic position derived from BoHV type 1.1 (accession number AJ004801.1). Bovine growth hormone gene (bGH), genomic position derived from Bos Taurus (accession number M57764.1).
semen. The assay included primers from BoHV-1 glycoprotein C (gC) and bovine growth hormone (bGH) genes for simultaneous detection of both the targets in single tube. The primer set for bGH served as IPC and ensured optimal reaction performance without inhibition of amplification due to seminal inhibitors. An Indian respiratory isolate of BoHV-1 (isolate no. 216) (Mehrotra et al., 1976; Gupta and Rai, 1993) was used in this study to standardize the amplification reaction condition. The virus was propagated in Madin–Darby bovine kidney (MDBK) cells and titrated. The semen samples from 80 apparently healthy breeding bulls were collected, transported on ice to the laboratory and stored at −20 ◦ C. Total DNA was isolated from bovine semen using the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s protocol with minor modifications. Briefly, 10 l of bovine semen was diluted with 190 l of phosphate buffered saline prior to lysis with buffer AL. The lysate was passed through spin column and washed with wash buffer AW1 and AW2. The total DNA was eluted in 20 l nuclease-free water and stored at −70 ◦ C until further use. The primer sets from BoHV-1 gC and bovine growth hormone (bGH) genes (Table 1) were designed using PrimerQuest software (http://eu.idtdna.com/PrimerQuest). SYBR Green I based uniplex and duplex real-time PCR were carried out in triplicates using KAPA SYBR FAST qPCR Kit (KAPA Biosystems, USA) in Mx3005P QPCR system (Agilent Technologies, USA) following the manufacturer’s instructions. No template control (NTC) was included in the assay
to determine background florescence. The reaction mixture in 20 l volume contained 1× KAPA SYBR FAST qPCR master mix, ROX (low) 0.4 l, 125 nM of each primer namely, BHV-F/R and/or bGH-F/R and 1 l of template DNA. The amplification condition was: initial denaturation at 95 ◦ C for 2 min and 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s. Melt curve analysis (MCA) was performed to verify the specificity of the amplified products based on their melting temperature by carrying a single cycle of denaturation at 95 ◦ C for 1 min, annealing at 60 ◦ C for 30 s, followed by slow increase in temperature to 95 ◦ C at the rate of 0.2 ◦ C/s. The results were analyzed using MxPro qPCR software Version 4.10 (Agilent Technologies, USA). For preparation of standard curve, the 122 bp amplified product from BoHV-1 gC gene using primer pair BHV-F/R was cloned into pJET1.2 vector (ThermoFisher Scientific, USA). The linear recombinant plasmid was quantified using UV spectrophotometer and copy number of plasmid was calculated following the method described earlier (Lee et al., 2006). The ten-fold dilution of plasmid from 108 to 100 copies per l was used as target DNA to generate the standard curve using primer pair BHV-F/R in SYBR Green I based uniplex realtime PCR (Fig. 1). As seen in Fig. 1, the assay could detect up to 10 copies of target DNA per reaction indicating sensitivity of the assay. The linear regression curve was plotted with the mean CT (average of three) values on the Y-axis and logarithm values of copy number of plasmid on the X-axis covering linear range of 8 log units. The curve showed linear regression relationship with coefficient of determination (R2 ) of 0.996 and a slope of y = −3.328x + 39.23
Fig. 1. Sensitivity of the SYBR Green I based real-time PCR assay. Amplification plot (cycle number versus fluorescence) of known copies of plasmid standards (108 –100 copies per reaction) was plotted with three replicates.
8
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
Fig. 2. Standard curve generated from the mean cycle threshold (CT ) values obtained against known copies of plasmid standards (copy number). The coefficient of determination (R2 ) and the equation of regression curve (Y) were calculated.
Table 2 Repeatability of CT values in intra- and inter-assays using SYBR Green I based real-time PCR. Assay no.
108
107
106
105
104
103
102
101
Intra-assay variation I II III Mean CT ± S.D.a CV (%)b
11.74 11.78 12 11.84 ± 0.14 1.18
15.65 15.77 15.84 15.75 ± 0.1 0.61
19.11 19.37 19.5 19.33 ± 0.2 1.03
22.91 22.78 23.03 22.91 ± 0.13 0.55
26.02 26.45 26.55 26.34 ± 0.28 0.68
29.98 29.89 29.82 29.90 ± 0.08 0.27
32.25 32.96 32.52 32.58 ± 0.36 1.1
35.66 35.48 34.63 35.26 ± 0.55 1.56
Inter-assay variation I II III Mean CT ± S.D.a CV (%)b
11.74 11.56 11.91 11.74 ± 0.18 1.49
15.65 15.61 16.01 15.76 ± 0.22 1.4
19.11 19.38 19.85 19.45 ± 0.37 1.93
22.91 22.94 23.54 23.13 ± 0.36 1.54
26.02 26.56 27.09 26.56 ± 0.54 2.02
29.98 30.13 30.77 30.29 ± 0.42 1.39
32.25 32.93 34.05 33.08 ± 0.91 2.75
35.66 36.1 36.3 36.02 ± 0.33 0.91
a b
Standard deviation. Coefficient of variation.
