Mol Biol Rep (2014) 41:5585–5591 DOI 10.1007/s11033-014-3213-7

Development of ARMS-PCR assay for genotyping of Pro12Ala SNP of PPARG gene: a cost effective way for case–control studies of type 2 diabetes in developing countries Mehboob Islam • Fazli Rabbi Awan Shahid Mahmood Baig

•

Received: 26 June 2013 / Accepted: 27 January 2014 / Published online: 26 July 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract Type 2 diabetes (T2D) is a prevalent metabolic disorder across the globe. Research is underway on various aspects including genetics to understand and control the global epidemic of diabetes. Recently, several SNPs in various genes have been associated with T2D. These association studies are mainly carried out in the developed countries through Genome Wide Association Scans, with follow-up replication/validation studies by high-throughput genotyping techniques (e.g. Taqman Technology). Although, similar studies could be conducted in developing countries, however, the limiting factors are the associated cost and expertise. These factors hamper research into the genetic association and replication studies from low-income countries to figure out the role of putatively associated SNPs in diabetes. Although, there are several SNP detection methods (e.g. Taqman assay, Dot-blot, PCR-RFLP, DGGE, SSCP) but these are either expensive or labor intensive or less sensitive. Hence, our aim was to develop a low-cost method for the validation of PPARG (Pro12Ala, CCA[GCA) SNP (rs1801282) for its association with T2D. Here, we developed a cost-effective and rapid amplification refractory mutation specific-PCR (ARMS-PCR) method for this SNP detection. We successfully genotyped PPARG SNPs (Pro12Ala) in human samples and the validity of this method was confirmed by DNA sequencing of a few representative samples for the three different genotypes. Furthermore,

M. Islam  F. R. Awan (&)  S. M. Baig Diabetes and Cardio-Metabolic Disorders Laboratory, Human Molecular Genetics and Metabolic Disorders Group, Health Biotechnology Division, National Institute for Biotechnology and Genetic Engineering (NIBGE), Jhang Road, P.O. Box 577, Faisalabad, Pakistan e-mail: [email protected]

ARMS-PCR was applied to T2D patients and control samples for the screening of this SNP. Keywords ARMS-PCR  PPARG  Pro12Ala  rs1801282  SNP  Diabetes  PCR-RFLP

Introduction Diabetes mellitus is a metabolic disorder characterized by chronic high blood glucose levels. The global prevalence of diabetes was estimated to 366 million in 2011 which is expected to rise to 552 million by 2030 [1]. Prevalence of diabetes together with glucose intolerance in Pakistan has been reported up to 20 % [2–4]. Type 2 diabetes (T2D) is the most common form of diabetes affecting more than 90 % of diabetes patients. This is a complex disorder, resulting from insulin resistance, reduced insulin secretion or both. Apart from environmental and life style factors (e.g. carbohydrate and fat rich diets, physical inactivity)—genetics is a key contributing factor for the development of T2D. This is evident from the high concordance rate of T2D among monozygotic twins as compared to dizygotic twins, as well as high prevalence of T2D in some ethnic population [5]. To elucidate genetic basis of complex disorders like diabetes, researchers have shifted their approach from classical genetics to most modern technologies like Genome Wide Association Scans (GWAS). Such studies involve a large number of samples from patients and healthy controls, which are subsequently tested for the detection of disease associated gene variants (SNPs, Single Nucleotide Polymorphisms) using high-throughput molecular genetics tools like DNA microarrays. The disease associated SNPs are further validated through replication studies in large number of

