Journal of Virological Methods 220 (2015) 13–17
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of an immunochromatographic strip test for rapid detection of lily symptomless virus Yubao Zhang a , Yajun Wang a , Jing Meng b , Zhongkui Xie a,∗ , Ruoyu Wang a , Hadley Randal Kutcher c , Zhihong Guo a a
Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Lanzhou 730000, China Ningxia Agricultural Comprehensive Development Office, Yinchuan 750002, China c College of Agriculture and Bioresources, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada b
a b s t r a c t Article history: Received 14 January 2015 Received in revised form 26 March 2015 Accepted 26 March 2015 Available online 4 April 2015 Keywords: Immunonochromatographic strip LSV PCR Rapid detection
A rapid immunochromatographic strip (ICS) test for specific detection of lily symptomless virus (LSV) was developed. The test is based on a double-antibody sandwich format and employs two distinct antiLSV polyclonal antibodies (IgG1 and IgG2 ). The first antibody, IgG1 was used as the detection antibody conjugated to colloidal gold and the second antibody, IgG2 was used to as the capture antibody at the test line. The performance of the ICS test was evaluated and the results obtained were compared with a quadruplex RT-PCR assay. When serial dilutions of purified LSV were tested, the LSV detection limit of the ICS test was 6.0 × 10−8 mg/mL, which was the same as the quadruplex RT-PCR assay. Relative to quadruplex RT-PCR, the specificity and sensitivity of the ICS were 98.6% and 100%, respectively for field leaf samples. There was significant agreement between the results of the ICS and quadruplex RT-PCR tests ( = 0.983). Compared with conventional lily virus detection methods, our ICS test has many advantages: simple, fast, low cost, high sensitivity and specificity, and has applications in the laboratory and in the field to detect and control LSV. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Lanzhou lily (Lilium davidii var. unicolor) is an important edible bulb crop as well as a traditional medicinal plant with a 150year cultivation history in the Lanzhou area of northwestern China (Wang et al., 2010). It is famous for its large size, thick white flesh, and sweet taste. It is also is an important ornamental plant because of its flaming and flamboyant coloration. The economic importance of the Lanzhou lily has increased greatly during the past decade because of the rapid increase in demand for this plant. However, cultivars of the Lanzhou lily are seriously affected by viral infections, which have decreased lily production by 50% in recent years. Lily symptomless virus (LSV; Genus Carlavirus, family Flexiviridae) is the most common virus that infects Lanzhou lily (Wang
∗ Corresponding author at: Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, No. 320 Dong Gang West Road, Lanzhou 730000, China. Tel.: +86 931 496 7206; fax: +86 931 827 3894. E-mail addresses: [email protected] (Y. Zhang), [email protected] (Y. Wang), [email protected] (J. Meng), [email protected], [email protected] (Z. Xie), [email protected] (R. Wang), [email protected] (H.R. Kutcher), [email protected] (Z. Guo). http://dx.doi.org/10.1016/j.jviromet.2015.03.021 0166-0934/© 2015 Elsevier B.V. All rights reserved.
et al., 2007); it has been reported in the United States, Europe, Australia, and Asia (Singh, 2005). LSV is a filamentous particle, 640 nm in length and 17–18 nm in diameter. The genomic RNA of LSV comprises 8394 nucleotides and contains six open reading frames (ORFs). The ORF5 (7140–8015 nucleotides) encodes a coat protein (CP) of 291 amino acids, and the genomic RNA of LSV is encapsulated in a single type of CP with a molecular weight of 32 kDa (Choi and Ryu, 2003). The host range of LSV is restricted to Liliaceae (Singh, 2005). It is one of the most prevalent viruses of lilies that causes quantitative and qualitative aspects of yield reduction of bulbs and flowers (Asjes, 2000). Viral diseases represent some of the most dangerous threats to Lanzhou lily, so it is important to develop fast and effective diagnostic techniques for early detection. However, the most commonly used methods to detect viruses, including LSV in lily samples are electron microscopy (Wang et al., 2007), enzyme-linked immunosorbent assay (ELISA; Sharma et al., 2005), the polymerase chain reaction (PCR; Niimi et al., 2003; Zhang et al., 2010), and the real-time PCR (Nesi et al., 2013). However, these methods are limited by their lengthy test time, the technical expertise required, and the necessity for specialized laboratory equipment. Therefore, these methods are unsuitable for widespread use to support the production of Lanzhou lily, and it is necessary to
14
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
develop a rapid, specific, and easily performed LSV assay. The immunochromatographic assay offers several advantages over traditional immunoassays, such as its low cost, procedural simplicity, limited requirements for special skills or expensive equipment, and rapid results (Alvarez et al., 2010). This assay has thus been widely applied to detect hormones, bioactive molecules, contagious human diseases, animal and plant viruses, bacteria and parasite antigens, and their antibodies (Zhang et al., 2008; Sun et al., 2013). The aim of the present study was to develop an immunochromatographic test strip (ICS) for rapid and accurate detection of LSV. The sensitivity and specificity of the ICS were evaluated using a quadruplex reverse transcriptase (RT)-PCR assay as a reference test. In detection trials, 120 Lanzhou lily samples from the field were analyzed using both the quadruplex RT-PCR assay and the ICS test. The results showed excellent agreement between the tests ( = 0.983). 2. Materials and methods 2.1. Reagents and materials Naturally infected Lily plants showing typical dwarfing, or leaves displaying chlorotic, yellow spots or stripes, or mosaic symptoms were collected in fields of the Gaolan Research Station (36◦ 05 N, 103◦ 31 E) in Lanzhou, Gansu province, China. Leaves near the flower bud were tested by RT-PCR according to the method of Zhang et al. (2010). As a result, leaves from single plants that tested positive for LSV, CMV or LMoV served as sources of LSV, CMV and LMoV viruses and were stored at −70 ◦ C. The first antibody, IgG1 -rabbit IgG anti-native LSV and the second antibody IgG2 -rabbit IgG anti-recombinant LSV CP were produced and purified following the methods of Wang et al. (2007, 2010). Both of the antibodies were kept in aliquots of 1 mg at −20 ◦ C for 1 year. We purchased chloroauric acid (HAuCl4 ) and goat anti-rabbit IgG from the Sigma Company (St. Louis, MO, USA), nitrocellulose membranes (HiFlow-120) and cellulose filter from Millipore (Billerica, MA, USA), and special cellulose and absorbent papers from Jieyi Company (Shanghai, China). 