corresponding to the amplification efficiency of 99.7% (Fig. 2). This efficiency of DNA amplification was within the permissible range as described earlier (Amer and Almajhdi, 2011; Sharma and Dasgupta, 2012). For evaluating reproducibility of the assay, plasmid standards ranging from 108 to 100 copies/reaction were tested repeatedly. Intra-assay variations were assessed by using three replicates of each dilution. For evaluating inter-assay variations, each dilution was tested in three different run. For each plasmid standard dilution, the mean, standard deviation (SD) and coefficient of variation (CV) were calculated based on their CT values (Table 2). There was no significant difference in the CV between assay performance of the reactions in terms of sensitivity, specificity, accuracy and reproducibility. The CV for intra-assay and for inter-assay variability ranged from 0.27% to 1.56% and 0.91% to 2.75%, respectively, which were within the acceptable limit of 5% (Islam et al., 2004). This indicated capability of the assay to generate reproducible results. When SYBR Green I based real-time PCR was done in duplex format using total DNA isolated from BoHV-1 infected MDBK cell culture supernatant, there were two distinct Tm peaks, one from BoHV-1 gC gene at Tm of 89.35 ± 0.24 ◦ C and the other from bGH gene as IPC at 82.39 ± 0.23 ◦ C (Fig. 3). The difference in Tm peaks was due to differences in length and GC content of the amplified products. The consistent generation of Tm peaks at 89.35 ± 0.24 ◦ C and 82.39 ± 0.23 ◦ C for BoHV-1 gC and bGH genes, respectively, indicated specificity of the assay.
The analytical sensitivity of the assay was determined by total DNA isolated from BoHV-1 negative semen spiked with known titer of BoHV-1 (from 2.15 × 104 to 2.15 × 10−2 TCID50 /per ml of semen). The detection limit was found to be 0.21 TCID50 infectious BoHV1 per reaction that was comparable to 0.38 TCID50 of the TaqMan probe based real-time PCR (Wang et al., 2007). There was no amplification from BoHV-1 gC gene in negative controls like, total DNA isolated from bovine semen and MDBK cells indicating specificity of the developed assay. The diagnostic applicability of the assay was established by analysing 80 bovine semen samples and compared with results from OIE recommended TaqMan real-time PCR as gold standard test. The TaqMan real-time PCR was carried out using the gB-F/R primers and TaqMan probe (Table 1) as described earlier (Wang et al., 2007; OIE, 2010). The cycling condition was: initial denaturation at 95 ◦ C for 2 min and 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s. Out of 80 samples tested, 24 samples were found positive
Table 3 Comparative performance of duplex SYBR Green I and TaqMan real-time PCR assays for detection of BoHV-1 in semen. Name of the assay
SYBR Green I real-time PCR
TaqMan real-time PCR
Total samples tested
Positive (%) Negative (%)
24 (30) 56 (70)
24 (30) 56 (70)
80
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
9
Fig. 3. Melting curve analysis of the amplified products in SYBR Green I based duplex real-time PCR assay. Two distinct Tm peaks at 89.35 ± 0.24 ◦ C and 82.39 ± 0.23 ◦ C represented BoHV-1 gC and bGH specific products, respectively. The multiple curves in the plot represented the replicates.
Table 4 Diagnostic sensitivity, specificity and accuracy of SYBR Green I duplex real-time PCR assay in comparison with TaqMan real-time PCR. SYBR Green I real-time PCR
TaqMan real-time PCR
Positive Negative
Positive
Negative
24 0
0 56
Sensitivity
Specificity
Positive predictive value
Negative predictive value
Overall accuracy
100%
100%
100%
100%
100%
with SYBR Green I duplex real-time PCR as well as TaqMan realtime PCR assays. This indicated that the sensitivity of the assay was equivalent to TaqMan real-time PCR (Table 2) with 100% positive predictive value. All the 56 samples, negative with TaqMan realtime PCR were found negative in SYBR Green I duplex real-time PCR assay. This indicated diagnostic sensitivity and specificity along with both positive and negative predictive value of 100% (Table 3). The overall diagnostic potential of SYBR Green I duplex real-time PCR assay was found equivalent to TaqMan real-time PCR (Table 4). In conclusion, this study reports a simple and sensitive SYBR Green I duplex real-time PCR assay for detection of BoHV-1 in bovine semen along with internal positive control. Due to its high throughput nature, the assay is convenient for screening large number of semen batches simultaneously for the presence of BoHV-1 before they are used for artificial insemination and breeding programs. The rapid results obtained by the assay can prove crucial for proper herd management and prevention of the BoHV-1 spread through semen. Further, this assay can be considered as an alternative to the regular methods of BoHV-1 detection such as virus isolation, conventional PCR and TaqMan probe based real-time PCR.
