Biosensors and Bioelectronics 55 (2014) 324–329
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Development of an electrochemical method for Ochratoxin A detection based on aptamer and loop-mediated isothermal amplification Shunbi Xie, Yaqin Chai n, Yali Yuan, Lijuan Bai, Ruo Yuan n Key Laboratory of Ministry of Education on Luminescence and Real-Time Analysis, School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 3 September 2013 Received in revised form 2 November 2013 Accepted 4 November 2013 Available online 16 December 2013
Loop-mediated isothermal amplification (LAMP) is an outstanding DNA amplification procedure, in which the reaction can accumulate 109 copies from less than 10 copies of input template within an hour. While the amplification reaction is extremely powerful, the quantitative detection of LAMP products is still analytically difficult. Besides, the type of targets that LAMP can detect is also less, which to some extent limited the application of LAMP. In this study, we are reporting for the first time an efficient and accurate detection system which employs the integration of LAMP, aptamer and the electrochemical method for the sensitive detection of Ochratoxin A (OTA). Aptamers were designed as the forward outer primer to trigger the LAMP reaction, and then the LAMP amplification products were combined with a redox active molecule methylene blue (MB) and analyzed by an electrode using differential pulse voltammograms (DPV). As the reaction progresses, the MB intercalated into double-stranded regions of LAMP amplicons reduces the free MB concentration. Hence, the peak current of reaction mixture decreased with the amplification because of the slow diffusion of MB-amplified DNA complex to the electrode surface. The peak height of the current was related to the input amount of the aptamers, providing a ready means to detection the concentration of OTA. With such design, the proposed assay showed a good linear relationship within the range of 0.001–50 nM with a detection limit of 0.3 pM (defined as S/N¼ 3) for OTA. & 2014 Published by Elsevier B.V.
Keywords: Loop-mediated isothermal amplification Aptamer Electrochemical Ochratoxin A
1. Introduction Signal generation and amplification plays a significant role in improving the sensitivity of a biosensor (Du et al., 2011; Zheng et al., 2011; Shi et al., 2012; Shi et al., 2013). To realize this aim, a series of very powerful isothermal nucleic acid amplification techniques have been developed that have shown promising applications in research, diagnostics, forensics, medicine, and agriculture (Gill, Ghaemi, 2008; Asiello, Baeumner, 2011). These techniques include polymerase chain reaction (PCR) (Ranasinghe, Brown, 2005; Marx, Strerath, 2005), rolling circle amplification (RCA) (Li, Zhong, 2007; Li et al., 2010), strand displacement amplification (SDA) (Weizmann et al., 2006), the isothermal exponential amplification reaction (EXPAR) (Wang, Zhang, 2012; Liu et al., 2012) and loop-mediated isothermal amplification of DNA (LAMP) (Notomi et al., 2000; Fang et al., 2011). Among these techniques, LAMP is especially interesting as it employs only one enzyme and is relatively insensitive to the secondary structure of n
Corresponding authors. Tel.: þ 86 23 68252277; fax: þ 86 23 68253172. E-mail addresses: [email protected] (Y. Chai), [email protected] (R. Yuan).
0956-5663/$ - see front matter & 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.bios.2013.11.009
the amplicon (Li et al., 2012). LAMP is a very sensitive, easy and time saving method that can amplify up to 109 copies of target gene in less than an hour under isothermal conditions (65 1C). The method uses four to six primers that recognize six–eight regions of the target DNA eliminating non-specific binding and thus ensuring the specificity of LAMP. A simple incubator, such as water bath or heating block, is sufficient for the DNA amplification, which makes its use under field conditions feasible (Parida et al., 2008). Despite the attractiveness of the LAMP technique, there are still some potential shortcomings in the quantitative detection of LAMP products. In many cases, the identification of LAMP products is mainly based on a dsDNA-specific fluorescent dye, electrophoresis of amplicons, turbidity due to magnesium pyrophosphate, and the metal ion indicator (Tomita et al., 2008). DNA amplification is visualized by the naked eye either as turbidity or the color change of a fluorescent dye. Even though these methods allow real-time detection, the signals are due solely to the accumulation of basepairs and can easily read false amplicons as the true ones (Njiru et al., 2008; Paris et al., 2007). Besides, although LAMP have made great progress in detections of virus (Wang et al., 2012), bacteria (Han et al., 2011), parasites (Abdul-Ghani et al., 2012), food safeties
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
325
presence of OTA, the OTA aptamers bound with OTA and released from the self-assembled duplex on the electrode into solution. Then the remaining unbound OTA aptamers on the electrode could hybridize with template DNA in the LAMP system. The OTA aptamers perfectly complementary to the sequence of M in template DNA and trigger the LAMP amplification. Finally, the LAMP amplification products were combined with a redox active molecule methylene blue (MB) and analyzed by an electrode using differential pulse voltammograms (DPV). As the reaction progresses, the MB intercalated into double-stranded regions of LAMP amplicons reduces the free MB concentration. Hence, the peak current of reaction mixture decreases with the amplification because of the slow diffusion of MB-amplified DNA complex to the electrode surface. The peak height of the current was related to the input amount of the aptamers, providing a ready means to detection the concentration of OTA.
(Ueda, Kuwabara, 2009) and animal embryo sex identifications (Nogami et al., 2008), its powerful amplification functionality has not been well applied in the field of proteins, small molecules, adenosine and metal ions detection areas, which present some limitations for their practical implementation. In response to such limitations, if we want to utilize LAMP's outstanding characteristics, the first problem that we must be resolved is how to quantity the LAMP products more accurately, and another major effort underway is aimed at how to extend the application range of LAMP. Motivated by these clear needs, we attempted to develop an approach, which integrated LAMP with other detection technology and molecular recognition element, for the sensitive and quantitative detection of various target. Aptamers are synthetic oligonucleotides that can bind a wide range of target molecules (proteins, drugs, amino acids, etc.) with high specificity and selectivity. Owing to their high selectivity, stability, versatile target binding and easy regeneration capabilities over traditional antibodies, there has been a considerable interest in employing aptamers as recognition ligands for biosensor applications (Xiang et al., 2010). We therefore sought to transduce the aptamers into LAMP for the purpose of extending the application range of LAMP. Electrochemical methods have received particular attention, owing to their distinct advantages of speed, sensitivity, cost and portability. Recently, a few research groups have reported the electrochemical detection methods for amplified DNA by LAMP. Ahmed et al. (2013) reported a real-time electrochemical method for pathogen DNA detection using electrostatic interaction of a redox probe. Nagatani et al. (2011) reported the electrochemical LAMP product detection method by using Hoechst 33258. Hsieh et al. (2012) also reported a rapid, sensitive, and the quantitative method to detection Pathogenic DNA at the point of care through microfluidic electrochemical quantitative LAMP. In such strategies, the detection of LAMP products did not require any probe immobilization on an electrode by using electroactive reagents such as Hoechst 33258 or methylene blue (MB) and showed promising results.