123

5586

disease and control samples by high-throughput genotyping techniques like real-time PCR based TaqMan technologies. In several such GWA studies, researchers have recently identified various SNPs in several genes associated with T2D such as TCF7L2, KCNJ11, FTO, SLC30A8, PPARG etc. [6, 7], and the latter one is being considered in this paper. Peroxisome proliferator activated receptors (PPARs) are the nuclear receptors which are activated by the fatty acids resulting in the increase of peroxisome. This accelerates the b-oxidation of long and branched chain fatty acids. PPARs are also involved in the catabolism of D-amino acids, polyamines and synthesis of plasmalogens [8, 9]. Three types of PPARs have been identified as: PPAR-alpha, PPAR-delta and PPAR-gamma, which are encoded by three different genes. The PPARG gene is located on chromosome 3 (3p25) and codes for 505 amino acids long PPARG. This protein is abundantly expressed in adipose tissues in comparison to other tissues and its expression is strongly induced during adipocyte differentiation [10]. Pro12Ala mutation in the PPARG gene has been consistently associated with T2D in some ethnic populations [11, 12]. For replication of T2D associated SNPs (e.g. Pro12Ala in PPARG), targeted SNPs have been screened in different ethnic populations using various mutation detection methods like; single strand conformational polymorphism (SSCP), denaturing gradient gel electrophoresis (DGGE), restriction fragment length polymorphism (RFLP), TaqMan assay, Molecular beacons etc. [13–15]. The applications of these methods for SNPs detection have their advantages and disadvantages. As most of the replication studies are conducted in developed countries, so over there TaqMan assay was preferentially used owing to its high sensitivity and highthroughput nature [12, 16, 17]. In some other countries, PCRRFLP was used for SNPs detection in diabetes genes, which is inexpensive relative to TaqMan assay as it does not require expensive infrastructure like real-time PCR machine and costly reagents, however, it is very laborious [18, 19]. In general, expensive and sophisticated techniques for SNPs detection are not suitable for investigation in developing countries as cost is a matter of primary concern here. Hence, there is a need to develop simple and cost-effective assays for the detection of SNPs associated with complex diseases in developing countries. ARMS-PCR is one such simple, rapid and cost-effective technique which can be used to investigate the known variants (SNPs) in genome and involves two primers, one complementary to normal allele and other complementary to a variant at 30 end [20]. A similar cost effective ARMS-PCR method was reported for the detection of FecB genotype in sheep [21]. Owing to its suitability for developing countries, we have already developed and reported ARMS-PCR as a cost-effective method for the diagnosis of beta-thalassemia mutations in Pakistan [22].

123

Mol Biol Rep (2014) 41:5585–5591

As replication studies for diabetes associated SNPs are required for advancing diabetes research, and in future devising targeted therapies for the diabetic patients in developing countries, hence low-cost, simple and rapid SNP detection methods are absolutely required to achieve these goals. For this purpose, we set out to address this problem for one of the important diabetes related gene SNP as described below. Here, we report the development of new simple, reliable and cost-effective method called amplification refractory mutation system (ARMS) PCR for the detection of a variant rs1801282 (Pro12Ala) converting genetic code CCA (Pro) to GCA (Ala) at 12th amino acid in PPARG (GenBank accession no NC_000003.11). Furthermore, in this study, we applied this new assay and performed genotyping of this SNP in representative samples from T2D patients and healthy control subjects. From this study, we suggest that this simple and cost effective method can be adapted for genotyping based research in developing countries. So, in this article, the development and application of ARMSPCR for Pro12Ala SNP in PPARG have been discussed.

Materials and methods Sample collection All the blood samples used in this study were collected from the T2D patients and control subjects from Medical Unit, Allied Hospital, Faisalabad, Pakistan. Written informed consents were obtained from all subjects, and this study was approved by the ethical review committee of our institute (NIBGE). Genomic DNA from the collected samples was extracted using standard Phenol-chloroform method. ARMS-PCR assay for Pro12Ala variant in PPARG gene was optimized as described in this report and the collected samples were genotyped for Pro12Ala variant. DNA sequence retrieval and ARMS-PCR primer designing SNP in PPARG associated with T2D was selected from the literature [11, 23] and sequence was retrieved from the NCBI database. For SNP genotyping an allele specific ARMSprimer set was designed using Batch Primer 3 software, freely available online (http://probes.pw.usda.gov/cgi-bin/ batchprimer3/batchprimer3.cgi). To design an ARMS-PCR primer, a mismatch can be deliberately added at -2, -3 or -4 position from the 30 end of the primer. Primers reported in this article have addition of a mismatch at -2 position in such a way that if a strong mismatch is present at 30 end of the primer, the deliberately added nucleotide at -2 position would be a weak mismatch and vice versa. Similarly a