Acknowledgement This study was supported by a project grant BS-3011 under National Fund for Basic, Strategic and Frontier Application Research in Agriculture (NFBSFARA), Indian Council of Agricultural Research (ICAR), Government of India.
References Amer, H.M., Almajhdi, F.N., 2011. Development of a SYBR Green I based real-time RT-PCR assay for detection and quantification of bovine coronavirus. Mol. Cell. Probes 25, 101–107. Chandranaik, B.M., Chethana, S., Kumar, S., Renukaprasad, C., 2010. Isolation of BHV1 from bovine semen and application of real-time PCR for diagnosis of IBR/IPV from clinical samples. Vet. Arhiv. 80, 467–475. Diallo, I.S., Corney, B.G., Rodwell, B.J., 2011. Detection and differentiation of bovine herpesvirus 1 and 5 using a multiplex real-time polymerase chain reaction. J. Virol. Methods 175, 46–52. Eaglesome, M.D., Garcia, M.M., 1997. Disease risks to animal health from artificial insemination with bovine semen. Rev. Sci. Tech. Off. Int. Epiz. 16, 215–225. Gibbs, E.P., Rweyemamu, M.M., 1977. Bovine herpesviruses. Part 1. Vet. Bull. 47, 317–343. Gupta, P.K., Rai, A., 1993. Restriction enzyme analysis of bovine herpesvirus-1 DNA from an Indian isolate. Biochem. Mol. Biol. Int. 29, 889–898. Gupta, P.K., Saini, M., Rai, A., 2006. Rapid and sensitive PCR-based test for detection of bovine herpesvirus-1 in semen. Indian J. Virol. 17, 23–27. Hoorfar, J., Malorny, B., Abdulmawjood, A., Cook, N., Wagner, M., Fach, P., 2004. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J. Clin. Microbiol. 42, 1863–1868. Horwood, P.F., Mahony, T.J., 2011. Multiplex real-time RT-PCR detection of three viruses associated with the bovine respiratory disease complex. J. Virol. Methods 171, 360–363. Islam, A., Harrison, B., Cheetam, B.F., Mahony, T.J., Young, P.L., WalkdenBrown, S.W., 2004. Differential amplification and quantitation of Marek’s disease viruses using real-time polymerase chain reaction. J. Virol. Methods 119, 103–113. Jones, C., Newby, T.J., Holt, T., Doster, A., Stone, M.J., Webster, C.J., Jackwood, M.W., 2000. Analysis of latency in cattle after inoculation with a temperature sensitive mutant of bovine herpesvirus 1 (RLB106). Vaccine 18, 3185–3195. Lee, C., Kim, J., Shin, S.G., Hwang, S., 2006. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. J. Biotechnol. 123, 273–280. Mehrotra, M.L., Rajya, B.S., Kumar, S., 1976. IBR-keratoconjunctivitis in calves. Indian J. Vet. Pathol. 1, 70–73. OIE, 2010. Infectious bovine rhinotracheitis/infectious pustular vulvovaginitis. In: OIE Terrestrial Manual (Chapter 2.4.13).
10
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
Rana, S.K., Kota, S.N.L.S., Samayam, P.N.R., Rajan, S., Srinivasan, V.A., 2011. Use of real-time polymerase chain reaction to detect bovine herpesvirus 1 in frozen cattle and buffalo semen in India. Vet. Ital. 47, 313–322. Rocha, M.A., Barbosa, E.F., Guimaraes, S.E., Neto, D., Gouveia, A.M., 1998. A high sensitivity nested PCR assay for BHV-1 detection in semen of naturally infected bulls. Vet. Microbiol. 63, 1–11. Sharma, S., Dasgupta, I., 2012. Development of SYBR Green I based real-time PCR assays for quantitative detection of Rice tungro bacilliform virus and Rice tungro spherical virus. J. Virol. Methods 181, 86–92. Thonur, L., Maley, M., Gilray, J., Crook, T., Laming, E., Turnbull, D., Nath, M., Willoughby, K., 2012. One-step multiplex real-time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3. BMC Vet. Res. 8, 37. Turin, L., Russo, S., Poli, G., 1999. BoHV-1: new molecular approaches to control a common and widespread infection. Mol. Med. 5, 261–284. Van der Oirschot, J.T., 1995. Bovine herpes virus 1 in semen of bulls and the risk of transmission: a brief review. Vet. Q. 17, 29–33. Van der Oirschot, J.T., Straver, P.J., van Lieshout, J.A.H., Quak, J., Westenbrink, F., van Exsel, A.C.A., 1993. A subclinical infection of bulls with bovine herpesvirus type 1 at an artificial insemination centre. Vet. Rec. 132, 32–35. Van Engelenburg, F.A., Kaashoek, M.J., Oirschot, J.T., Rijsewijk, F.A.M., 1995. A glycoprotein E deletion mutant of bovine herpesvirus 1 infects the same limited