Ochratoxin A (OTA), hexanethiol (96%, HT), gold chloride (HAuCl4) and bataine were purchased from Sigma (St. Louis, MO). Bst polymerase large fragments, MgSO4 and the deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs Ltd. (Beijing, China). Tris-hydroxymethylaminomethane hydrochloride (tris) was obtained from Roche (Switzerland). K3[Fe(CN)6] and K4[Fe(CN)6] were purchased from Beijing Chemical Reagent Co. (Beijing, China). All HPLC-purified DNA oligonucleotides were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The template DNA was synthesized by Integrated DNA Technologies, Inc. (IDT, USA). The oligonucleotide sequences are summarized as follows: Template DNA:
However, all of these assays are signal-off platform, in which the method itself has some limitations. In spite of this shortcoming, by combining the advantages of electrochemical method, these assays also promise a novel pathway to achieve the qualitative and quantitative detection of the LAMP amplification. In this article, to both improve the specificity of LAMP detection and to make direct readout of LAMP amplification simpler and much more reliable, we have developed an signal-on electrochemical aptasensor that combines the amplification power of LAMP, the versatile target binding of aptamer and the inherent high sensitivity of the electrochemical method for the rapid analysis of targets for the first time. As a model system, we chose the small molecules OTA as the interest target. The mechanism and LAMP reaction steps for OTA detection are illustrated in Scheme 1. The capture DNAs (cDNA) were firstly self-assembled on gold nanoparticles modified electrode. Then OTA aptamers were immobilized on the electrode via partially hybridized with cDNA. In the
Primer FIP (F1c–F2): 5'–ACAACGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC-3' Primer BIP (B1c–B2): 5'–CGACTCTAGAGGATCCCCGGGTACTTTTTGTTGTGTGGAATTGTGAGCGGAT-3' Primer B3: 5'–ACTTTATGCTTCCGGCTCGTA-3' Capture DNA: 5'–TGTCCGATGC-(CH2)6-SH-3' Aptamer: 5'–GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3' (bold font domain is the complementary sequence to the capture DNA) 20 mM Tris–HCl buffer (pH 7.4) containing 140 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 was used as a binding buffer. Phosphate-buffered solution (PBS) (pH 7.0, 0.1 M) containing 10 mM KCl, 2 mM MgCl2 was used as working buffer solution. All other chemicals were of analytical grade and used as received. Electrochemical experiments, including electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) and cyclic voltammetry (CV), were carried out with a CHI 660B
2. Experimental section 2.1. Reagents and apparatus
326
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
Scheme 1. Schematic illustration of OTA detection principle using electrochemical method based on aptamer and LAMP. (a) The redox and the amplicons after amplification at zero concentration of OTA which produced the lower current and (b) the redox and the amplicons after amplification at highly concentration of OTA which produced higher current as observed by DPV.
electrochemistry workstation (Shanghai CH Instrumission, China). The pH measurements were finished with a pH meter (MP 230, Mettler-Toledo, Switzerland). A three-electrode system contained a modified glassy carbon electrode (GCE, Φ ¼4 mm) as working electrode, a platinum wire as auxiliary electrode and a saturated calomel electrode (SCE) as a reference electrode. 2.2. Electrochemical measurements All electrochemical experiments were carried out in a conventional electrochemical cell containing a three-electrode arrangement. CVs of the electrode fabrication were performed in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl, scanning from 0.6 V to 0.2 V at a scan rate of 50 mV/s. Electrochemical impedance spectroscopy (EIS) was carried out in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl with the frequencies swept from 0.1 to 105 Hz. The electrode was immersed into 1 mL 0.1 M PBS (pH 7.0) containing the LAMP production, the response of MB was measured by differential pulse voltammetry (DPV). The DPV measurement was taken: the potential range was from 0.4 to 0 V, modulation amplitude was 0.05 V, pulse width was 0.05 s, and sample width was 0.0167 s. 2.3. Fabrication of the modified electrodes Prior to use, GCE was polished carefully with 0.05 and 0.3 μm alumina powder on fine abrasive paper sequentially and then washed ultrasonically in water and ethanol for a few minutes. Firstly, AuNPs were deposited onto the GCE in 1% HAuCl4 solutions
at the potential of 0.2 V for 30 s, immediately, 20 μL of 2.5 μM capture DNA solution was cast on the AuNPs-GCE at 4 1C for 16 h. To eliminate nonspecific binding effects, the modified electrode was followed by incubating with 20 μL of 1.0 mM HT for 45 min at room temperature. And then 20 μL of the OTA aptamer (2.5 μM) solution was dropped on the modified electrode surface for 2 h at room temperature. After rinsed with the washing buffer solution, the fabricated aptasensor was dropped with 20 μL of a fixed concentration of OTA for 40 min. Finally, the resulting electrode was rinsed with the washing buffer solution and was ready for the next step. 2.4. The LAMP reaction The LAMP system, which consists of a template DNA, forward inner primer (FIP), backward inner primer (BIP) and backward outer primer B3, is designed according to the literature (Li et al., 2011) with some modifications. LAMP reaction was carried out in a total of 500 μL reaction mixture containing 375 μL PBS (pH 7.0, 0.1 M), 100 μL MB (40 μM), 2 μL 10 Thermol Pol Buffer, 1 μL MgSO4 (8 mM), 3 μL betaine (1.0 M), 5 μL dNTPs (1.4 mM), 2 μL of each high performance liquid chromatography (HPLC)-graded inner primers, FIP and BIP (2.5 μM), 1 μL of backward outer primer B3 (2.5 μM), followed by the addition of 8U of Bst polymerase. 5 μL of DNA template approximately 100 ng/μl was eventually added to the reaction mixture. Finally, the modified electrode described above was immersed into the solution of the LAMP system, and then the reaction mixture was incubated at 65 1C for 60 min and at 80 1C for 4 min in order to terminate the reaction.
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
3. Results and discussion 3.1. Working principle of the LAMP amplification reaction The template DNA successively contains the sequences of B3, B2, B1, F1c, F2c and M. As the Fig. 1 illustrated, in the initial step, FIP hybridizes to F2c in the template DNA and extends in the presence of Bst DNA polymerase and dNTPs. Thereafter, the OTA aptamer hybridizes to M in the template DNA and initiates the strand displacement DNA synthesis (SDS) based on the catalytic activity of the extension along the DNA template and the strand displacement activity of Bst DNA polymerase, releasing a FIPlinked single strand DNA (ssDNA), which can form a stem-loop structure at the 5' terminus through the hybridization between F1 and F1c. BIP contains the sequence B1c, a TTTT spacer and B2 complementary to B2c. At the 3' terminus of the ssDNA, BIP hybridizes to B2c to perform the primer extension and then the back outer primer B3 hybridizes to B3c in the 3' terminus of the ssDNA to perform the SDS, releasing a BIP-linked ssDNA which can form double stem-loop structures at 3' and 5' terminus, respectively. And then as demonstrated in the previous reports (Tomita et al., 2008), the FIP, BIP primers and the DNA strand-displacing polymerase enable the production of dumbbell-shaped intermediate structures and stem-loop and cauliflower-like amplicons in a continuous manner.