2.2. Preparation of colloidal gold and colloidal gold-IgG1 conjugates Colloidal gold particles with a mean diameter of 30 nm were prepared by the method of Hermanson (2008). Under constant stirring, 1.4 mL of 1% trisodium citrate (w/v) was added to 100 mL of 0.01% aqueous chloroauric acid solution (w/v) at 100 ◦ C and boiled for 5 min. As the resulting colloidal gold cooled gradually to room temperature, with continuous stirring, we maintained the pH at 7.5 by adding 0.1 M potassium carbonate. Sodium azide was added to a final concentration of 0.01% (w/v) before storage at 4 ◦ C in a glass bottle covered with foil. The absorption maxima (max ) of the solutions were analyzed by means of ultraviolet/visible spectroscopy (UV/vis) using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) to determine the approximate particle sizes, which were confirmed by transmission electron microscopy (TEM) measurements using a JEM-1230 transmission electron microscope (TEM; JEOL, Tokyo, Japan). To prepare the colloidal gold-IgG1 conjugates, IgG1 (160 L at 1.0 mg/mL) was added drop-wise to 10 mL of the pH-adjusted colloidal gold solution. The mixture was stirred vigorously for 30 min, and then 2.5 mL of 10% (w/v) bovine serum albumin (BSA) was added to block excess reactivity of the gold colloid. The mixture was then stirred for an additional 30 min. After centrifuging the mixture at 10,000 × g and 4 ◦ C for 30 min, the gold pellets were
resuspended in 1 mL of dilution buffer (20 mM Tris/HCl buffer at pH 8.2 containing 1% (w/v) BSA, 3% (w/v) sucrose, and 0.02% (w/v) sodium azide). The colloidal gold conjugate was then stored at 4 ◦ C until use. 2.3. Preparation of the immunochromatographic strip (ICS) The ICS included four components: a sample pad (special cellulose paper), a conjugate release pad (cellulose filter), a nitrocellulose membrane, and an absorbent pad (absorbent paper). The sample pad was treated with 20 mM phosphate buffer (PBS) containing 1% (w/v) BSA, 0.5% (v/v) Tween-20, and 0.05%(w/v) sodium azide at pH 7.4, and was then dried for 2 h at 37 ◦ C. First, a control line was formed by carefully dragging a pipette tip containing 100 L of the goat anti-rabbit IgG (at 2.0 mg/mL) along the long axis of the nitrocellulose membrane. The tip was guided against a ruler placed 6 mm from one end of the membrane. Immediately following this procedure, the same process was repeated to generate a test line using the IgG2 (at 1.5 mg/mL). A 5-mm gap was left between two lines. Subsequently, the membrane was allowed to dry completely for at least 2 h at room temperature and was then attached to a backing plate. An 18 mm × 5 mm absorbent pad was applied at the downstream end of the nitrocellulose membrane. This material was used as the “sink pad”. Next, a 5 mm × 5 mm cellulose filter pad was impregnated with 15 L colloidal gold-IgG1 solution and left to dry overnight at room temperature. The resulting “conjugate release pad” together with a 20 mm × 5 mm “sample pad” was placed at the opposite end of the sink pad to complete the test strip. These strips were housed in plastic cases and then stored at 4 ◦ C under desiccated conditions until use. 2.4. The immunochromatographic assay If the sample tested contained LSV, the LSV reacted with IgG1 conjugated to colloidal gold. The complex IgG1 -LSV-gold then migrated into the nitrocellulose membrane by capillary action and subsequently reacted with the immobilized IgG2 in the test line. Unbound IgG1 -colloidal gold particles ran over the test line and reacted with the goat anti-rabbit IgG at the control line to form a second visible purple–red band. About 100 L of the tested sample was applied to the plastic cassette sample window. The result was read between 5 and 10 min after the addition of the sample. The sample was considered positive if two distinct purple-red lines appeared, one in the test region and the other in the control region; negative when no line appeared in the test region, and invalid if the control line failed to appear. 2.5. Specificity and sensitivity of the ICS test To evaluate the cross-reactivity of the ICS test strip, we tested LSV and two other common lily viruses (cucumber mosaic virus, CMV, and lily mosaic virus, LMoV) from field samples collected from the Gaolan Research Station, using the ICS. LSV positive leaves were used as a positive control and virus extraction buffer (0.2 M Tris/HCl buffer (pH 7.5) containing 10 mM EDTA-Na2 , 0.1% (w/v) polyvinyl polypyrrolidone and 0.1% (v/v) 2-mercaptoethanol) was used as a negative control. The sensitivity of the ICS test was evaluated by testing a series of 10-fold dilutions of the purified LSV solution (at 6.0 × 10−1 mg/mL), which was analyzed as virus antigen by means of western blotting using the IgG2 protein at a concentration of 2.0 × 10−2 mg/mL. Each dilution was then added to an ICS test, and the sensitivity was determined from the end-point dilution. In addition, we determined the specificity and the sensitivity of the ICS test compared with the quadruplex RT-PCR assay (Zhang et al., 2010). Briefly, we used four pairs of primers (Table 1) simultaneously to detect LMoV, LSV, CMV, and the lily 18S
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
15
Table 1 Sequence and position of the PCR primers used in the quadruplex RT-PCR assay. Virus
GeneBank accession no.
Fragment size (bp)
Sequence 5 –3
Sense
Position
LSV
DQ531052
198
CMV
DQ767971
248
LMoV
AJ564636
395
18SrRNA
AY684927
303
TATGGGCTTCCAATACAAC TATTCGGTTTCCAGGTTC CTTTGTAGGGAGTGAACGCTGTA AGATGGCGGCAACGGATA TGGCACCTCACCAAATGTA CATCATCTGCTGTATGCCTCT ATACCGTCCTAGTCTCAACC ACAAATCGCTCCACCAAC
+ − + − + − + −
618–636 815–832 171–193 418–435 390–408 784–804 971–990 1273–1290
rRNA housekeeping gene (as an internal control). Total RNA was extracted from the above leaf samples and a series of 10-fold dilutions of the purified viral samples by using the RNAprep pure Plant Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. The first strand of cDNA was synthesized by MMLV reverse transcriptase with the Oligo (dT)-18 primer (TaKaRa Biotech, Dalian, China). Quadruplex PCR was carried out in 25 L volumes containing 2 L the cDNA product, 4 mM Mg2+ , 0.6 mM dNTPs, 0.625U of Taq polymerase (TaKaRa EX Taq, TaKaRa Biotech, Dalian, China), and 0.2 M of each quadruplex sense and anti-sense primer (Table 1). The PCR amplification consisted of 30 cycles at 94 ◦ C for 30 s, 52.5 ◦ C for 45 s, and 72 ◦ C for 1 min. The quadruplex RT-PCR products were checked by electrophoresis on a 2.0% agarose gel and were of the expected sizes (395, 198, 248, and 303 bp, respectively). 2.6. Detection of LSV in field samples
Fig. 1. TEM image of the colloidal gold particles.