number of tissues in calves as wild-type virus, but for a shorter period. J. Gen. Virol. 76, 2387–2392. Wang, J., OKeefe, J., Orr, D., Loth, L., Banks, M., Wakeley, P., West, D., Card, R., Ibata, G., Maanen, K.V., Thoren, P., Isaksson, M., Kerkhofs, P., 2008. An international inter-laboratory ring trial to evaluate a real-time PCR assay for the detection of bovine herpesvirus 1 in extended bovine semen. Vet. Microbiol. 126, 11–19. Wang, J., OKeefe, J., Orr, D., Loth, L., Banks, M., Wakeley, P., West, D., Card, R., Ibata, G., Maanen, K.V., Thoren, P., Isaksson, M., Kerkhofs, P., 2007. Validation of a realtime PCR assay for the detection of bovine herpesvirus 1 in bovine semen. J. Virol. Methods 144, 103–108. Wernike, K., Hoffmann, B., Kalthoff, D., Konig, P., Beer, M., 2011. Development and validation of a triplex real-time PCR assay for the rapid detection and differentiation of wild-type and glycoprotein E-deleted vaccine strains of bovine herpesvirus type 1. J. Virol. Methods 174, 77–84. Wyler, R., Engels, M., Schwyzer, M., 1989. Infectious bovine rhinotracheitis/vulvovaginitis (BoHV-1). In: Witman, G. (Ed.), Herpesvirus Diseases of Cattle, Horses, and Pigs. Kluwer Academic Publishers, Boston, MA. Xia, J.Q., Lofstedt, R.M., Yason, C.V., Kibenge, F.S., 1995. The use of a polymerase chain reaction assay for the detection of bovine herpesvirus 1 in the semen of experimentally infected bulls by dot blot hybridization, polymerase chain reaction and virus isolation. Res. Vet. Sci. 59, 183–185.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Development of a SYBR Green I based duplex real-time PCR for detection of bovine herpesvirus-1 in semen Sachin S. Pawar a , Chetan D. Meshram a , Niraj K. Singh b , Mohini Saini c , B.P. Mishra a , Praveen K. Gupta a,∗ a
Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar, India School of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India c Center for Wildlife, Indian Veterinary Research Institute, Izatnagar, India b
a b s t r a c t Article history: Received 3 March 2014 Received in revised form 12 July 2014 Accepted 18 July 2014 Available online 29 July 2014 Keywords: Bovine herpesvirus-1 Duplex real-time PCR Bovine semen SYBR Green I
Bovine herpesvirus-1 (BoHV-1) is a viral pathogen found in infected bull semen, which is transmitted to inseminated cows by artificial insemination. BoHV-1 infection can cause reproductive disorders leading to significant economic loss to cattle industry. To detect BoHV-1 in semen, in this study, a SYBR Green I based duplex real-time PCR was developed. The assay included primers from BoHV-1 glycoprotein C (gC) and bovine growth hormone (bGH) genes for simultaneous detection in single tube. The result was interpreted by analysing melting temperature (Tm ) peaks obtained after melt curve analysis of the amplified products at the end of reaction. The Tm peaks for BoHV-1-gC indicated presence of BoHV-1 while the bGH peak indicated reaction without inhibition. The sensitivity of the assay was to detect ten BoHV-1 genome copies per reaction. The analytical sensitivity was to detect 0.21 TCID50 infectious BoHV1 in spiked semen. The assay was validated with 80 semen samples collected from breeding bulls. The diagnostic sensitivity and specificity of the assay was 100% with OIE recommended TaqMan probe based real-time PCR. © 2014 Elsevier B.V. All rights reserved.
Bovine herpesvirus-1 (BoHV-1) is a viral pathogen of cattle belonging to the genus Varicello virus of the sub-family Alphaherpesvirinae within the family Herpesviridae. BoHV-1 infects cattle of all ages and breeds, causes infectious bovine rhinotracheitis (IBR), infectious pustular vulvovaginitis (IPV) in cows and infectious balanoposthitis (IBP) in bulls (Gibbs and Rweyemamu, 1977). It is distributed worldwide and leads to significant economic loss to cattle industry due to decrease in milk yield, reduced fertility and abortions (Turin et al., 1999). After clinical infection, BoHV1 establishes latency (Jones et al., 2000) and infected cattle are considered as lifelong carriers and potential shedders of the virus (Wang et al., 2007). Breeding bulls play an important role in dissemination of the disease as the virus is excreted in semen from infected bulls both during the acute phase of infection and latency (Van der Oirschot, 1995) and transmit the disease by natural service or artificial insemination (Wyler et al., 1989). It was observed that shedding of BoHV-1 was not always associated with clinical signs of
∗ Corresponding author at: Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar 243122, India. Tel.: +91 581 2301584; fax: +91 581 2301940. E-mail address: [email protected] (P.K. Gupta). http://dx.doi.org/10.1016/j.jviromet.2014.07.027 0166-0934/© 2014 Elsevier B.V. All rights reserved.