Fig. 1. Schematic representation of the LAMP reaction initiated by the OTA aptamer.
327
Initially, the redox reporter MB molecules within the LAMP reaction solution are free, producing a measurable high current signal. As the reaction progresses, the intercalation of DNA-binding MB molecules into newly formed amplicons double-stranded regions of LAMP amplicons reduces the free MB concentration and thus decreases the redox current. The peak height of the current was related to the extent of amplification of DNA and the input amount of OTA aptamer. The more OTA detected, the less OTA aptamer remained on the electrode, resulting less newly formed amplicons with high current signal of MB. Thus a signal on assay was fabricated for OTA sensitivity detection. 3.2. The electrochemical characterization of the stepwise modified electrodes To characterize the modified electrodes, the assembly steps of the sensing interface were investigated by CV measurements. CVs of different modified electrodes that investigated in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl were shown in Fig. 2A. As can be seen, a well-defined redox peak of [Fe(CN)6]3 /4 was observed at the bare electrode (curve a). Curve b showed the electrodeposition of AuNPs on the GCE, the peak current was increased, indicating that the AuNPs could promote the electron transfer. After the thiol-modified capture DNA was immobilized on the modified electrode, the redox peak current decreased (curve c), which was attributed to the capture DNA block the electron transfer on the electrode surface. Subsequently, the modified electrode was treated with HT to block nonspecific site, a further decrease of peak current (curve d) was observed. After assembling OTA aptamer, the steric hindrance was further increased, resulting in further decrease in current (curve e). With the introduction of OTA (curve g), OTA combined with the OTA aptamer, which resulted in less DNA being on the electrode surface. Thus, an increased peak current was observed, which was higher than the peak current of the HT-modified electrode and lower than that of the OTA aptamer-DNA modified electrode. The differences of the CVs in different modified stages clearly reflected the changes in each stage of the electrode surface. As one of the electrochemical technologies, electrochemical impedance spectroscopy (EIS) has been proven to be one of the most powerful tools for interfacial investigation (Li et al., 2005). Thus, in this work, we employed EIS to further confirm the assemble process of the aptasensor. Fig. 2B showed the Nyquist plots of impedance spectra at different electrodes. The bare GCE electrode showed a very small semicircle domain implying very fast electron-transfer process (curve a). Owing to conductivity of AuNPs, a decrease of semicircle diameter was obtained after the electrochemical deposition (curve b). However, after the consecutive
Fig. 2. The electrochemical characterization of the stepwise modified electrodes: CV (A) and EIS (B) of bare GCE (a); GCE/Au (b); GCE/Au/capture DNA (c); GCE/Au/ capture DNA/HT (d); GCE/Au/ capture DNA/HT/aptamer (e); GCE/Au/capture DNA/HT/aptamer/OTA (f) in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl. Scan rate: 50 mV/s.
328
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
assembling of negative capture DNA, inert HT and negative OTA aptamer, the resistances were increased with the stepwise increase of semicircle diameter (curve c, d, e, respectively). The resistance clearly decreased when the electrode was incubated with OTA (curve f). The results indicated that a sensing interface was effectively constructed. The results indicated that a sensing interface was effectively constructed.
0.8 mM to 4.0 mM, indicating that the MB embedded in the newly formed amplicons has not reached the saturation point. When the MB concentration reached 4.8 mM, the current value suddenly increases, indicating that the MB concentration in the solution is supersaturated. Therefore, we have chosen 4.0 mM for its appropriate and sufficient signal acquisition without any inhibition of isothermal amplification over time.
3.3. Optimization of the experimental conditions 3.4. The detection of OTA based on DPV In order to maximize the efficiency and sensitivity of the system, the optimization of the experimental conditions such as the incubation time of OTA aptamer with OTA and the MB concentration were investigated. OTA binding with its aptamer caused the aptamer release from electrode, more aptamer was released, the less amplicons were produced by the LAMP amplification, and ultimately resulting an incease current signal. Therefore, the incubation time of the OTA aptamer binging with OTA is a very important impact on the experimental results. The OTA aptamers bound with OTA and released from the electrode into solution, thus the CV response signal for OTA increased from 10 min to 40 min and changed very little after 40 min (Fig. 3 A). Therefore, the time of 40 min was selected for the incubation time. The concentration of MB also intensely influenced the sensitivity of biosensor. The MB was elected to apply in a series of concentrations (Fig. 3B). At the beginning, the current response changed slowly with the MB concentration increasing from
Under the optimal conditions, a bare electrode was immersed in solutions of different concentrations of OTA LAMP amplification and the DPV responses were recorded. Fig. 4 showed the calibration curves corresponding to the DPV detection of OTA in the PBS (pH 7.0) based on the changes of current intensity (ΔI). As expected, a linear relationship between the difference of the peak current and background (ΔI) and the logarithm of the concentration of OTA (log cOTA) was obtained in the range of 0.001–50 nM. The linear equation was ΔI (μA)¼ 0.1086 log cOTA (nM) 0.5607 with a correlation coefficient of 0.9901 and an evaluated detection limit of 0.3 pM. In addition, the analytical performance of the developed aptasensor for OTA detection was compared with those of other methods reported in the literatures. The results were summarized in Table S1 (see Supplementary material). It can be seen that the linear range and detection limit of the proposed assay was greatly improved and a lower detection limit was achieved.
-4.2 -3.9
I / µA
-4.0 -3.5 -3.0 -2.5 -2.0 -1.5 -1.0 -0 4 .5 0.0 1 4 .8 3.2 .0 -0. .2 M 2 0 3 /n 1. .4 -0. 4 0.8 6 B -0. cM
-3.3
E
I / µA
-3.6
/
V
-3.0 -2.7 0
1
2
3
4
5
cMB / nM Fig. 3. The optimization of experimental parameter: (A) influence of OTA and aptamer incubation time on the current response. The inset shows the dependence of peak currents on each incubation time. (B) The optimum concentration of MB. The inset shows the dependence of peak currents on each concentration of MB.
Fig. 4. (A) DPVs of OTA detection at different concentrations: 0 nM, 0.001 nM, 0.01 nM, 0.1 nM, 1 nM, 10 nM, 50 nM. Detection buffer: PBS (pH 7.0). (B) The calibration plot of current intensity vs. log cOTA.
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
329
we preserve the best features as follows: LAMP provides high sensitivity and specificity for molecular detection, while also providing LAMP modularity, ease of readout, and suppression of parasite detection; We anticipate that this combination will ultimately make LAMP much more useful for the vary types of target. In this paper, the LAMP-based assay was only applied to OTA detection, while the scheme can be easily designed for other targets by changing the corresponding aptamer without other conditions, making this method potentially universal.
Acknowledgments
Fig. 5. DPV current of aptasensor after incubation with different targets.