A total of 120 individual Lanzhou lily leaf samples were collected from fields at Xiguoyuan in Lanzhou, Gansu Province, and used for detection of LSV. Viral extracts were prepared by grinding 500-mg leaf samples from each plant in 2.5 mL of virus extraction buffer at a ratio of 1:5 (tissue weight [g]: buffer volume [mL]). The extracts were centrifuged at 1500 × g for 5 min. The liquid supernatants were collected and used as the detection samples in the ICS test. In addition, each leaf sample was tested using quadruplex RT-PCR assays to provide a comparison. RNA extraction and quadruplex PCR were performed as described above. 3. Results 3.1. Identification of the colloidal gold particles The prepared colloidal gold solution was deep red and had high light transmission. The UV/vis absorption spectrum from 400 to 600 nm showed a peak at about 528 nm caused by surface resonance of the colloidal gold particles (data not shown). The TEM image shows that the colloidal gold particles were almost uniform in size, which provided the best basis for preparation of the ICS (Fig. 1). 3.2. Specificity and sensitivity of the ICS To determine the specificity of the ICS, we tested for LSV and the two other viruses simultaneously. The samples of healthy leaves and those containing CMV and LMoV produced a single strong band in the control line of the ICS; LSV produced an additional band in the test line (Fig. 2A). All the samples were also tested by means of quadruplex RT-PCR, which produced the same results as the ICS test (Fig. 2B). Thus, the ICS has high specificity for LSV. The sensitivity of the ICS test was determined by means of serial dilutions of purified native products of LSV, ranging from 6.0 × 10−1 mg/mL to 6.0 × 10−9 mg/mL. Western blotting revealed
Fig. 2. Specificity of detection by (A) the ICS and (B) amplification by quadruplex RT-PCR for healthy leaf samples and for samples containing CMV, LMoV, or LSV. Lane M, DL600 marker; lane 1, negative control; lane 2, healthy control; lane 3, CMV; lane 4, LMoV; lane 5, LSV; lane 6, positive control (LSV + CMV + 18S rRNA + LMoV).
that the purified native LSV bound to the 32 kDa IgG2 protein (Fig. 3). All dilutions were tested by ICS and quadruplex RT-PCR. The diluted samples revealed the same detection limits for ICS and quadruplex RT-PCR, at approximately 6.0 × 10−8 mg/mL (Fig. 4A and B). The quantification test revealed that the ICS had the same detection sensitivity as the quadruplex RT-PCR assay.
16
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17 Table 2 Detection of LSV in field leaf samples by the ICS test and by the quadruplex RT-PCR assay. RT-PCR
ICS Positive Negative Total
Positive
Negative
Total
48 0 48
1 71 72
49 71 120
Compared to the quadruplex RT-PCR assay the specificity of the ICS test: 71/(1 + 71) × 100% = 98.6%, and the sensitivity of the ICS test: 48/(0 + 48) × 100% = 100%. Po = (48 + 71)/120 = 0.992. Pe = (48/120) × (49/120) + (72/120) × (71/120) = 0.518. = (Po – Pe )/(1 – Pe ) = 0.983.
Fig. 3. Western blot analysis of the purified LSV using IgG2 antibodies: M, protein markers; blank lane, negative control. The 32 kDa fragment is the LSV target protein.
Fig. 4. Sensitivity comparison between the ICS test and the quadruplex RT-PCR assay. (A) 6.0 × 10−1 mg/mL of purified LSV was serially diluted 10-fold to 6.0 × 10−9 ; LSV could be detected to 6.0 × 10−8 mg/mL by the ICS test. (B) 6.0 × 10−8 mg/mL of LSV could also be detected by quadruplex RT-PCR (6.0 × 10−1 mg/mL of LSV was serially diluted from 6.0 × 10−1 to 6.0 × 10−10 ; lanes 3–12); M, DL600 marker; lane 1, negative control; lane 2, healthy control; lane 13, positive control (LSV + CMV + 18S rRNA + LMoV).
3.3. Experimental detection of LSV in field samples We analyzed 120 field samples of Lanzhou lily leaves using the quadruplex RT-PCR assay and the ICS. Of the 120 samples, 49 positives and 71 negatives were obtained with the ICS, versus 48 positives and 72 negatives by means of quadruplex RT-PCR. Thus, compared with the quadruplex RT-PCR assay, the ICS test had a specificity of 98.6%, and a sensitivity of 100%. There was therefore excellent agreement ( = 0.983) between the ICS and quadruplex RT-PCR results (Table 2). 4. Discussion LSV is widespread in many countries where lily is grown, and causes yield and quality losses of flowers and bulbs. Most lily virus researchers focus their attention on laboratory detection methods
e.g. ELISA and RT-PCR. However, the latter technologies are limited by the necessity of skilled technicians and expensive equipment which may not be practical for rapid, field detection and management of a LSV outbreak. The development of the ICS test is a convenient and practical method that could be performed in the field, without any equipment, for the rapid diagnosis of the main lily viruses. In this study, we have successfully developed a new rapid approach to detect LSV using the ICS test, a technique that has been utilized for the detection of other viruses in many species (Jiang et al., 2011; Sun et al., 2013). The detection limit of the ICS test was 6.0 × 10−8 mg/mL, which was similar to the sensitivity of the quadruplex RT-PCR assay. The values obtained for comparative sensitivity (100%) and specificity (98.6%) are higher than those reported with other ICS tests for human and animal infectious diseases (Alvarez et al., 2010; Sun et al., 2013). The ICS test for detection of LSV showed a low level of non-specificity, and only one weak false-positive result was found in the 120 field samples. The sensitivity and specificity of the ICS depend strongly on the antibodies used in the test strip. We used the purified native LSV and the recombinant LSV CP proteins as the source of antigens to produce the first and the second antibodies, respectively (Wang et al., 2007, 2010). There are some differences in antigenicity between the native LSV and the recombinant LSV CP (Wang et al., 2010), which may contribute to the higher sensitivity of the initial virus antigen and antibody reaction. Therefore, we used the IgG1 as the detection antibody to conjugate colloidal gold. However, due to the limitation of the purification method, the purity of native LSV was lower than the recombinant protein. The LSV products may contain some host plant proteins (Wang et al., 2007). These impurities may produce non-specific antibodies, which could contribute to falsepositive results in the ICS test if used as the as the capture antibody with the IgG1 . Therefore, to improve the level of specificity, we used an antibody (IgG2 ) with higher specificity as the capture antibody. In addition, an optimal pH and nitrocellulose membrane that has a lower wicking rate or higher diffusion speed were crucial for the development of an effective ICS test, as they affected the performance and reliability of the colloidal gold conjugate. In this study, we prepared colloidal gold particles with a mean diameter of 30 nm, and with a pH of 7.5, the colloidal gold particles combined stably with IgG1 . The color indicator lines in the test and control lines were obvious and easy to distinguish. However, lily pigments in the solution from the leaf samples may potentially interfere with release of the colloidal gold-antibody conjugates and protein-binding capacity of the membrane if they migrated into the conjugate release pad and the nitrocellulose membrane. Reduced protein-binding capacity will lead to a reduction in sensitivity, so the selected sample pad must be able to effectively filter out these pigments. A special cellulose-based pad will be suitable for this purpose.