Mol Biol Rep (2014) 41:5585–5591

mismatch of medium strength is added at -2 position if a medium strength mismatch is at 30 end of primer [24, 25]. Distinction between strong, weak and medium mismatch is given as strong mismatches: C–C, G–A, A–A, weak mismatches: T–T, T–C, T–G, G–G, A–C [24]. However some of these mismatches were reported as, medium strength mismatches: A–A, C–C, G–G, T–T [26]. To amplify a Pro12Ala containing region of PPARG gene, a common reverse primer R=GGAGCCATGCACAGAGATA and SNP specific forward primers F1=CGCAGATTCTCCTATTGTCC and F2=CGCAGATTCTCCTATTGTCG were used in two separate PCR reaction mixtures. PCR reaction was optimized to amplify the desired region at these conditions: 95 °C for 5 min, followed by 30 cycles at 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s and final extension at 72 °C for 5 min. About 50–100 ng of DNA was used as template in 15 ll reaction mixture containing 19 PCR buffer, 0.2 mM dNTPs, 2.5 mM MgCl2, 10 pmol of forward and reverse primers and 1U of Taq polymerase. Two separate reactions were run using common reverse and separate forward primers. After the completion of PCR reaction 10 ll of PCR product was loaded on 2 % agarose gel and stained with ethidium bromide. The gel was analyzed under UV light in a gel documentation system using UV-pro software. Validation of ARMS-PCR genotyping

5587

Fig. 1 ARMS-PCR assay output for PPARG (Pro12Ala) SNP. Lane 1 100 bp DNA ladder, Lanes 2, 3 amplification of the same sample in two allele specific reaction mixture showing genotype C/C, Lanes 4, 5 amplification of the same sample in two allele specific reaction mixture showing genotype C/G, Lanes 6, 7 amplification of the same sample in two allele specific reaction mixture showing genotype G/G Table 1 Allele and genotype frequencies for PPARG Pro/Ala (C/G) SNP Amino acids

Genotypes

Control N (frequency)

T2D patients N (frequency)

Pro/Pro

CC

184 (0.83)

135 (0.80)

Pro/Ala

CG

33 (0.15)

31 (0.18)

Ala/Ala

GG

4 (0.02)

3 (0.02)

Using the above mentioned primers and PCR conditions, human genomic DNA samples from control and T2D subjects were genotyped for PPARG Pro12Ala variant. Moreover, for validation of ARMS-PCR results, nine samples (three samples with each genotype) were DNA sequenced by Sanger method, and a 100 % concordance was obtained among the results obtained from ARMS-PCR and DNA sequencing.

Results Using the above mentioned ARMS-PCR assay, an amplified product of 293 bp is the representative band size for genotyping of Pro12Ala variant in PPARG gene. We have found all the three genotypes in our collected samples comprising of both control and diabetic subjects. In case of homozygous condition either Pro/Pro or Ala/Ala genotypes were amplified, while in heterozygous condition, PCR amplification for both Pro and Ala genotypes was observed in two separate allele specific reactions (Fig. 1). Further, we checked the distribution of these genotypes and found them according to Hardy-Weinberg equilibrium. The estimated genotype frequencies are given in Table 1.