3.5. The specificity of current assay The specificity of the developed aptasensor was tested by the incubation reaction of dsDNA on the aptasensor surface with different targets at the same condition. Several 10 nM nontargets including protein thrombin, small molecules cocaine and OTA's dechlorinated analog Ochratoxin B (OTB) were assayed to investigate the specificity of the method. Due to the inherent specificity of the aptamer toward its target, the electrochemical signal for the sensing system presented high selectivity as shown in Fig. 5. Only OTA (1 nM) can induce remarkable signal, even 10-fold higher concentrations than that of OTA, rather low signals were found for the nontargets. It indicated that the developed method possessed high specificity for the OTA detection. 3.6. Evaluation of real samples OTA is a common contaminant of wine and it is report that OTA is detected more ordinarily in red wines than in roses and white wines due to its special wine making procedure (Ottender, Majerus, 2000). In this experiment, the assay of the target OTA in a series of real samples was investigated by detecting OTA in red wine. The standard addition method was employed to evaluate the applicability of the proposed method. Herein, a series of samples were prepared by adding OTA of different concentrations to red wine (obtained from the local supermarket). The recoveries were calculated by the found amount/added amount ratio, and the data were given in Table S2. From Table S2 (see Supplementary material ), we could see that the recovery (between 97.4% and 108%) and relative standard deviation values (between 4.3% and 7.8%) were acceptable, which indicated the potentiality of this method for OTA detection in real biological samples. 4. Conclusions In summary, we have demonstrated that the LAMP reaction can be applied to ultrasensitive detection of OTA. By using OTA aptamer to initiate the LAMP reaction and quantitative electrochemical detection of LAMP amplification by monitoring the intercalation of DNA-binding methylene blue (MB) redox reporter molecules into newly formed amplicons with an electrode, as low as 0.3 pM OTA can be accurately determined. Besides, the proposal method was designed as a signal-on platform which has the advantages of high sensitivity, low background signal and outstanding accuracy. By pairing a novel amplification technique, LAMP combines with aptamer and electrochemical technique,
This work was financially supported by the NNSF of China (21075100, 21105081), State Key Laboratory of Electroanalytical Chemistry (SKLEAC2010009), the Fundamental Research Funds for the Central Universities (XDJK2012A004), Specialized Research Fund for the Doctoral Program of Higher Education (20100182110015), Ministry of Education of China (Project 708073).
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2013.11.009. References Abdul-Ghani, R., Al-Mekhlafi, A.M., Karanis, P., 2012. Acta Trop. 122, 233–240. Ahmed, M.U., Nahar, S., Safavieh, M., Zourob, M., 2013. Analyst 138, 907–915. Asiello, P.J., Baeumner, A., 2011. J. Lab. Chip 11, 1420–1430. Du, Y., Guo, S., Dong, S., Wang, E., 2011. Biomaterials 32, 8584–8592. Fang, X.E., Chen, H., Yu, S.N., Jiang, X.Y., Kong, J.L., 2011. Anal. Chem. 83, 690–695. Gill, P., Ghaemi, A., 2008. Nucleotides Nucleic Acids 27, 224–243. Han, H.J., Jung, S.J., Oh, M.J., Kim, D.H., 2011. J. Fish Dis. 34, 395–398. Hsieh, K., Patterson, A.S., Ferguson, B.S., Plaxco, K.W., Soh, H.T., 2012. Angew. Chem. Int. Ed. 51, 4896–4900. Li, B.L., Chen, X., Ellington, A.D., 2012. Anal. Chem. 84, 8371–8377. Li, C.P., Li, Z.P., Jia, H.X., Yan, J.L., 2011. Chem. Commun. 47, 2595–2597. Li, C.Z., Liu, Y.L., Luong, J.H.T., 2005. Anal. Chem. 77, 478–485. Li, J.S., Zhong, W.W., 2007. Anal. Chem. 79, 9030–9038. Li, J.S., Deng, T., Chu, X., Yang, R.H., Jiang, J.H., Shen, G.L., Yu, R.Q., 2010. Anal. Chem. 82, 2811–2816. Liu, Y.Q., Zhang, M., Yin, B.C., Ye, B.C., 2012. Anal. Chem. 84, 5165–5169. Marx, A., Strerath, M., 2005. Angew. Chem. Int. Ed. 44, 7842–7849. Nagatani, N., Yamanak, K., Saito, M., Koketsu, R., Sasaki, T., Ikuta, K., Miyahara, T., Tamiya, E., 2011. Analyst 136, 5143–5150. Njiru, Z.K., Mikosza, A.S.J., Armstrong, T., Enyaru, J.C., Ndung'u, J.M., Thompson, A.R. C., 2008. PLoS Negl. Trop. Dis. 2, 147–153. Nogami, H., Tsutsumi, H., Komuro, T., Mukoyama, R., 2008. Forensic. Sci. Int. Genet. 2, 349–353. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Nucleic Acids Res. 28, E63. Ottender, H., Majerus, P., 2000. Food Addit. Contam. 17, 793–798. Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., 2008. Rev. Med. Virol. 18, 407–421. Paris, D.H., Imwong, M., Faiz, A.M., Hasan, M., Bin Yunus, E., Silamut, K., Lee, S.J., Day, N.P.J., Dondorp, A.M., 2007. Am. J. Trop. Med. Hyg. 77, 972–976. Ranasinghe, R.T., Brown, T., 2005. Chem. Commun. 44, 5487–5502. Shi, J., Zhang, H.Y., Snyder, X., Wang, M.X., Xie, J., Porterfield, D.M., Stanciu, L.A., 2012. Biosens. Bioelectron. 38, 314–320. Shi, J., McLamore, E.S., Porterfield, D.M., 2013. Biosens. Bioelectron. 40, 127–134. Tomita, N., Mori, Y., Kanda, H., Notomi, T., 2008. Nat. Protoc. 3, 877–882. Ueda, S., Kuwabara, Y., 2009. Biocontrol. Sci. 14, 73–76. Wang, G.L., Zhang, C.Y., 2012. Anal. Chem. 84, 7037–7042. Wang, X., Zhu, J.P., Zhang, Q., Xu, Z.G., F. Zhang, Z.H., Zhao, W.Z., Zheng, L.S., Zheng. J., 2012. Virol. Methods 179, 330–334. Weizmann, Y., Beissenhirtz, M.K., Cheglakov, Z., Nowarski, R., Kotler, M., Willner, I., 2006. Angew. Chem. Int. Ed. 118, 7544–7548. Xiang, Y., Zhang, Y.Y., Qian, X.Q., Chai, Y.Q., Wang, J., Yuan, R., 2010. Biosens. Bioelectron. 25, 2539–2542. Zheng, X.X., Liu, Q., Jing, C., Li, Y., Li, D., Luo, W.J., Wen, Y.Q., He, Y., Huang, Q., Long, Y. T., Fan, C.H., 2011. Angew. Chem. Int. Ed. 50, 11994–11998.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Development of an electrochemical method for Ochratoxin A detection based on aptamer and loop-mediated isothermal amplification Shunbi Xie, Yaqin Chai n, Yali Yuan, Lijuan Bai, Ruo Yuan n Key Laboratory of Ministry of Education on Luminescence and Real-Time Analysis, School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 3 September 2013 Received in revised form 2 November 2013 Accepted 4 November 2013 Available online 16 December 2013
Loop-mediated isothermal amplification (LAMP) is an outstanding DNA amplification procedure, in which the reaction can accumulate 109 copies from less than 10 copies of input template within an hour. While the amplification reaction is extremely powerful, the quantitative detection of LAMP products is still analytically difficult. Besides, the type of targets that LAMP can detect is also less, which to some extent limited the application of LAMP. In this study, we are reporting for the first time an efficient and accurate detection system which employs the integration of LAMP, aptamer and the electrochemical method for the sensitive detection of Ochratoxin A (OTA). Aptamers were designed as the forward outer primer to trigger the LAMP reaction, and then the LAMP amplification products were combined with a redox active molecule methylene blue (MB) and analyzed by an electrode using differential pulse voltammograms (DPV). As the reaction progresses, the MB intercalated into double-stranded regions of LAMP amplicons reduces the free MB concentration. Hence, the peak current of reaction mixture decreased with the amplification because of the slow diffusion of MB-amplified DNA complex to the electrode surface. The peak height of the current was related to the input amount of the aptamers, providing a ready means to detection the concentration of OTA. With such design, the proposed assay showed a good linear relationship within the range of 0.001–50 nM with a detection limit of 0.3 pM (defined as S/N¼ 3) for OTA. & 2014 Published by Elsevier B.V.