the disease (Van der Oirschot et al., 1993) and vaccination may not completely prevent the virus shedding in semen (Eaglesome and Garcia, 1997). Hence, it is of utmost importance to screen bovine semen for presence of BoHV-1 before use in artificial insemination to avoid large-scale spread of BoHV-1 infection. World Organization for Animal Health, Office International des Epizooties (OIE) recommends screening of every batch of bovine semen before using for artificial insemination (OIE, 2010). Several diagnostic tests, including virus isolation (Rocha et al., 1998), dot-blot hybridization (Xia et al., 1995), PCR (Van Engelenburg et al., 1995; Gupta et al., 2006) and nested PCR (Rocha et al., 1998) have been developed for detection of BoHV-1 in bovine semen. To enhance the sensitivity and specificity of BoHV-1 detection, TaqMan probe based real-time PCR assays have been reported (Wang et al., 2007, 2008; Chandranaik et al., 2010; Diallo et al., 2011; Horwood and Mahony, 2011; Rana et al., 2011; Wernike et al., 2011; Thonur et al., 2012). However, the nucleic acid amplification based assays may lead to false negative results due to presence of seminal inhibitors in semen (Van Engelenburg et al., 1995). Therefore, inclusion of an internal positive control (IPC) in the assay is recommended (Hoorfar et al., 2004; Amer and Almajhdi, 2011). In this study, we report a nucleic acid amplification assay based on SYBR Green I duplex real-time PCR to detect BoHV-1 in bovine
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
7
Table 1 Details of primers and probe used in the study. Assay/test
Primer name
Genomic position a
Sequence (5 –3 )
Reference
SYBR Green I duplex real-time PCR
IBR-F IBR-R bGH-F bGH-R
17434–17453 17533–17555a 1124–1144b 1238–1258 b
TGTGACTTGGTGCCCATGTC GGCGACAACTATATTTTCCCTTC AAGAGTTTGTAAGCTCCCGAG CCCTAACCACATCCCTACTTG
In this study
TaqMan real-time PCR
gBF gBR TaqMan Probe
57499–57519a 57595–57575a 57525–57545a
TGTGGACCTAAACCTCACGGT GTAGTCGAGCAGACCCGTGTC FAM-AGGACCGCGAGTTCTTGCCGC-TAMRA
Wang et al. (2007)
a b
BoHV-1 glycoprotein C (gC) gene, genomic position derived from BoHV type 1.1 (accession number AJ004801.1). Bovine growth hormone gene (bGH), genomic position derived from Bos Taurus (accession number M57764.1).
semen. The assay included primers from BoHV-1 glycoprotein C (gC) and bovine growth hormone (bGH) genes for simultaneous detection of both the targets in single tube. The primer set for bGH served as IPC and ensured optimal reaction performance without inhibition of amplification due to seminal inhibitors. An Indian respiratory isolate of BoHV-1 (isolate no. 216) (Mehrotra et al., 1976; Gupta and Rai, 1993) was used in this study to standardize the amplification reaction condition. The virus was propagated in Madin–Darby bovine kidney (MDBK) cells and titrated. The semen samples from 80 apparently healthy breeding bulls were collected, transported on ice to the laboratory and stored at −20 ◦ C. Total DNA was isolated from bovine semen using the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s protocol with minor modifications. Briefly, 10 l of bovine semen was diluted with 190 l of phosphate buffered saline prior to lysis with buffer AL. The lysate was passed through spin column and washed with wash buffer AW1 and AW2. The total DNA was eluted in 20 l nuclease-free water and stored at −70 ◦ C until further use. The primer sets from BoHV-1 gC and bovine growth hormone (bGH) genes (Table 1) were designed using PrimerQuest software (http://eu.idtdna.com/PrimerQuest). SYBR Green I based uniplex and duplex real-time PCR were carried out in triplicates using KAPA SYBR FAST qPCR Kit (KAPA Biosystems, USA) in Mx3005P QPCR system (Agilent Technologies, USA) following the manufacturer’s instructions. No template control (NTC) was included in the assay
to determine background florescence. The reaction mixture in 20 l volume contained 1× KAPA SYBR FAST qPCR master mix, ROX (low) 0.4 l, 125 nM of each primer namely, BHV-F/R and/or bGH-F/R and 1 l of template DNA. The amplification condition was: initial denaturation at 95 ◦ C for 2 min and 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s. Melt curve analysis (MCA) was performed to verify the specificity of the amplified products based on their melting temperature by carrying a single cycle of denaturation at 95 ◦ C for 1 min, annealing at 60 ◦ C for 30 s, followed by slow increase in temperature to 95 ◦ C at the rate of 0.2 ◦ C/s. The results were analyzed using MxPro qPCR software Version 4.10 (Agilent Technologies, USA). For preparation of standard curve, the 122 bp amplified product from BoHV-1 gC gene using primer pair BHV-F/R was cloned into pJET1.2 vector (ThermoFisher Scientific, USA). The linear recombinant plasmid was quantified using UV spectrophotometer and copy number of plasmid was calculated following the method described earlier (Lee et al., 2006). The ten-fold dilution of plasmid from 108 to 100 copies per l was used as target DNA to generate the standard curve using primer pair BHV-F/R in SYBR Green I based uniplex realtime PCR (Fig. 1). As seen in Fig. 1, the assay could detect up to 10 copies of target DNA per reaction indicating sensitivity of the assay. The linear regression curve was plotted with the mean CT (average of three) values on the Y-axis and logarithm values of copy number of plasmid on the X-axis covering linear range of 8 log units. The curve showed linear regression relationship with coefficient of determination (R2 ) of 0.996 and a slope of y = −3.328x + 39.23
Fig. 1. Sensitivity of the SYBR Green I based real-time PCR assay. Amplification plot (cycle number versus fluorescence) of known copies of plasmid standards (108 –100 copies per reaction) was plotted with three replicates.