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
Currently, laboratory detection of LSV is based on various methods including ELISA (Sharma et al., 2005), RT-PCR (Niimi et al., 2003; Zhang et al., 2010) and real-time PCR (Nesi et al., 2013). The sensitivity of a real-time PCR assay was found to be greater than that of the RT-PCR for the detection of LSV (Nesi et al., 2013). In the ICS specificity test, two other lily viruses were tested; only the control line appeared in each strip with these viruses. The sensitivity of the ICS test has reached the level of RT-PCR in the laboratory; however, more importantly the ICS test offers advantages for the rapid detection of LSV on-site without the requirement for skilled technicians and expensive equipment. Furthermore, the ICS results can be obtained with 10 min. In addition, the lower cost of ICS test should encourage acceptance by lily growers. In contrast, in conventional and real-time PCR assays, each step of the procedure can strongly influence the result, the procedure must be followed strictly, and use of high quality reagents is necessary to ensure optimal test results. Moreover, because the ICS test has several advantages over traditional ELISA, RT-PCR and real-time PCR methods in the laboratory, it has been widely used as a common detection tool for viruses, bacteria and parasite antigens, as well as their antibodies (Alvarez et al., 2010). In short, these results demonstrate that the ICS test has practical applications due to its favorable sensitivity and specificity for the detection of LSV. In conclusion, the ICS test is a highly sensitive and specific method for detecting LSV, especially in the field. The ICS test was highly specific, and had high sensitivity in detecting the LSV antigen. This assay offers an advantage over other techniques in that it can be completed within 10 min without the need for special instruments or skilled personnel, and can therefore be used both in the laboratory and the field. Thus, it will contribute to the detection and control of this viral disease in China. The ICS test is currently being used to monitor LSV in field samples from Lanzhou lily production areas in Gansu Province of China. To our knowledge, this is the first description of a practical ICS test for detection of LSV infection. Acknowledgments This study was supported by the National Natural Science Foundation of China (Grant No. 31201651), by the “West Light” Project
17
of the Chinese Academy of Sciences in 2014, by the Gansu Agricultural Biotechnology Research and Development Projects (Grants GNSW-2011-05 and GNSW-2010-20), and by the Ningxia Agricultural Comprehensive Development Office (NTKJ-2014-09-1). References Alvarez, I., Gutierrez, G., Barrandeguy, M., Trono, K., 2010. Immunochromatographic lateral flow test for detection of antibodies to equine infections anemia virus. J. Virol. Methods 167, 152–157. Asjes, C.J., 2000. Control of aphid-borne lily symptomless virus and lily mottle virus in Lilium in the Netherlands. Virus Res. 71, 23–32. Choi, S.A., Ryu, K.H., 2003. The complete nucleotide sequence of the genome RNA of lily symptomless virus and its comparison with that of other carlaviruses. Arch. Virol. 148, 1943–1955. Hermanson, G.T., 2008. Bioconjugate Techniques, 2nd ed. Academic Press, San Diego, pp. 928–930. Jiang, T., Liang, Z., Ren, W., Chen, J., Zhi, X., Qi, G., Liu, X., Cai, X., 2011. A simple and rapid colloidal gold-based immunochromatographic strip test for detection of FMDV serotype A*. Virol. Sin. 26, 30–39. Nesi, B., Lazzereschi, S., Pecchioli, S., Grassotti, A., Rizzo, D., Stefani, L., Paoli, M., Della Bartola, M., Materazzi, A., 2013. Detection of virus infecting Lilium spp. by RT-PCR and real-time PCR. Acta Hort. (ISHS) 1002, 215–221. Niimi, Y., Han, D.S., Mori, S., Kobayashi, H., 2003. Detection of cucumber mosaic virus, lily symptomless virus and lily mottle virus in Lilium species by RT-PCR technique. Sci. Hortic. 97, 57–63. Sharma, A., Mahinghara, B.K., Singh, A.K., Kulshrestha, S., Raikhy, G., Singh, L., Verma, N., Hallan, V., Ram, R., Zaidi, A.A., 2005. Identification, detection and frequency of lily viruses in northern India. Sci. Hortic. 106, 213–227. Singh, A.K., 2005. Natural occurrence of lily symptomless on spider lily. Plant Pathol. 54, 255–265. Sun, C., Zhao, K., Chen, K.Y., He, W.Q., Su, G.L., Sun, X.P., Wang, L., Pan, W., Zhang, W., Gao, F., Song, D.G., 2013. Development of a convenient immunochromatographic strip for the diagnosis of vesicular stomatitis virus serotype Indiana infections. J. Virol. Methods 188, 57–63. Wang, R.Y., Wang, J.H., Wang, Y., Xie, Z.K., An, L.Z., 2007. Comparison of two gel filtration chromatographic methods for the purification of lily symptomless virus. J. Virol. Methods 139, 125–131. Wang, R.Y., Wang, G.P., Zhao, Q., Zhu, Y., An, L.Z., Wang, Y., 2010. Expression, purification and characterization of the lily symptomless virus coat protein from Lanzhou isolate. Virol. J. 7, 34. Zhang, G., Guo, J., Wang, X., 2008. Immunochromatographic lateral flow strip tests. In: Rasooly, A. (Ed.), Biosensors and Biodetection: Methods and Protocols: Electrochemical and Mechanical Detectors, Lateral Flow and Ligands for Biosensors. Methods in Molecular Biology, vol. 504, pp. 169–183. Zhang, Y.B., Xie, Z.K., Wang, Y.J., Guo, Z.H., Tong, X.Z., 2010. Simultaneous detection of two main Lanzhou lily (Liliumdavidiivar. unicolor) viruses by RT-PCR. J. Wuhan Bot. Res. 28 (6), 744–749 (in Chinese with English abstract).