Keywords: Loop-mediated isothermal amplification Aptamer Electrochemical Ochratoxin A
1. Introduction Signal generation and amplification plays a significant role in improving the sensitivity of a biosensor (Du et al., 2011; Zheng et al., 2011; Shi et al., 2012; Shi et al., 2013). To realize this aim, a series of very powerful isothermal nucleic acid amplification techniques have been developed that have shown promising applications in research, diagnostics, forensics, medicine, and agriculture (Gill, Ghaemi, 2008; Asiello, Baeumner, 2011). These techniques include polymerase chain reaction (PCR) (Ranasinghe, Brown, 2005; Marx, Strerath, 2005), rolling circle amplification (RCA) (Li, Zhong, 2007; Li et al., 2010), strand displacement amplification (SDA) (Weizmann et al., 2006), the isothermal exponential amplification reaction (EXPAR) (Wang, Zhang, 2012; Liu et al., 2012) and loop-mediated isothermal amplification of DNA (LAMP) (Notomi et al., 2000; Fang et al., 2011). Among these techniques, LAMP is especially interesting as it employs only one enzyme and is relatively insensitive to the secondary structure of n
Corresponding authors. Tel.: þ 86 23 68252277; fax: þ 86 23 68253172. E-mail addresses: [email protected] (Y. Chai), [email protected] (R. Yuan).
0956-5663/$ - see front matter & 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.bios.2013.11.009
the amplicon (Li et al., 2012). LAMP is a very sensitive, easy and time saving method that can amplify up to 109 copies of target gene in less than an hour under isothermal conditions (65 1C). The method uses four to six primers that recognize six–eight regions of the target DNA eliminating non-specific binding and thus ensuring the specificity of LAMP. A simple incubator, such as water bath or heating block, is sufficient for the DNA amplification, which makes its use under field conditions feasible (Parida et al., 2008). Despite the attractiveness of the LAMP technique, there are still some potential shortcomings in the quantitative detection of LAMP products. In many cases, the identification of LAMP products is mainly based on a dsDNA-specific fluorescent dye, electrophoresis of amplicons, turbidity due to magnesium pyrophosphate, and the metal ion indicator (Tomita et al., 2008). DNA amplification is visualized by the naked eye either as turbidity or the color change of a fluorescent dye. Even though these methods allow real-time detection, the signals are due solely to the accumulation of basepairs and can easily read false amplicons as the true ones (Njiru et al., 2008; Paris et al., 2007). Besides, although LAMP have made great progress in detections of virus (Wang et al., 2012), bacteria (Han et al., 2011), parasites (Abdul-Ghani et al., 2012), food safeties
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
325
presence of OTA, the OTA aptamers bound with OTA and released from the self-assembled duplex on the electrode into solution. Then the remaining unbound OTA aptamers on the electrode could hybridize with template DNA in the LAMP system. The OTA aptamers perfectly complementary to the sequence of M in template DNA and trigger the LAMP amplification. Finally, the LAMP amplification products were combined with a redox active molecule methylene blue (MB) and analyzed by an electrode using differential pulse voltammograms (DPV). As the reaction progresses, the MB intercalated into double-stranded regions of LAMP amplicons reduces the free MB concentration. Hence, the peak current of reaction mixture decreases with the amplification because of the slow diffusion of MB-amplified DNA complex to the electrode surface. The peak height of the current was related to the input amount of the aptamers, providing a ready means to detection the concentration of OTA.
(Ueda, Kuwabara, 2009) and animal embryo sex identifications (Nogami et al., 2008), its powerful amplification functionality has not been well applied in the field of proteins, small molecules, adenosine and metal ions detection areas, which present some limitations for their practical implementation. In response to such limitations, if we want to utilize LAMP's outstanding characteristics, the first problem that we must be resolved is how to quantity the LAMP products more accurately, and another major effort underway is aimed at how to extend the application range of LAMP. Motivated by these clear needs, we attempted to develop an approach, which integrated LAMP with other detection technology and molecular recognition element, for the sensitive and quantitative detection of various target. Aptamers are synthetic oligonucleotides that can bind a wide range of target molecules (proteins, drugs, amino acids, etc.) with high specificity and selectivity. Owing to their high selectivity, stability, versatile target binding and easy regeneration capabilities over traditional antibodies, there has been a considerable interest in employing aptamers as recognition ligands for biosensor applications (Xiang et al., 2010). We therefore sought to transduce the aptamers into LAMP for the purpose of extending the application range of LAMP. Electrochemical methods have received particular attention, owing to their distinct advantages of speed, sensitivity, cost and portability. Recently, a few research groups have reported the electrochemical detection methods for amplified DNA by LAMP. Ahmed et al. (2013) reported a real-time electrochemical method for pathogen DNA detection using electrostatic interaction of a redox probe. Nagatani et al. (2011) reported the electrochemical LAMP product detection method by using Hoechst 33258. Hsieh et al. (2012) also reported a rapid, sensitive, and the quantitative method to detection Pathogenic DNA at the point of care through microfluidic electrochemical quantitative LAMP. In such strategies, the detection of LAMP products did not require any probe immobilization on an electrode by using electroactive reagents such as Hoechst 33258 or methylene blue (MB) and showed promising results.