8
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
Fig. 2. Standard curve generated from the mean cycle threshold (CT ) values obtained against known copies of plasmid standards (copy number). The coefficient of determination (R2 ) and the equation of regression curve (Y) were calculated.
Table 2 Repeatability of CT values in intra- and inter-assays using SYBR Green I based real-time PCR. Assay no.
108
107
106
105
104
103
102
101
Intra-assay variation I II III Mean CT ± S.D.a CV (%)b
11.74 11.78 12 11.84 ± 0.14 1.18
15.65 15.77 15.84 15.75 ± 0.1 0.61
19.11 19.37 19.5 19.33 ± 0.2 1.03
22.91 22.78 23.03 22.91 ± 0.13 0.55
26.02 26.45 26.55 26.34 ± 0.28 0.68
29.98 29.89 29.82 29.90 ± 0.08 0.27
32.25 32.96 32.52 32.58 ± 0.36 1.1
35.66 35.48 34.63 35.26 ± 0.55 1.56
Inter-assay variation I II III Mean CT ± S.D.a CV (%)b
11.74 11.56 11.91 11.74 ± 0.18 1.49
15.65 15.61 16.01 15.76 ± 0.22 1.4
19.11 19.38 19.85 19.45 ± 0.37 1.93
22.91 22.94 23.54 23.13 ± 0.36 1.54
26.02 26.56 27.09 26.56 ± 0.54 2.02
29.98 30.13 30.77 30.29 ± 0.42 1.39
32.25 32.93 34.05 33.08 ± 0.91 2.75
35.66 36.1 36.3 36.02 ± 0.33 0.91
a b
Standard deviation. Coefficient of variation.
corresponding to the amplification efficiency of 99.7% (Fig. 2). This efficiency of DNA amplification was within the permissible range as described earlier (Amer and Almajhdi, 2011; Sharma and Dasgupta, 2012). For evaluating reproducibility of the assay, plasmid standards ranging from 108 to 100 copies/reaction were tested repeatedly. Intra-assay variations were assessed by using three replicates of each dilution. For evaluating inter-assay variations, each dilution was tested in three different run. For each plasmid standard dilution, the mean, standard deviation (SD) and coefficient of variation (CV) were calculated based on their CT values (Table 2). There was no significant difference in the CV between assay performance of the reactions in terms of sensitivity, specificity, accuracy and reproducibility. The CV for intra-assay and for inter-assay variability ranged from 0.27% to 1.56% and 0.91% to 2.75%, respectively, which were within the acceptable limit of 5% (Islam et al., 2004). This indicated capability of the assay to generate reproducible results. When SYBR Green I based real-time PCR was done in duplex format using total DNA isolated from BoHV-1 infected MDBK cell culture supernatant, there were two distinct Tm peaks, one from BoHV-1 gC gene at Tm of 89.35 ± 0.24 ◦ C and the other from bGH gene as IPC at 82.39 ± 0.23 ◦ C (Fig. 3). The difference in Tm peaks was due to differences in length and GC content of the amplified products. The consistent generation of Tm peaks at 89.35 ± 0.24 ◦ C and 82.39 ± 0.23 ◦ C for BoHV-1 gC and bGH genes, respectively, indicated specificity of the assay.