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Development of an immunochromatographic strip test for rapid detection of lily symptomless virus Yubao Zhang a , Yajun Wang a , Jing Meng b , Zhongkui Xie a,∗ , Ruoyu Wang a , Hadley Randal Kutcher c , Zhihong Guo a a
Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, Lanzhou 730000, China Ningxia Agricultural Comprehensive Development Office, Yinchuan 750002, China c College of Agriculture and Bioresources, University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada b
a b s t r a c t Article history: Received 14 January 2015 Received in revised form 26 March 2015 Accepted 26 March 2015 Available online 4 April 2015 Keywords: Immunonochromatographic strip LSV PCR Rapid detection
A rapid immunochromatographic strip (ICS) test for specific detection of lily symptomless virus (LSV) was developed. The test is based on a double-antibody sandwich format and employs two distinct antiLSV polyclonal antibodies (IgG1 and IgG2 ). The first antibody, IgG1 was used as the detection antibody conjugated to colloidal gold and the second antibody, IgG2 was used to as the capture antibody at the test line. The performance of the ICS test was evaluated and the results obtained were compared with a quadruplex RT-PCR assay. When serial dilutions of purified LSV were tested, the LSV detection limit of the ICS test was 6.0 × 10−8 mg/mL, which was the same as the quadruplex RT-PCR assay. Relative to quadruplex RT-PCR, the specificity and sensitivity of the ICS were 98.6% and 100%, respectively for field leaf samples. There was significant agreement between the results of the ICS and quadruplex RT-PCR tests ( = 0.983). Compared with conventional lily virus detection methods, our ICS test has many advantages: simple, fast, low cost, high sensitivity and specificity, and has applications in the laboratory and in the field to detect and control LSV. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Lanzhou lily (Lilium davidii var. unicolor) is an important edible bulb crop as well as a traditional medicinal plant with a 150year cultivation history in the Lanzhou area of northwestern China (Wang et al., 2010). It is famous for its large size, thick white flesh, and sweet taste. It is also is an important ornamental plant because of its flaming and flamboyant coloration. The economic importance of the Lanzhou lily has increased greatly during the past decade because of the rapid increase in demand for this plant. However, cultivars of the Lanzhou lily are seriously affected by viral infections, which have decreased lily production by 50% in recent years. Lily symptomless virus (LSV; Genus Carlavirus, family Flexiviridae) is the most common virus that infects Lanzhou lily (Wang
∗ Corresponding author at: Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences, No. 320 Dong Gang West Road, Lanzhou 730000, China. Tel.: +86 931 496 7206; fax: +86 931 827 3894. E-mail addresses: [email protected] (Y. Zhang), [email protected] (Y. Wang), [email protected] (J. Meng), [email protected], [email protected] (Z. Xie), [email protected] (R. Wang), [email protected] (H.R. Kutcher), [email protected] (Z. Guo). http://dx.doi.org/10.1016/j.jviromet.2015.03.021 0166-0934/© 2015 Elsevier B.V. All rights reserved.
et al., 2007); it has been reported in the United States, Europe, Australia, and Asia (Singh, 2005). LSV is a filamentous particle, 640 nm in length and 17–18 nm in diameter. The genomic RNA of LSV comprises 8394 nucleotides and contains six open reading frames (ORFs). The ORF5 (7140–8015 nucleotides) encodes a coat protein (CP) of 291 amino acids, and the genomic RNA of LSV is encapsulated in a single type of CP with a molecular weight of 32 kDa (Choi and Ryu, 2003). The host range of LSV is restricted to Liliaceae (Singh, 2005). It is one of the most prevalent viruses of lilies that causes quantitative and qualitative aspects of yield reduction of bulbs and flowers (Asjes, 2000). Viral diseases represent some of the most dangerous threats to Lanzhou lily, so it is important to develop fast and effective diagnostic techniques for early detection. However, the most commonly used methods to detect viruses, including LSV in lily samples are electron microscopy (Wang et al., 2007), enzyme-linked immunosorbent assay (ELISA; Sharma et al., 2005), the polymerase chain reaction (PCR; Niimi et al., 2003; Zhang et al., 2010), and the real-time PCR (Nesi et al., 2013). However, these methods are limited by their lengthy test time, the technical expertise required, and the necessity for specialized laboratory equipment. Therefore, these methods are unsuitable for widespread use to support the production of Lanzhou lily, and it is necessary to
14
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
develop a rapid, specific, and easily performed LSV assay. The immunochromatographic assay offers several advantages over traditional immunoassays, such as its low cost, procedural simplicity, limited requirements for special skills or expensive equipment, and rapid results (Alvarez et al., 2010). This assay has thus been widely applied to detect hormones, bioactive molecules, contagious human diseases, animal and plant viruses, bacteria and parasite antigens, and their antibodies (Zhang et al., 2008; Sun et al., 2013). The aim of the present study was to develop an immunochromatographic test strip (ICS) for rapid and accurate detection of LSV. The sensitivity and specificity of the ICS were evaluated using a quadruplex reverse transcriptase (RT)-PCR assay as a reference test. In detection trials, 120 Lanzhou lily samples from the field were analyzed using both the quadruplex RT-PCR assay and the ICS test. The results showed excellent agreement between the tests ( = 0.983). 2. Materials and methods 2.1. Reagents and materials Naturally infected Lily plants showing typical dwarfing, or leaves displaying chlorotic, yellow spots or stripes, or mosaic symptoms were collected in fields of the Gaolan Research Station (36◦ 05 N, 103◦ 31 E) in Lanzhou, Gansu province, China. Leaves near the flower bud were tested by RT-PCR according to the method of Zhang et al. (2010). As a result, leaves from single plants that tested positive for LSV, CMV or LMoV served as sources of LSV, CMV and LMoV viruses and were stored at −70 ◦ C. The first antibody, IgG1 -rabbit IgG anti-native LSV and the second antibody IgG2 -rabbit IgG anti-recombinant LSV CP were produced and purified following the methods of Wang et al. (2007, 2010). Both of the antibodies were kept in aliquots of 1 mg at −20 ◦ C for 1 year. We purchased chloroauric acid (HAuCl4 ) and goat anti-rabbit IgG from the Sigma Company (St. Louis, MO, USA), nitrocellulose membranes (HiFlow-120) and cellulose filter from Millipore (Billerica, MA, USA), and special cellulose and absorbent papers from Jieyi Company (Shanghai, China). 