Ochratoxin A (OTA), hexanethiol (96%, HT), gold chloride (HAuCl4) and bataine were purchased from Sigma (St. Louis, MO). Bst polymerase large fragments, MgSO4 and the deoxynucleotide triphosphates (dNTPs) were purchased from New England Biolabs Ltd. (Beijing, China). Tris-hydroxymethylaminomethane hydrochloride (tris) was obtained from Roche (Switzerland). K3[Fe(CN)6] and K4[Fe(CN)6] were purchased from Beijing Chemical Reagent Co. (Beijing, China). All HPLC-purified DNA oligonucleotides were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The template DNA was synthesized by Integrated DNA Technologies, Inc. (IDT, USA). The oligonucleotide sequences are summarized as follows: Template DNA:
However, all of these assays are signal-off platform, in which the method itself has some limitations. In spite of this shortcoming, by combining the advantages of electrochemical method, these assays also promise a novel pathway to achieve the qualitative and quantitative detection of the LAMP amplification. In this article, to both improve the specificity of LAMP detection and to make direct readout of LAMP amplification simpler and much more reliable, we have developed an signal-on electrochemical aptasensor that combines the amplification power of LAMP, the versatile target binding of aptamer and the inherent high sensitivity of the electrochemical method for the rapid analysis of targets for the first time. As a model system, we chose the small molecules OTA as the interest target. The mechanism and LAMP reaction steps for OTA detection are illustrated in Scheme 1. The capture DNAs (cDNA) were firstly self-assembled on gold nanoparticles modified electrode. Then OTA aptamers were immobilized on the electrode via partially hybridized with cDNA. In the
Primer FIP (F1c–F2): 5'–ACAACGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC-3' Primer BIP (B1c–B2): 5'–CGACTCTAGAGGATCCCCGGGTACTTTTTGTTGTGTGGAATTGTGAGCGGAT-3' Primer B3: 5'–ACTTTATGCTTCCGGCTCGTA-3' Capture DNA: 5'–TGTCCGATGC-(CH2)6-SH-3' Aptamer: 5'–GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3' (bold font domain is the complementary sequence to the capture DNA) 20 mM Tris–HCl buffer (pH 7.4) containing 140 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 was used as a binding buffer. Phosphate-buffered solution (PBS) (pH 7.0, 0.1 M) containing 10 mM KCl, 2 mM MgCl2 was used as working buffer solution. All other chemicals were of analytical grade and used as received. Electrochemical experiments, including electrochemical impedance spectroscopy (EIS), differential pulse voltammetry (DPV) and cyclic voltammetry (CV), were carried out with a CHI 660B
2. Experimental section 2.1. Reagents and apparatus
326
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
Scheme 1. Schematic illustration of OTA detection principle using electrochemical method based on aptamer and LAMP. (a) The redox and the amplicons after amplification at zero concentration of OTA which produced the lower current and (b) the redox and the amplicons after amplification at highly concentration of OTA which produced higher current as observed by DPV.
electrochemistry workstation (Shanghai CH Instrumission, China). The pH measurements were finished with a pH meter (MP 230, Mettler-Toledo, Switzerland). A three-electrode system contained a modified glassy carbon electrode (GCE, Φ ¼4 mm) as working electrode, a platinum wire as auxiliary electrode and a saturated calomel electrode (SCE) as a reference electrode. 2.2. Electrochemical measurements All electrochemical experiments were carried out in a conventional electrochemical cell containing a three-electrode arrangement. CVs of the electrode fabrication were performed in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl, scanning from 0.6 V to 0.2 V at a scan rate of 50 mV/s. Electrochemical impedance spectroscopy (EIS) was carried out in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl with the frequencies swept from 0.1 to 105 Hz. The electrode was immersed into 1 mL 0.1 M PBS (pH 7.0) containing the LAMP production, the response of MB was measured by differential pulse voltammetry (DPV). The DPV measurement was taken: the potential range was from 0.4 to 0 V, modulation amplitude was 0.05 V, pulse width was 0.05 s, and sample width was 0.0167 s. 2.3. Fabrication of the modified electrodes Prior to use, GCE was polished carefully with 0.05 and 0.3 μm alumina powder on fine abrasive paper sequentially and then washed ultrasonically in water and ethanol for a few minutes. Firstly, AuNPs were deposited onto the GCE in 1% HAuCl4 solutions
at the potential of 0.2 V for 30 s, immediately, 20 μL of 2.5 μM capture DNA solution was cast on the AuNPs-GCE at 4 1C for 16 h. To eliminate nonspecific binding effects, the modified electrode was followed by incubating with 20 μL of 1.0 mM HT for 45 min at room temperature. And then 20 μL of the OTA aptamer (2.5 μM) solution was dropped on the modified electrode surface for 2 h at room temperature. After rinsed with the washing buffer solution, the fabricated aptasensor was dropped with 20 μL of a fixed concentration of OTA for 40 min. Finally, the resulting electrode was rinsed with the washing buffer solution and was ready for the next step. 2.4. The LAMP reaction The LAMP system, which consists of a template DNA, forward inner primer (FIP), backward inner primer (BIP) and backward outer primer B3, is designed according to the literature (Li et al., 2011) with some modifications. LAMP reaction was carried out in a total of 500 μL reaction mixture containing 375 μL PBS (pH 7.0, 0.1 M), 100 μL MB (40 μM), 2 μL 10 Thermol Pol Buffer, 1 μL MgSO4 (8 mM), 3 μL betaine (1.0 M), 5 μL dNTPs (1.4 mM), 2 μL of each high performance liquid chromatography (HPLC)-graded inner primers, FIP and BIP (2.5 μM), 1 μL of backward outer primer B3 (2.5 μM), followed by the addition of 8U of Bst polymerase. 5 μL of DNA template approximately 100 ng/μl was eventually added to the reaction mixture. Finally, the modified electrode described above was immersed into the solution of the LAMP system, and then the reaction mixture was incubated at 65 1C for 60 min and at 80 1C for 4 min in order to terminate the reaction.
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
3. Results and discussion 3.1. Working principle of the LAMP amplification reaction The template DNA successively contains the sequences of B3, B2, B1, F1c, F2c and M. As the Fig. 1 illustrated, in the initial step, FIP hybridizes to F2c in the template DNA and extends in the presence of Bst DNA polymerase and dNTPs. Thereafter, the OTA aptamer hybridizes to M in the template DNA and initiates the strand displacement DNA synthesis (SDS) based on the catalytic activity of the extension along the DNA template and the strand displacement activity of Bst DNA polymerase, releasing a FIPlinked single strand DNA (ssDNA), which can form a stem-loop structure at the 5' terminus through the hybridization between F1 and F1c. BIP contains the sequence B1c, a TTTT spacer and B2 complementary to B2c. At the 3' terminus of the ssDNA, BIP hybridizes to B2c to perform the primer extension and then the back outer primer B3 hybridizes to B3c in the 3' terminus of the ssDNA to perform the SDS, releasing a BIP-linked ssDNA which can form double stem-loop structures at 3' and 5' terminus, respectively. And then as demonstrated in the previous reports (Tomita et al., 2008), the FIP, BIP primers and the DNA strand-displacing polymerase enable the production of dumbbell-shaped intermediate structures and stem-loop and cauliflower-like amplicons in a continuous manner.