The analytical sensitivity of the assay was determined by total DNA isolated from BoHV-1 negative semen spiked with known titer of BoHV-1 (from 2.15 × 104 to 2.15 × 10−2 TCID50 /per ml of semen). The detection limit was found to be 0.21 TCID50 infectious BoHV1 per reaction that was comparable to 0.38 TCID50 of the TaqMan probe based real-time PCR (Wang et al., 2007). There was no amplification from BoHV-1 gC gene in negative controls like, total DNA isolated from bovine semen and MDBK cells indicating specificity of the developed assay. The diagnostic applicability of the assay was established by analysing 80 bovine semen samples and compared with results from OIE recommended TaqMan real-time PCR as gold standard test. The TaqMan real-time PCR was carried out using the gB-F/R primers and TaqMan probe (Table 1) as described earlier (Wang et al., 2007; OIE, 2010). The cycling condition was: initial denaturation at 95 ◦ C for 2 min and 45 cycles of 95 ◦ C for 15 s and 60 ◦ C for 45 s. Out of 80 samples tested, 24 samples were found positive
Table 3 Comparative performance of duplex SYBR Green I and TaqMan real-time PCR assays for detection of BoHV-1 in semen. Name of the assay
SYBR Green I real-time PCR
TaqMan real-time PCR
Total samples tested
Positive (%) Negative (%)
24 (30) 56 (70)
24 (30) 56 (70)
80
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
9
Fig. 3. Melting curve analysis of the amplified products in SYBR Green I based duplex real-time PCR assay. Two distinct Tm peaks at 89.35 ± 0.24 ◦ C and 82.39 ± 0.23 ◦ C represented BoHV-1 gC and bGH specific products, respectively. The multiple curves in the plot represented the replicates.
Table 4 Diagnostic sensitivity, specificity and accuracy of SYBR Green I duplex real-time PCR assay in comparison with TaqMan real-time PCR. SYBR Green I real-time PCR
TaqMan real-time PCR
Positive Negative
Positive
Negative
24 0
0 56
Sensitivity
Specificity
Positive predictive value
Negative predictive value
Overall accuracy
100%
100%
100%
100%
100%
with SYBR Green I duplex real-time PCR as well as TaqMan realtime PCR assays. This indicated that the sensitivity of the assay was equivalent to TaqMan real-time PCR (Table 2) with 100% positive predictive value. All the 56 samples, negative with TaqMan realtime PCR were found negative in SYBR Green I duplex real-time PCR assay. This indicated diagnostic sensitivity and specificity along with both positive and negative predictive value of 100% (Table 3). The overall diagnostic potential of SYBR Green I duplex real-time PCR assay was found equivalent to TaqMan real-time PCR (Table 4). In conclusion, this study reports a simple and sensitive SYBR Green I duplex real-time PCR assay for detection of BoHV-1 in bovine semen along with internal positive control. Due to its high throughput nature, the assay is convenient for screening large number of semen batches simultaneously for the presence of BoHV-1 before they are used for artificial insemination and breeding programs. The rapid results obtained by the assay can prove crucial for proper herd management and prevention of the BoHV-1 spread through semen. Further, this assay can be considered as an alternative to the regular methods of BoHV-1 detection such as virus isolation, conventional PCR and TaqMan probe based real-time PCR.
Acknowledgement This study was supported by a project grant BS-3011 under National Fund for Basic, Strategic and Frontier Application Research in Agriculture (NFBSFARA), Indian Council of Agricultural Research (ICAR), Government of India.
References Amer, H.M., Almajhdi, F.N., 2011. Development of a SYBR Green I based real-time RT-PCR assay for detection and quantification of bovine coronavirus. Mol. Cell. Probes 25, 101–107. Chandranaik, B.M., Chethana, S., Kumar, S., Renukaprasad, C., 2010. Isolation of BHV1 from bovine semen and application of real-time PCR for diagnosis of IBR/IPV from clinical samples. Vet. Arhiv. 80, 467–475. Diallo, I.S., Corney, B.G., Rodwell, B.J., 2011. Detection and differentiation of bovine herpesvirus 1 and 5 using a multiplex real-time polymerase chain reaction. J. Virol. Methods 175, 46–52. Eaglesome, M.D., Garcia, M.M., 1997. Disease risks to animal health from artificial insemination with bovine semen. Rev. Sci. Tech. Off. Int. Epiz. 16, 215–225. Gibbs, E.P., Rweyemamu, M.M., 1977. Bovine herpesviruses. Part 1. Vet. Bull. 47, 317–343. Gupta, P.K., Rai, A., 1993. Restriction enzyme analysis of bovine herpesvirus-1 DNA from an Indian isolate. Biochem. Mol. Biol. Int. 29, 889–898. Gupta, P.K., Saini, M., Rai, A., 2006. Rapid and sensitive PCR-based test for detection of bovine herpesvirus-1 in semen. Indian J. Virol. 17, 23–27. Hoorfar, J., Malorny, B., Abdulmawjood, A., Cook, N., Wagner, M., Fach, P., 2004. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J. Clin. Microbiol. 42, 1863–1868. Horwood, P.F., Mahony, T.J., 2011. Multiplex real-time RT-PCR detection of three viruses associated with the bovine respiratory disease complex. J. Virol. Methods 171, 360–363. Islam, A., Harrison, B., Cheetam, B.F., Mahony, T.J., Young, P.L., WalkdenBrown, S.W., 2004. Differential amplification and quantitation of Marek’s disease viruses using real-time polymerase chain reaction. J. Virol. Methods 119, 103–113. Jones, C., Newby, T.J., Holt, T., Doster, A., Stone, M.J., Webster, C.J., Jackwood, M.W., 2000. Analysis of latency in cattle after inoculation with a temperature sensitive mutant of bovine herpesvirus 1 (RLB106). Vaccine 18, 3185–3195. Lee, C., Kim, J., Shin, S.G., Hwang, S., 2006. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. J. Biotechnol. 123, 273–280. Mehrotra, M.L., Rajya, B.S., Kumar, S., 1976. IBR-keratoconjunctivitis in calves. Indian J. Vet. Pathol. 1, 70–73. OIE, 2010. Infectious bovine rhinotracheitis/infectious pustular vulvovaginitis. In: OIE Terrestrial Manual (Chapter 2.4.13).