Fig. 2 Amplification of a heterozygous genotype for PPARG (Pro12Ala) SNP using different concentrations of genomic DNA. Lane 1 100 bp DNA ladder, amplification of a sample with heterozygous genotype C/G in two allele specific reaction mixture using, Lanes 2, 3 100 ng DNA template, Lanes 4, 5 50 ng DNA template, Lanes 6, 7 25 ng DNA template and Lanes 8, 9 10 ng DNA template

Optimization result of ARMS-PCR assay ARMS-PCR reaction for PPARG Pro12Ala was also optimized for different concentration of genomic DNA. We used 100, 50, 25, and 10 ng of template DNA and found

123

5588

Mol Biol Rep (2014) 41:5585–5591

Table 2 Procedural cost of different SNP genotyping methods Methods

Estimated cost in USDa DNA extraction

PCR reaction mix

Labeled probes

Restriction enzyme

Cost per sample

TaqMan

Yes

0.2–0.3

Yes

No

0.2–0.3

PCR-RFLP

Yes

0.1

No

0.5

0.6–0.7

ARMS-PCR

Yes

0.1

No

No

0.05–0.1

a

This cost does not include the cost of sample collection, storage, DNA extraction and equipment e.g. PCR machine or RT-PCR machine and labor charges as well utilities

amplification with 100, 50, and 25 ng but no amplification was found with 10 ng DNA; however, good amplification was achieved with 50 ng genomic DNA in the ARMS-PCR reaction mixture (Fig. 2). Cost of ARMS-PCR assay and its comparison with other genotyping methods We have roughly estimated per sample cost in the three commonly used SNP genotyping methods such as TaqMan assay, PCR-RFLP and ARMS-PCR method (Table 2). The initial cost i.e. sample collection, DNA extraction, quantity and quality check for extracted DNA using 1 % agarose gel and/or spectrophotometer is equal in all the three given methods. In case of PCR-RFLP agarose gel is run twice, firstly after PCR amplification and secondly after restriction of amplified product. However in ARMS-PCR results can be deduced directly after PCR amplification and running the amplified product on agarose gel, while Real-Time based TaqMan assay does not require samples to be run on agarose gel. However, the infrastructure cost for TaqMan assay (e.g. Real Time PCR machine) is very high. Cost given in Table 2 is an estimated procedural cost for the three given methods which does not include the cost of blood sample collection and preservation, DNA extraction, DNA quantification. Moreover the cost for equipment, time, electricity and labor is also not included. Confirmation of ARMS-PCR assay results by DNA sequence analysis To confirm the genotyping results obtained by ARMS-PCR assay, we sequenced some representative samples of each genotype by Sanger method and found DNA sequence consistent with our ARMS-PCR results (Fig. 3). From this analysis, DNA sequences for only three samples are shown here, which were aligned using online available software (http://www.justbio.com/index.php?page=aligner) to show the heterogeneity of our targeted SNP. A small portion of this alignment result having (Pro12Ala, CCA[GCA) sequence is shown for three samples below.

123

Sample 1: CTCTGGGAGATTCTCCTATTGAC C/C CAGAAAGCGATTCCTTCACTGATACAC Sample 2: CTCTGGGAGATTCTCCTATTGAC G/G CAGAAAGCGATTCCTTCACTGATACAC Sample 3: CTCTGGGAGATTCTCCTATTGAC C/G CAGAAAGCGATTCCTTCACTGATACAC