Fig. 1. Schematic representation of the LAMP reaction initiated by the OTA aptamer.
327
Initially, the redox reporter MB molecules within the LAMP reaction solution are free, producing a measurable high current signal. As the reaction progresses, the intercalation of DNA-binding MB molecules into newly formed amplicons double-stranded regions of LAMP amplicons reduces the free MB concentration and thus decreases the redox current. The peak height of the current was related to the extent of amplification of DNA and the input amount of OTA aptamer. The more OTA detected, the less OTA aptamer remained on the electrode, resulting less newly formed amplicons with high current signal of MB. Thus a signal on assay was fabricated for OTA sensitivity detection. 3.2. The electrochemical characterization of the stepwise modified electrodes To characterize the modified electrodes, the assembly steps of the sensing interface were investigated by CV measurements. CVs of different modified electrodes that investigated in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl were shown in Fig. 2A. As can be seen, a well-defined redox peak of [Fe(CN)6]3 /4 was observed at the bare electrode (curve a). Curve b showed the electrodeposition of AuNPs on the GCE, the peak current was increased, indicating that the AuNPs could promote the electron transfer. After the thiol-modified capture DNA was immobilized on the modified electrode, the redox peak current decreased (curve c), which was attributed to the capture DNA block the electron transfer on the electrode surface. Subsequently, the modified electrode was treated with HT to block nonspecific site, a further decrease of peak current (curve d) was observed. After assembling OTA aptamer, the steric hindrance was further increased, resulting in further decrease in current (curve e). With the introduction of OTA (curve g), OTA combined with the OTA aptamer, which resulted in less DNA being on the electrode surface. Thus, an increased peak current was observed, which was higher than the peak current of the HT-modified electrode and lower than that of the OTA aptamer-DNA modified electrode. The differences of the CVs in different modified stages clearly reflected the changes in each stage of the electrode surface. As one of the electrochemical technologies, electrochemical impedance spectroscopy (EIS) has been proven to be one of the most powerful tools for interfacial investigation (Li et al., 2005). Thus, in this work, we employed EIS to further confirm the assemble process of the aptasensor. Fig. 2B showed the Nyquist plots of impedance spectra at different electrodes. The bare GCE electrode showed a very small semicircle domain implying very fast electron-transfer process (curve a). Owing to conductivity of AuNPs, a decrease of semicircle diameter was obtained after the electrochemical deposition (curve b). However, after the consecutive
Fig. 2. The electrochemical characterization of the stepwise modified electrodes: CV (A) and EIS (B) of bare GCE (a); GCE/Au (b); GCE/Au/capture DNA (c); GCE/Au/ capture DNA/HT (d); GCE/Au/ capture DNA/HT/aptamer (e); GCE/Au/capture DNA/HT/aptamer/OTA (f) in 2 mL 5 mM K3[Fe(CN)6] and K4[Fe(CN)6] solution containing 0.2 M KCl. Scan rate: 50 mV/s.
328
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
assembling of negative capture DNA, inert HT and negative OTA aptamer, the resistances were increased with the stepwise increase of semicircle diameter (curve c, d, e, respectively). The resistance clearly decreased when the electrode was incubated with OTA (curve f). The results indicated that a sensing interface was effectively constructed. The results indicated that a sensing interface was effectively constructed.
0.8 mM to 4.0 mM, indicating that the MB embedded in the newly formed amplicons has not reached the saturation point. When the MB concentration reached 4.8 mM, the current value suddenly increases, indicating that the MB concentration in the solution is supersaturated. Therefore, we have chosen 4.0 mM for its appropriate and sufficient signal acquisition without any inhibition of isothermal amplification over time.
3.3. Optimization of the experimental conditions 3.4. The detection of OTA based on DPV In order to maximize the efficiency and sensitivity of the system, the optimization of the experimental conditions such as the incubation time of OTA aptamer with OTA and the MB concentration were investigated. OTA binding with its aptamer caused the aptamer release from electrode, more aptamer was released, the less amplicons were produced by the LAMP amplification, and ultimately resulting an incease current signal. Therefore, the incubation time of the OTA aptamer binging with OTA is a very important impact on the experimental results. The OTA aptamers bound with OTA and released from the electrode into solution, thus the CV response signal for OTA increased from 10 min to 40 min and changed very little after 40 min (Fig. 3 A). Therefore, the time of 40 min was selected for the incubation time. The concentration of MB also intensely influenced the sensitivity of biosensor. The MB was elected to apply in a series of concentrations (Fig. 3B). At the beginning, the current response changed slowly with the MB concentration increasing from
Under the optimal conditions, a bare electrode was immersed in solutions of different concentrations of OTA LAMP amplification and the DPV responses were recorded. Fig. 4 showed the calibration curves corresponding to the DPV detection of OTA in the PBS (pH 7.0) based on the changes of current intensity (ΔI). As expected, a linear relationship between the difference of the peak current and background (ΔI) and the logarithm of the concentration of OTA (log cOTA) was obtained in the range of 0.001–50 nM. The linear equation was ΔI (μA)¼ 0.1086 log cOTA (nM) 0.5607 with a correlation coefficient of 0.9901 and an evaluated detection limit of 0.3 pM. In addition, the analytical performance of the developed aptasensor for OTA detection was compared with those of other methods reported in the literatures. The results were summarized in Table S1 (see Supplementary material). It can be seen that the linear range and detection limit of the proposed assay was greatly improved and a lower detection limit was achieved.
-4.2 -3.9
I / µA
-4.0 -3.5 -3.0 -2.5 -2.0 -1.5 -1.0 -0 4 .5 0.0 1 4 .8 3.2 .0 -0. .2 M 2 0 3 /n 1. .4 -0. 4 0.8 6 B -0. cM
-3.3
E
I / µA
-3.6
/
V
-3.0 -2.7 0
1
2
3
4
5
cMB / nM Fig. 3. The optimization of experimental parameter: (A) influence of OTA and aptamer incubation time on the current response. The inset shows the dependence of peak currents on each incubation time. (B) The optimum concentration of MB. The inset shows the dependence of peak currents on each concentration of MB.
Fig. 4. (A) DPVs of OTA detection at different concentrations: 0 nM, 0.001 nM, 0.01 nM, 0.1 nM, 1 nM, 10 nM, 50 nM. Detection buffer: PBS (pH 7.0). (B) The calibration plot of current intensity vs. log cOTA.
S. Xie et al. / Biosensors and Bioelectronics 55 (2014) 324–329
329
we preserve the best features as follows: LAMP provides high sensitivity and specificity for molecular detection, while also providing LAMP modularity, ease of readout, and suppression of parasite detection; We anticipate that this combination will ultimately make LAMP much more useful for the vary types of target. In this paper, the LAMP-based assay was only applied to OTA detection, while the scheme can be easily designed for other targets by changing the corresponding aptamer without other conditions, making this method potentially universal.