2.2. Preparation of colloidal gold and colloidal gold-IgG1 conjugates Colloidal gold particles with a mean diameter of 30 nm were prepared by the method of Hermanson (2008). Under constant stirring, 1.4 mL of 1% trisodium citrate (w/v) was added to 100 mL of 0.01% aqueous chloroauric acid solution (w/v) at 100 ◦ C and boiled for 5 min. As the resulting colloidal gold cooled gradually to room temperature, with continuous stirring, we maintained the pH at 7.5 by adding 0.1 M potassium carbonate. Sodium azide was added to a final concentration of 0.01% (w/v) before storage at 4 ◦ C in a glass bottle covered with foil. The absorption maxima (max ) of the solutions were analyzed by means of ultraviolet/visible spectroscopy (UV/vis) using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) to determine the approximate particle sizes, which were confirmed by transmission electron microscopy (TEM) measurements using a JEM-1230 transmission electron microscope (TEM; JEOL, Tokyo, Japan). To prepare the colloidal gold-IgG1 conjugates, IgG1 (160 L at 1.0 mg/mL) was added drop-wise to 10 mL of the pH-adjusted colloidal gold solution. The mixture was stirred vigorously for 30 min, and then 2.5 mL of 10% (w/v) bovine serum albumin (BSA) was added to block excess reactivity of the gold colloid. The mixture was then stirred for an additional 30 min. After centrifuging the mixture at 10,000 × g and 4 ◦ C for 30 min, the gold pellets were
resuspended in 1 mL of dilution buffer (20 mM Tris/HCl buffer at pH 8.2 containing 1% (w/v) BSA, 3% (w/v) sucrose, and 0.02% (w/v) sodium azide). The colloidal gold conjugate was then stored at 4 ◦ C until use. 2.3. Preparation of the immunochromatographic strip (ICS) The ICS included four components: a sample pad (special cellulose paper), a conjugate release pad (cellulose filter), a nitrocellulose membrane, and an absorbent pad (absorbent paper). The sample pad was treated with 20 mM phosphate buffer (PBS) containing 1% (w/v) BSA, 0.5% (v/v) Tween-20, and 0.05%(w/v) sodium azide at pH 7.4, and was then dried for 2 h at 37 ◦ C. First, a control line was formed by carefully dragging a pipette tip containing 100 L of the goat anti-rabbit IgG (at 2.0 mg/mL) along the long axis of the nitrocellulose membrane. The tip was guided against a ruler placed 6 mm from one end of the membrane. Immediately following this procedure, the same process was repeated to generate a test line using the IgG2 (at 1.5 mg/mL). A 5-mm gap was left between two lines. Subsequently, the membrane was allowed to dry completely for at least 2 h at room temperature and was then attached to a backing plate. An 18 mm × 5 mm absorbent pad was applied at the downstream end of the nitrocellulose membrane. This material was used as the “sink pad”. Next, a 5 mm × 5 mm cellulose filter pad was impregnated with 15 L colloidal gold-IgG1 solution and left to dry overnight at room temperature. The resulting “conjugate release pad” together with a 20 mm × 5 mm “sample pad” was placed at the opposite end of the sink pad to complete the test strip. These strips were housed in plastic cases and then stored at 4 ◦ C under desiccated conditions until use. 2.4. The immunochromatographic assay If the sample tested contained LSV, the LSV reacted with IgG1 conjugated to colloidal gold. The complex IgG1 -LSV-gold then migrated into the nitrocellulose membrane by capillary action and subsequently reacted with the immobilized IgG2 in the test line. Unbound IgG1 -colloidal gold particles ran over the test line and reacted with the goat anti-rabbit IgG at the control line to form a second visible purple–red band. About 100 L of the tested sample was applied to the plastic cassette sample window. The result was read between 5 and 10 min after the addition of the sample. The sample was considered positive if two distinct purple-red lines appeared, one in the test region and the other in the control region; negative when no line appeared in the test region, and invalid if the control line failed to appear. 2.5. Specificity and sensitivity of the ICS test To evaluate the cross-reactivity of the ICS test strip, we tested LSV and two other common lily viruses (cucumber mosaic virus, CMV, and lily mosaic virus, LMoV) from field samples collected from the Gaolan Research Station, using the ICS. LSV positive leaves were used as a positive control and virus extraction buffer (0.2 M Tris/HCl buffer (pH 7.5) containing 10 mM EDTA-Na2 , 0.1% (w/v) polyvinyl polypyrrolidone and 0.1% (v/v) 2-mercaptoethanol) was used as a negative control. The sensitivity of the ICS test was evaluated by testing a series of 10-fold dilutions of the purified LSV solution (at 6.0 × 10−1 mg/mL), which was analyzed as virus antigen by means of western blotting using the IgG2 protein at a concentration of 2.0 × 10−2 mg/mL. Each dilution was then added to an ICS test, and the sensitivity was determined from the end-point dilution. In addition, we determined the specificity and the sensitivity of the ICS test compared with the quadruplex RT-PCR assay (Zhang et al., 2010). Briefly, we used four pairs of primers (Table 1) simultaneously to detect LMoV, LSV, CMV, and the lily 18S
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
15
Table 1 Sequence and position of the PCR primers used in the quadruplex RT-PCR assay. Virus
GeneBank accession no.
Fragment size (bp)
Sequence 5 –3
Sense
Position
LSV
DQ531052
198
CMV
DQ767971
248
LMoV
AJ564636
395
18SrRNA
AY684927
303
TATGGGCTTCCAATACAAC TATTCGGTTTCCAGGTTC CTTTGTAGGGAGTGAACGCTGTA AGATGGCGGCAACGGATA TGGCACCTCACCAAATGTA CATCATCTGCTGTATGCCTCT ATACCGTCCTAGTCTCAACC ACAAATCGCTCCACCAAC
+ − + − + − + −
618–636 815–832 171–193 418–435 390–408 784–804 971–990 1273–1290
rRNA housekeeping gene (as an internal control). Total RNA was extracted from the above leaf samples and a series of 10-fold dilutions of the purified viral samples by using the RNAprep pure Plant Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. The first strand of cDNA was synthesized by MMLV reverse transcriptase with the Oligo (dT)-18 primer (TaKaRa Biotech, Dalian, China). Quadruplex PCR was carried out in 25 L volumes containing 2 L the cDNA product, 4 mM Mg2+ , 0.6 mM dNTPs, 0.625U of Taq polymerase (TaKaRa EX Taq, TaKaRa Biotech, Dalian, China), and 0.2 M of each quadruplex sense and anti-sense primer (Table 1). The PCR amplification consisted of 30 cycles at 94 ◦ C for 30 s, 52.5 ◦ C for 45 s, and 72 ◦ C for 1 min. The quadruplex RT-PCR products were checked by electrophoresis on a 2.0% agarose gel and were of the expected sizes (395, 198, 248, and 303 bp, respectively). 2.6. Detection of LSV in field samples
Fig. 1. TEM image of the colloidal gold particles.