Discussion Diabetes mellitus is a serious disorder which affects millions of people every year and its prevalence is also increasing in developing countries including Pakistan. To tackle this disease, many researchers are trying to elucidate the pathophysiology and genetics of diabetes, so that preventive measures can be taken. GWAS is a method of choice to study genetics of complex diseases like diabetes; however, findings of GWAS are to be replicated in different ethnic populations using high-throughput genotyping methods for SNPs analysis. The associated SNPs are targeted using established methods like DGGE, Dot blot, Taqman assay, PCR-RFLP etc. RFLP method was the first to identify SNPs even before the advent of PCR. However, RFLP has also its disadvantages like cost of the restriction enzyme, time and labor intensive. Incomplete digestion of amplified product in case of RFLP would lead to false genotyping. In comparison with RFLP method, ARMS-PCR has been preferred method for genotyping due to its simplicity and cost effectiveness [27]. Hybridization based allelic discrimination is the simplest of all methods and no enzyme treatment is involved but designing of sequence specific probes is a matter of concern. An allele specific oligonucleotide (ASO) is the simplest of hybridization methods in which two probes, one specific for each allele is required. These ASO probes can be labeled with some flourophores or mass tags for their identification. For their optimization stringent conditions are required which allow a single nucleotide mismatch probe not to hybridize with the target. Moreover the use of flourophores or mass tags increases their cost [15]. Nowadays the challenge of designing sequence specific probes has been solved to a much extent due to the development of algorithms.

Mol Biol Rep (2014) 41:5585–5591

5589

Fig. 3 DNA sequence of PPARG gene region showing Pro12Ala (CCA[GCA) polymorphism in humans. DNA sequencing of the representative samples showing three genotypes (C/C, C/G and G/G) in PPARG gene for Pro12Ala polymorphism. In the chromatogram

Blue, Black, Green and Red peaks show C, G, A and T nucleotides respectively. The highlighted region in the chromatogram represents the site for Pro12Ala (CCA[GCA) polymorphism

Typically, Molecular Beacon and TaqMan assays use this hybridization based strategy and both are quite costly techniques involving labeled probes with fluorescent and quencher dyes [28].

Another ligation dependent method is used which utilizes ligation property of DNA ligase to discriminate two alleles. Although this method has high specificity and is very simple, it is the slowest method and requires largest

123

5590

number of modified probes [13]. Dot blot method is unsuitable due to the concern of radioactivity and hazardous chemicals required in the process. An allele specific PCR approach is based on the principle that DNA polymerase only extends those primers whose 30 end is complementary to the target. Using ARMSPCR based approach, all the three possible genotypes for this variant (Pro12Ala) in PPARG have been clearly screened in diabetics in our study. A related ARMS-PCR assay has also been recently used for this SNP in Pakistani patients with rheumatoid arthritis by Jalil et al. [29]. However, in their report, the focus was the rheumatoid disease and not specifically the ARMS-PCR assay development. Hence, their paper did not report the validation of this assay by DNA sequencing as well confirmation of PCR product results on agarose gel. Moreover, they did not report the PCR reaction conditions, which potentially make it difficult to follow or reproduce the ARMS-PCR assay used in their study for this SNP. While in our report, we have provided all the experimental details for optimization, validation and confirmation of our assay as well screening human samples from control and diabetic patients. Also, our allele specific primer sequences are different from the one used by Jalil and coworkers. Thus, these data give more confidence to the ARMS-PCR assay that we have presented in this article. Overall, ARMS-PCR method is particularly suitable for developing countries in comparison to costly methods like TaqMan assay and even PCR-RFLP. In Taqman assay, which is most commonly used SNP genotyping method in developed countries, the infrastructure setup cost is very high as compared to ARMS-PCR and PCR-RFLP methods. Also Real Time PCR machine which is a sophisticated instrument is required for TaqMan assay. In PCR-RFLP method although the infrastructure setup cost is low but the procedural cost is high due to cost of restriction enzyme. Moreover the time and labor cost is very high in case of PCR-RFLP as the agarose gel is run twice to get the results. So in our opinion ARMS-PCR method is a low cost method in comparison to TaqMan and PCR-RFLP method, although the sensitivity and accuracy of TaqMan assay could not be denied. However, like all techniques, ARMSPCR assay also has some weaknesses. This method cannot be used to genotype all SNPs. For some SNP targets, ARMS-PCR assay can give high amplification of nonspecific products. For such targets, it is very difficult to optimize primers for the assay. However, different positions (-2, -3 and -4) of mismatch nucleotide at 30 end of the allele specific primers and annealing temperatures can be varied to optimize the ARMS-PCR assay for such SNPs. These efforts make this process quite challenging and labor intensive for some SNP targets. In ARMS-PCR the annealing temperature and template concentration are