10
S.S. Pawar et al. / Journal of Virological Methods 208 (2014) 6–10
Rana, S.K., Kota, S.N.L.S., Samayam, P.N.R., Rajan, S., Srinivasan, V.A., 2011. Use of real-time polymerase chain reaction to detect bovine herpesvirus 1 in frozen cattle and buffalo semen in India. Vet. Ital. 47, 313–322. Rocha, M.A., Barbosa, E.F., Guimaraes, S.E., Neto, D., Gouveia, A.M., 1998. A high sensitivity nested PCR assay for BHV-1 detection in semen of naturally infected bulls. Vet. Microbiol. 63, 1–11. Sharma, S., Dasgupta, I., 2012. Development of SYBR Green I based real-time PCR assays for quantitative detection of Rice tungro bacilliform virus and Rice tungro spherical virus. J. Virol. Methods 181, 86–92. Thonur, L., Maley, M., Gilray, J., Crook, T., Laming, E., Turnbull, D., Nath, M., Willoughby, K., 2012. One-step multiplex real-time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3. BMC Vet. Res. 8, 37. Turin, L., Russo, S., Poli, G., 1999. BoHV-1: new molecular approaches to control a common and widespread infection. Mol. Med. 5, 261–284. Van der Oirschot, J.T., 1995. Bovine herpes virus 1 in semen of bulls and the risk of transmission: a brief review. Vet. Q. 17, 29–33. Van der Oirschot, J.T., Straver, P.J., van Lieshout, J.A.H., Quak, J., Westenbrink, F., van Exsel, A.C.A., 1993. A subclinical infection of bulls with bovine herpesvirus type 1 at an artificial insemination centre. Vet. Rec. 132, 32–35. Van Engelenburg, F.A., Kaashoek, M.J., Oirschot, J.T., Rijsewijk, F.A.M., 1995. A glycoprotein E deletion mutant of bovine herpesvirus 1 infects the same limited
number of tissues in calves as wild-type virus, but for a shorter period. J. Gen. Virol. 76, 2387–2392. Wang, J., OKeefe, J., Orr, D., Loth, L., Banks, M., Wakeley, P., West, D., Card, R., Ibata, G., Maanen, K.V., Thoren, P., Isaksson, M., Kerkhofs, P., 2008. An international inter-laboratory ring trial to evaluate a real-time PCR assay for the detection of bovine herpesvirus 1 in extended bovine semen. Vet. Microbiol. 126, 11–19. Wang, J., OKeefe, J., Orr, D., Loth, L., Banks, M., Wakeley, P., West, D., Card, R., Ibata, G., Maanen, K.V., Thoren, P., Isaksson, M., Kerkhofs, P., 2007. Validation of a realtime PCR assay for the detection of bovine herpesvirus 1 in bovine semen. J. Virol. Methods 144, 103–108. Wernike, K., Hoffmann, B., Kalthoff, D., Konig, P., Beer, M., 2011. Development and validation of a triplex real-time PCR assay for the rapid detection and differentiation of wild-type and glycoprotein E-deleted vaccine strains of bovine herpesvirus type 1. J. Virol. Methods 174, 77–84. Wyler, R., Engels, M., Schwyzer, M., 1989. Infectious bovine rhinotracheitis/vulvovaginitis (BoHV-1). In: Witman, G. (Ed.), Herpesvirus Diseases of Cattle, Horses, and Pigs. Kluwer Academic Publishers, Boston, MA. Xia, J.Q., Lofstedt, R.M., Yason, C.V., Kibenge, F.S., 1995. The use of a polymerase chain reaction assay for the detection of bovine herpesvirus 1 in the semen of experimentally infected bulls by dot blot hybridization, polymerase chain reaction and virus isolation. Res. Vet. Sci. 59, 183–185.