A total of 120 individual Lanzhou lily leaf samples were collected from fields at Xiguoyuan in Lanzhou, Gansu Province, and used for detection of LSV. Viral extracts were prepared by grinding 500-mg leaf samples from each plant in 2.5 mL of virus extraction buffer at a ratio of 1:5 (tissue weight [g]: buffer volume [mL]). The extracts were centrifuged at 1500 × g for 5 min. The liquid supernatants were collected and used as the detection samples in the ICS test. In addition, each leaf sample was tested using quadruplex RT-PCR assays to provide a comparison. RNA extraction and quadruplex PCR were performed as described above. 3. Results 3.1. Identification of the colloidal gold particles The prepared colloidal gold solution was deep red and had high light transmission. The UV/vis absorption spectrum from 400 to 600 nm showed a peak at about 528 nm caused by surface resonance of the colloidal gold particles (data not shown). The TEM image shows that the colloidal gold particles were almost uniform in size, which provided the best basis for preparation of the ICS (Fig. 1). 3.2. Specificity and sensitivity of the ICS To determine the specificity of the ICS, we tested for LSV and the two other viruses simultaneously. The samples of healthy leaves and those containing CMV and LMoV produced a single strong band in the control line of the ICS; LSV produced an additional band in the test line (Fig. 2A). All the samples were also tested by means of quadruplex RT-PCR, which produced the same results as the ICS test (Fig. 2B). Thus, the ICS has high specificity for LSV. The sensitivity of the ICS test was determined by means of serial dilutions of purified native products of LSV, ranging from 6.0 × 10−1 mg/mL to 6.0 × 10−9 mg/mL. Western blotting revealed
Fig. 2. Specificity of detection by (A) the ICS and (B) amplification by quadruplex RT-PCR for healthy leaf samples and for samples containing CMV, LMoV, or LSV. Lane M, DL600 marker; lane 1, negative control; lane 2, healthy control; lane 3, CMV; lane 4, LMoV; lane 5, LSV; lane 6, positive control (LSV + CMV + 18S rRNA + LMoV).
that the purified native LSV bound to the 32 kDa IgG2 protein (Fig. 3). All dilutions were tested by ICS and quadruplex RT-PCR. The diluted samples revealed the same detection limits for ICS and quadruplex RT-PCR, at approximately 6.0 × 10−8 mg/mL (Fig. 4A and B). The quantification test revealed that the ICS had the same detection sensitivity as the quadruplex RT-PCR assay.
16
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17 Table 2 Detection of LSV in field leaf samples by the ICS test and by the quadruplex RT-PCR assay. RT-PCR
ICS Positive Negative Total
Positive
Negative
Total
48 0 48
1 71 72
49 71 120
Compared to the quadruplex RT-PCR assay the specificity of the ICS test: 71/(1 + 71) × 100% = 98.6%, and the sensitivity of the ICS test: 48/(0 + 48) × 100% = 100%. Po = (48 + 71)/120 = 0.992. Pe = (48/120) × (49/120) + (72/120) × (71/120) = 0.518. = (Po – Pe )/(1 – Pe ) = 0.983.
Fig. 3. Western blot analysis of the purified LSV using IgG2 antibodies: M, protein markers; blank lane, negative control. The 32 kDa fragment is the LSV target protein.
Fig. 4. Sensitivity comparison between the ICS test and the quadruplex RT-PCR assay. (A) 6.0 × 10−1 mg/mL of purified LSV was serially diluted 10-fold to 6.0 × 10−9 ; LSV could be detected to 6.0 × 10−8 mg/mL by the ICS test. (B) 6.0 × 10−8 mg/mL of LSV could also be detected by quadruplex RT-PCR (6.0 × 10−1 mg/mL of LSV was serially diluted from 6.0 × 10−1 to 6.0 × 10−10 ; lanes 3–12); M, DL600 marker; lane 1, negative control; lane 2, healthy control; lane 13, positive control (LSV + CMV + 18S rRNA + LMoV).
3.3. Experimental detection of LSV in field samples We analyzed 120 field samples of Lanzhou lily leaves using the quadruplex RT-PCR assay and the ICS. Of the 120 samples, 49 positives and 71 negatives were obtained with the ICS, versus 48 positives and 72 negatives by means of quadruplex RT-PCR. Thus, compared with the quadruplex RT-PCR assay, the ICS test had a specificity of 98.6%, and a sensitivity of 100%. There was therefore excellent agreement ( = 0.983) between the ICS and quadruplex RT-PCR results (Table 2). 4. Discussion LSV is widespread in many countries where lily is grown, and causes yield and quality losses of flowers and bulbs. Most lily virus researchers focus their attention on laboratory detection methods
e.g. ELISA and RT-PCR. However, the latter technologies are limited by the necessity of skilled technicians and expensive equipment which may not be practical for rapid, field detection and management of a LSV outbreak. The development of the ICS test is a convenient and practical method that could be performed in the field, without any equipment, for the rapid diagnosis of the main lily viruses. In this study, we have successfully developed a new rapid approach to detect LSV using the ICS test, a technique that has been utilized for the detection of other viruses in many species (Jiang et al., 2011; Sun et al., 2013). The detection limit of the ICS test was 6.0 × 10−8 mg/mL, which was similar to the sensitivity of the quadruplex RT-PCR assay. The values obtained for comparative sensitivity (100%) and specificity (98.6%) are higher than those reported with other ICS tests for human and animal infectious diseases (Alvarez et al., 2010; Sun et al., 2013). The ICS test for detection of LSV showed a low level of non-specificity, and only one weak false-positive result was found in the 120 field samples. The sensitivity and specificity of the ICS depend strongly on the antibodies used in the test strip. We used the purified native LSV and the recombinant LSV CP proteins as the source of antigens to produce the first and the second antibodies, respectively (Wang et al., 2007, 2010). There are some differences in antigenicity between the native LSV and the recombinant LSV CP (Wang et al., 2010), which may contribute to the higher sensitivity of the initial virus antigen and antibody reaction. Therefore, we used the IgG1 as the detection antibody to conjugate colloidal gold. However, due to the limitation of the purification method, the purity of native LSV was lower than the recombinant protein. The LSV products may contain some host plant proteins (Wang et al., 2007). These impurities may produce non-specific antibodies, which could contribute to falsepositive results in the ICS test if used as the as the capture antibody with the IgG1 . Therefore, to improve the level of specificity, we used an antibody (IgG2 ) with higher specificity as the capture antibody. In addition, an optimal pH and nitrocellulose membrane that has a lower wicking rate or higher diffusion speed were crucial for the development of an effective ICS test, as they affected the performance and reliability of the colloidal gold conjugate. In this study, we prepared colloidal gold particles with a mean diameter of 30 nm, and with a pH of 7.5, the colloidal gold particles combined stably with IgG1 . The color indicator lines in the test and control lines were obvious and easy to distinguish. However, lily pigments in the solution from the leaf samples may potentially interfere with release of the colloidal gold-antibody conjugates and protein-binding capacity of the membrane if they migrated into the conjugate release pad and the nitrocellulose membrane. Reduced protein-binding capacity will lead to a reduction in sensitivity, so the selected sample pad must be able to effectively filter out these pigments. A special cellulose-based pad will be suitable for this purpose.