123

Mol Biol Rep (2014) 41:5585–5591

critical to differentiate between two different genotypes, as low annealing temperature and high template concentration can give false positive results. Therefore, it is suggested to confirm the results, if there is low signal for amplification by repeating the experiment using different concentration of template DNA. If such problems are avoided by strictly taking care of the PCR protocol, ARMS-PCR proves to be cost-effective and rapid genotyping method especially for genotyping of diabetes related SNPs in low-income countries. Availability and application of such SNP screening assays will be helpful in future for the prediction, prevention or treatment of complex diseases like diabetes in the developing countries. Acknowledgments All authors declare that there is no conflict of interest regarding this publication. This work was supported by the student grant from Higher Education Commission (HEC), Pakistan. Use of research facilities of National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan are greatly appreciated. We are also thankful to all our colleagues for their help during this study. We thank all patients and hospital staff who participated in this study.

References 1. Whiting DR, Guariguata L, Weil C, Shaw J (2011) IDF diabetes atlas: global estimates of the prevalence of diabetes for 2011 and 2030. Diabetes Res Clin Pract 94(3):311–321 2. Shera AS, Jawad F, Maqsood A (2007) Prevalence of diabetes in Pakistan. Diabetes Res Clin Pract 76(2):219–222 3. Shera AS, Basit A, Fawwad A, Hakeem R, Ahmedani MY, Hydrie MZ, Khwaja IA (2010) Pakistan National Diabetes Survey: prevalence of glucose intolerance and associated factors in the Punjab Province of Pakistan. Prim Care Diabetes 4(2):79–83 4. Zafar J, Bhatti F, Akhtar N, Rasheed U, Bashir R, Humayun S, Waheed A, Younus F, Nazar M, Umaimato (2011) Prevalence and risk factors for diabetes mellitus in a selected urban population of a city in Punjab. J Pak Med Assoc 61(1):40–47 5. Kyvik KO, Green A, Beck-Nielsen H (1995) Concordance rates of insulin dependent diabetes mellitus: a population based study of young Danish twins. BMJ 311(7010):913–917 6. McCarthy MI (2010) Genomics, type 2 diabetes, and obesity. N Engl J Med 363(24):2339–2350 7. Travers ME, McCarthy MI (2011) Type 2 diabetes and obesity: genomics and the clinic. Hum Genet 130(1):41–58 8. Dreyer C, Krey G, Keller H, Givel F, Helftenbein G, Wahli W (1992) Control of the peroxisomal beta-oxidation pathway by a novel family of nuclear hormone receptors. Cell 68(5):879–887 9. Wanders RJ, Waterham HR (2006) Biochemistry of mammalian peroxisomes revisited. Annu Rev Biochem 75:295–332 10. Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA (1994) Peroxisome proliferator-activated receptor (PPAR) gamma: adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135(2):798–800 11. Sanghera DK, Demirci FY, Been L, Ortega L, Ralhan S, Wander GS, Mehra NK, Singh J, Aston CE, Mulvihill JJ, Kamboh IM (2010) PPARG and ADIPOQ gene polymorphisms increase type 2 diabetes mellitus risk in Asian Indian Sikhs: Pro12Ala still remains as the strongest predictor. Metabolism 59(4):492–501 12. Martinez-Gomez LE, Cruz M, Martinez-Nava GA, MadridMarina V, Parra E, Garcia-Mena J, Espinoza-Rojo M, Estrada-

Mol Biol Rep (2014) 41:5585–5591

13. 14.

15.

16.

17.

18.

19.

20.