Acknowledgments
Fig. 5. DPV current of aptasensor after incubation with different targets.
3.5. The specificity of current assay The specificity of the developed aptasensor was tested by the incubation reaction of dsDNA on the aptasensor surface with different targets at the same condition. Several 10 nM nontargets including protein thrombin, small molecules cocaine and OTA's dechlorinated analog Ochratoxin B (OTB) were assayed to investigate the specificity of the method. Due to the inherent specificity of the aptamer toward its target, the electrochemical signal for the sensing system presented high selectivity as shown in Fig. 5. Only OTA (1 nM) can induce remarkable signal, even 10-fold higher concentrations than that of OTA, rather low signals were found for the nontargets. It indicated that the developed method possessed high specificity for the OTA detection. 3.6. Evaluation of real samples OTA is a common contaminant of wine and it is report that OTA is detected more ordinarily in red wines than in roses and white wines due to its special wine making procedure (Ottender, Majerus, 2000). In this experiment, the assay of the target OTA in a series of real samples was investigated by detecting OTA in red wine. The standard addition method was employed to evaluate the applicability of the proposed method. Herein, a series of samples were prepared by adding OTA of different concentrations to red wine (obtained from the local supermarket). The recoveries were calculated by the found amount/added amount ratio, and the data were given in Table S2. From Table S2 (see Supplementary material ), we could see that the recovery (between 97.4% and 108%) and relative standard deviation values (between 4.3% and 7.8%) were acceptable, which indicated the potentiality of this method for OTA detection in real biological samples. 4. Conclusions In summary, we have demonstrated that the LAMP reaction can be applied to ultrasensitive detection of OTA. By using OTA aptamer to initiate the LAMP reaction and quantitative electrochemical detection of LAMP amplification by monitoring the intercalation of DNA-binding methylene blue (MB) redox reporter molecules into newly formed amplicons with an electrode, as low as 0.3 pM OTA can be accurately determined. Besides, the proposal method was designed as a signal-on platform which has the advantages of high sensitivity, low background signal and outstanding accuracy. By pairing a novel amplification technique, LAMP combines with aptamer and electrochemical technique,
This work was financially supported by the NNSF of China (21075100, 21105081), State Key Laboratory of Electroanalytical Chemistry (SKLEAC2010009), the Fundamental Research Funds for the Central Universities (XDJK2012A004), Specialized Research Fund for the Doctoral Program of Higher Education (20100182110015), Ministry of Education of China (Project 708073).
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2013.11.009. References Abdul-Ghani, R., Al-Mekhlafi, A.M., Karanis, P., 2012. Acta Trop. 122, 233–240. Ahmed, M.U., Nahar, S., Safavieh, M., Zourob, M., 2013. Analyst 138, 907–915. Asiello, P.J., Baeumner, A., 2011. J. Lab. Chip 11, 1420–1430. Du, Y., Guo, S., Dong, S., Wang, E., 2011. Biomaterials 32, 8584–8592. Fang, X.E., Chen, H., Yu, S.N., Jiang, X.Y., Kong, J.L., 2011. Anal. Chem. 83, 690–695. Gill, P., Ghaemi, A., 2008. Nucleotides Nucleic Acids 27, 224–243. Han, H.J., Jung, S.J., Oh, M.J., Kim, D.H., 2011. J. Fish Dis. 34, 395–398. Hsieh, K., Patterson, A.S., Ferguson, B.S., Plaxco, K.W., Soh, H.T., 2012. Angew. Chem. Int. Ed. 51, 4896–4900. Li, B.L., Chen, X., Ellington, A.D., 2012. Anal. Chem. 84, 8371–8377. Li, C.P., Li, Z.P., Jia, H.X., Yan, J.L., 2011. Chem. Commun. 47, 2595–2597. Li, C.Z., Liu, Y.L., Luong, J.H.T., 2005. Anal. Chem. 77, 478–485. Li, J.S., Zhong, W.W., 2007. Anal. Chem. 79, 9030–9038. Li, J.S., Deng, T., Chu, X., Yang, R.H., Jiang, J.H., Shen, G.L., Yu, R.Q., 2010. Anal. Chem. 82, 2811–2816. Liu, Y.Q., Zhang, M., Yin, B.C., Ye, B.C., 2012. Anal. Chem. 84, 5165–5169. Marx, A., Strerath, M., 2005. Angew. Chem. Int. Ed. 44, 7842–7849. Nagatani, N., Yamanak, K., Saito, M., Koketsu, R., Sasaki, T., Ikuta, K., Miyahara, T., Tamiya, E., 2011. Analyst 136, 5143–5150. Njiru, Z.K., Mikosza, A.S.J., Armstrong, T., Enyaru, J.C., Ndung'u, J.M., Thompson, A.R. C., 2008. PLoS Negl. Trop. Dis. 2, 147–153. Nogami, H., Tsutsumi, H., Komuro, T., Mukoyama, R., 2008. Forensic. Sci. Int. Genet. 2, 349–353. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Nucleic Acids Res. 28, E63. Ottender, H., Majerus, P., 2000. Food Addit. Contam. 17, 793–798. Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., 2008. Rev. Med. Virol. 18, 407–421. Paris, D.H., Imwong, M., Faiz, A.M., Hasan, M., Bin Yunus, E., Silamut, K., Lee, S.J., Day, N.P.J., Dondorp, A.M., 2007. Am. J. Trop. Med. Hyg. 77, 972–976. Ranasinghe, R.T., Brown, T., 2005. Chem. Commun. 44, 5487–5502. Shi, J., Zhang, H.Y., Snyder, X., Wang, M.X., Xie, J., Porterfield, D.M., Stanciu, L.A., 2012. Biosens. Bioelectron. 38, 314–320. Shi, J., McLamore, E.S., Porterfield, D.M., 2013. Biosens. Bioelectron. 40, 127–134. Tomita, N., Mori, Y., Kanda, H., Notomi, T., 2008. Nat. Protoc. 3, 877–882. Ueda, S., Kuwabara, Y., 2009. Biocontrol. Sci. 14, 73–76. Wang, G.L., Zhang, C.Y., 2012. Anal. Chem. 84, 7037–7042. Wang, X., Zhu, J.P., Zhang, Q., Xu, Z.G., F. Zhang, Z.H., Zhao, W.Z., Zheng, L.S., Zheng. J., 2012. Virol. Methods 179, 330–334. Weizmann, Y., Beissenhirtz, M.K., Cheglakov, Z., Nowarski, R., Kotler, M., Willner, I., 2006. Angew. Chem. Int. Ed. 118, 7544–7548. Xiang, Y., Zhang, Y.Y., Qian, X.Q., Chai, Y.Q., Wang, J., Yuan, R., 2010. Biosens. Bioelectron. 25, 2539–2542. Zheng, X.X., Liu, Q., Jing, C., Li, Y., Li, D., Luo, W.J., Wen, Y.Q., He, Y., Huang, Q., Long, Y. T., Fan, C.H., 2011. Angew. Chem. Int. Ed. 50, 11994–11998.