Y. Zhang et al. / Journal of Virological Methods 220 (2015) 13–17
Currently, laboratory detection of LSV is based on various methods including ELISA (Sharma et al., 2005), RT-PCR (Niimi et al., 2003; Zhang et al., 2010) and real-time PCR (Nesi et al., 2013). The sensitivity of a real-time PCR assay was found to be greater than that of the RT-PCR for the detection of LSV (Nesi et al., 2013). In the ICS specificity test, two other lily viruses were tested; only the control line appeared in each strip with these viruses. The sensitivity of the ICS test has reached the level of RT-PCR in the laboratory; however, more importantly the ICS test offers advantages for the rapid detection of LSV on-site without the requirement for skilled technicians and expensive equipment. Furthermore, the ICS results can be obtained with 10 min. In addition, the lower cost of ICS test should encourage acceptance by lily growers. In contrast, in conventional and real-time PCR assays, each step of the procedure can strongly influence the result, the procedure must be followed strictly, and use of high quality reagents is necessary to ensure optimal test results. Moreover, because the ICS test has several advantages over traditional ELISA, RT-PCR and real-time PCR methods in the laboratory, it has been widely used as a common detection tool for viruses, bacteria and parasite antigens, as well as their antibodies (Alvarez et al., 2010). In short, these results demonstrate that the ICS test has practical applications due to its favorable sensitivity and specificity for the detection of LSV. In conclusion, the ICS test is a highly sensitive and specific method for detecting LSV, especially in the field. The ICS test was highly specific, and had high sensitivity in detecting the LSV antigen. This assay offers an advantage over other techniques in that it can be completed within 10 min without the need for special instruments or skilled personnel, and can therefore be used both in the laboratory and the field. Thus, it will contribute to the detection and control of this viral disease in China. The ICS test is currently being used to monitor LSV in field samples from Lanzhou lily production areas in Gansu Province of China. To our knowledge, this is the first description of a practical ICS test for detection of LSV infection. Acknowledgments This study was supported by the National Natural Science Foundation of China (Grant No. 31201651), by the “West Light” Project
17
of the Chinese Academy of Sciences in 2014, by the Gansu Agricultural Biotechnology Research and Development Projects (Grants GNSW-2011-05 and GNSW-2010-20), and by the Ningxia Agricultural Comprehensive Development Office (NTKJ-2014-09-1). References Alvarez, I., Gutierrez, G., Barrandeguy, M., Trono, K., 2010. Immunochromatographic lateral flow test for detection of antibodies to equine infections anemia virus. J. Virol. Methods 167, 152–157. Asjes, C.J., 2000. Control of aphid-borne lily symptomless virus and lily mottle virus in Lilium in the Netherlands. Virus Res. 71, 23–32. Choi, S.A., Ryu, K.H., 2003. The complete nucleotide sequence of the genome RNA of lily symptomless virus and its comparison with that of other carlaviruses. Arch. Virol. 148, 1943–1955. Hermanson, G.T., 2008. Bioconjugate Techniques, 2nd ed. Academic Press, San Diego, pp. 928–930. Jiang, T., Liang, Z., Ren, W., Chen, J., Zhi, X., Qi, G., Liu, X., Cai, X., 2011. A simple and rapid colloidal gold-based immunochromatographic strip test for detection of FMDV serotype A*. Virol. Sin. 26, 30–39. Nesi, B., Lazzereschi, S., Pecchioli, S., Grassotti, A., Rizzo, D., Stefani, L., Paoli, M., Della Bartola, M., Materazzi, A., 2013. Detection of virus infecting Lilium spp. by RT-PCR and real-time PCR. Acta Hort. (ISHS) 1002, 215–221. Niimi, Y., Han, D.S., Mori, S., Kobayashi, H., 2003. Detection of cucumber mosaic virus, lily symptomless virus and lily mottle virus in Lilium species by RT-PCR technique. Sci. Hortic. 97, 57–63. Sharma, A., Mahinghara, B.K., Singh, A.K., Kulshrestha, S., Raikhy, G., Singh, L., Verma, N., Hallan, V., Ram, R., Zaidi, A.A., 2005. Identification, detection and frequency of lily viruses in northern India. Sci. Hortic. 106, 213–227. Singh, A.K., 2005. Natural occurrence of lily symptomless on spider lily. Plant Pathol. 54, 255–265. Sun, C., Zhao, K., Chen, K.Y., He, W.Q., Su, G.L., Sun, X.P., Wang, L., Pan, W., Zhang, W., Gao, F., Song, D.G., 2013. Development of a convenient immunochromatographic strip for the diagnosis of vesicular stomatitis virus serotype Indiana infections. J. Virol. Methods 188, 57–63. Wang, R.Y., Wang, J.H., Wang, Y., Xie, Z.K., An, L.Z., 2007. Comparison of two gel filtration chromatographic methods for the purification of lily symptomless virus. J. Virol. Methods 139, 125–131. Wang, R.Y., Wang, G.P., Zhao, Q., Zhu, Y., An, L.Z., Wang, Y., 2010. Expression, purification and characterization of the lily symptomless virus coat protein from Lanzhou isolate. Virol. J. 7, 34. Zhang, G., Guo, J., Wang, X., 2008. Immunochromatographic lateral flow strip tests. In: Rasooly, A. (Ed.), Biosensors and Biodetection: Methods and Protocols: Electrochemical and Mechanical Detectors, Lateral Flow and Ligands for Biosensors. Methods in Molecular Biology, vol. 504, pp. 169–183. Zhang, Y.B., Xie, Z.K., Wang, Y.J., Guo, Z.H., Tong, X.Z., 2010. Simultaneous detection of two main Lanzhou lily (Liliumdavidiivar. unicolor) viruses by RT-PCR. J. Wuhan Bot. Res. 28 (6), 744–749 (in Chinese with English abstract).