Velasco BI, Piza-Roman LF, Aguilera P, Burguete-Garcia AI (2011) A replication study of the IRS1, CAPN10, TCF7L2, and PPARG gene polymorphisms associated with type 2 diabetes in two different populations of Mexico. Ann Hum Genet 75(5):612–620 Kwok PY, Chen X (2003) Detection of single nucleotide polymorphisms. Curr Issues Mol Biol 5(2):43–60 Sobrino B, Brion M, Carracedo A (2005) SNPs in forensic genetics: a review on SNP typing methodologies. Forensic Sci Int 154(2–3):181–194 Twyman RM (2005) Single nucleotide polymorphism (SNP) genotyping techniques—an overview. In: Fuchs J, Podda M (eds) Encyclopedia of diagnostic genomics and proteomics, vol. 2. Marcel Dekker, Inc. (now CRC Press), New York, pp 1202–1207. doi:10.1081/E-EDGP120020761 Muller YL, Bogardus C, Beamer BA, Shuldiner AR, Baier LJ (2003) A functional variant in the peroxisome proliferator-activated receptor gamma2 promoter is associated with predictors of obesity and type 2 diabetes in Pima Indians. Diabetes 52(7): 1864–1871 Montagnana M, Fava C, Nilsson PM, Engstrom G, Hedblad B, Lippi G, Minuz P, Berglund G, Melander O (2008) The Pro12Ala polymorphism of the PPARG gene is not associated with the metabolic syndrome in an urban population of middle-aged Swedish individuals. Diabet Med 25(8):902–908 Haseeb A, Iliyas M, Chakrabarti S, Farooqui AA, Naik SR, Ghosh S, Suragani M, Ehtesham NZ (2009) Single-nucleotide polymorphisms in peroxisome proliferator-activated receptor gamma and their association with plasma levels of resistin and the metabolic syndrome in a South Indian population. J Biosci 34(3):405–414 Vimaleswaran KS, Radha V, Jayapriya MG, Ghosh S, Majumder PP, Rao MR, Mohan V (2010) Evidence for an association with type 2 diabetes mellitus at the PPARG locus in a South Indian population. Metabolism 59(4):457–462 Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith JC, Markham AF (1989) Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 17(7):2503–2516

5591 21. George S, Sokolenko S, Aucoin MG (2012) Rapid and costeffective baculovirus sample preparation method as a viable alternative to conventional preparation for quantitative real-time PCR. J Virol Methods 182(1–2):27–36 22. Baig SM (2007) Molecular diagnosis of beta-thalassemia by multiplex ARMS-PCR: a cost effective method for developing countries like Pakistan. Prenat Diagn 27(6):580–581 23. Zeggini E, Groves CJ, Parkinson JR, Halford S, Owen KR, Frayling TM, Walker M, Hitman GA, Levy JC, O’Rahilly S, Hattersley AT, McCarthy MI (2005) Large-scale studies of the association between variation at the TNF/LTA locus and susceptibility to type 2 diabetes. Diabetologia 48(10):2013–2017 24. Old JM (2000) The amplification refractory mutation system. The nucleic acid protocols handbook. p 723–727 25. Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ (1990) Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18(4):999–1005 26. Ye S, Dhillon S, Ke X, Collins AR, Day IN (2001) An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res 29(17):e88 27. Duta-Cornescu G, Simon-Gruita A, Constantin N, Stanciu F, Banica MDD, Tuduce R, Cristea P, Stoian V (2009) A comparative study of ARMS–PCR and RFLP–PCR as methods for rapid SNP identification. Roman Biotechnol Lett 14(6):4845–4850 28. Shen GQ, Abdullah KG, Wang QK (2009) The TaqMan method for SNP genotyping. Methods Mol Biol 578:293–306 29. Jalil SF, Ahmed I, Gauhar Z, Ahmed M, Malik JM, John P, Bhatti A (2014) Association of Pro12Ala (rs1801282) variant of PPAR gamma with rheumatoid arthritis in a Pakistani population. Rheumatol Int 34(5):699–703. doi:10.1007/s00296-0001302768-00292

123