Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
Contents lists available at ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Development of real-time PCR assay for differential detection of Bordetella bronchiseptica and Bordetella parapertussis☆,☆☆,★ Anette Tizolova a, b, c, Delphine Brun b, c, Nicole Guiso b, c, Sophie Guillot b, c,⁎ a b c
Institute of Chemical Technology, Department of Biochemistry and Microbiology, Technicka 5, 166 28 Prague 6, Czech Republic Institut Pasteur, Unité Prévention et Thérapie Moléculaires des Maladies Humaines, 25 rue du Dr Roux, 75015 Paris, France Centre National de la Recherche Scientifique (CNRS) -URA 3012, Paris, France
a r t i c l e
i n f o
Article history: Received 19 September 2013 Received in revised form 16 December 2013 Accepted 22 December 2013 Available online 14 January 2014 Keywords: Bordetella bronchiseptica Bordetella parapertussis Real-time PCR Diagnosis
a b s t r a c t Bordetella parapertussis is a causative agent of whooping cough in humans, and B. bronchiseptica is causing wide variety of respiratory infections in mammals, including humans. Specific diagnostic tests are not currently available. Our first objective was to develop a real-time PCR test for the specific detection of B. bronchiseptica based on the previously described end-point PCR, targeting an intergenomic sequence of the fla gene locus, but it has not been reached. However, there is cross-reactivity between B. parapertussis and B. bronchiseptica. Therefore, the targeted region of several clinical isolates of both species was sequenced, and alignment of the sequences allowed the development of a 2-step real-time PCR assay. The first PCR assay detected the DNA of all clinical isolates of both B. bronchiseptica and B. parapertussis tested. The second PCR assay detected only the DNA of B. parapertussis clinical isolates, thereby allowing discrimination between B. parapertussis and B. bronchiseptica. © 2014 Elsevier Inc. All rights reserved.
1. Introduction The genus Bordetella includes the causative agents of pertussis syndrome: Bordetella pertussis and Bordetella parapertussis. Although vaccines against B. pertussis are available, outbreaks are still reported (Rodgers et al., 2013), and the incidence of B. parapertussis is higher than was recently suspected (Cherry and Seaton, 2012). B. pertussis and B. parapertussis isolates not expressing the vaccine antigen, pertactin (PRN), are currently circulating (Hegerle and Guiso, 2013). Furthermore, other related species, particularly the opportunistic pathogens Bordetella holmesii, Bordetella petrii, and Bordetella bronchiseptica have been becoming more clinically significant. B. bronchiseptica is primarily a respiratory tract pathogen that can infect various animal species and occasionally in humans. It has been isolated mostly from immunocompromised patients and, indeed, is usually associated with underlying medical conditions (Gisel et al., 2010; Gueirard et al., 1995; Patel et al., 2011; Petrocheilou-Paschou et al., 2000; Register et al., 2012; Wernli et al., 2011). Recently, this species was isolated from immunocompetent infants with persistent pneumonia (de la Torre et al., 2012; Rath et al., 2008). Numerous phylogenetic and genomic
☆ Conflict of interest: The authors declare that they have no conflicts of interest. ☆☆ Authors' contributions: Conceived and designed the experiments: AT, SG. Performed the experiments: AT, DB. Analyzed the data: AT, SG, and NG. Wrote the paper: AT, SG, and NG. Obtained the financial support: NG. All authors read and approved the final manuscript. ★ The GenBank accession number for the intergenomic fla region is [KC852863-7]. ⁎ Corresponding author. Tel.: +33-1-40-61-32-92; fax: +33-1-40-61-35-33. E-mail address: [email protected] (S. Guillot). 0732-8893/$ – see front matter © 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2013.12.020
studies have indicated that B. bronchiseptica is the closest common ancestor of the human-adapted Bordetella, B. pertussis and B. parapertussis, evolving independently from different B. bronchiseptica lineages. Multilocus sequence typing (MLST) analysis led to the description of 2 B. bronchiseptica lineages, complex I and complex IV (Diavatopoulos et al., 2005). The detection of B. bronchiseptica currently involves classic cultivation and biochemical characterisation (Vitek system, API system; matrix-associated laser desorption ionization-time of flight mass spectrometry) (Diamini et al., 2012). In 1999, we published an endpoint PCR diagnostic assay for the detection of B. bronchiseptica, based on a specific intergenomic sequence upstream from the flagellin structural gene (flaA) (Hozbor et al., 1999). Nucleic acid amplification tests, including PCR and more recently real-time PCR, overcome some of the limitations of culture and serological methods for the diagnosis of Bordetella infections. Most of the PCR tests are based on detection of insertion sequences (IS) present in multiple copies per genome, increasing the sensitivity of PCR tests. The IS481 and IS1001 are the most targets used for the detection of B. pertussis and B. parapertussis, respectively. However, the IS481 sequence is also present in B. holmesii that has been associated with pertussis-like disease (Bottero et al., 2013; Njamkepo et al., 2011; Reischl et al., 2001). B. bronchiseptica is also interfering with current consensus molecular diagnostic tests for pertussis (Riffelmann et al., 2005) because some isolates harbour IS481 (Register and Sanden, 2006; Tizolova et al., 2013) and/or IS1001 (Tizolova et al., 2013; van der Zee et al., 1993). Therefore, the presence of B. bronchiseptica can confound current molecular B. pertussis or B. parapertussis diagnostic test results. Although B. bronchiseptica may be rare, its prevalence is not known with any certainty, and it may cause
348
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
erroneous diagnosis, in particular in adolescents and adults. Clearly, a specific diagnostic assay would be useful for routine use or for use in reference laboratories (McIntyre and Sintchenko, 2013). In fact, there were only 2 specific molecular diagnostic approaches available and previously published: for B. pertussis, the target is the sequence of the pertussis toxin gene promoter (Andre et al., 2008), and for B. holmesii, the target is the hIS1001 sequence (Tatti et al., 2011). The initial objective of this work was the development of a more sensitive molecular diagnostic assay for detecting B. bronchiseptica i) collected from immunocompromised (including elderly) patients with cough resembling whooping cough or from patients with persistent cough ii) or in respiratory samples with positive Bordetella DNA harbouring IS481 sequences but not identified as a B. pertussis or B. holmesii. We adapted the fla PCR to a real-time amplification format to increase sensitivity. We optimised the assay as a 2-step PCR to overcome the cross reactivity between the B. bronchiseptica and B. parapertussis species. The specificity of this 2-step PCR for differential detection of B. bronchiseptica and B. parapertussis was then evaluated by testing recently circulating clinical isolates of B. pertussis, B. holmesii, and B. petrii. 2. Materials and methods
declared at the French Ministry of Research under the Reference: DC-2009-1067. 2.3. Culture and DNA isolation Clinical isolates and reference strains were cultivated at 36 °C for 48 hours (B. bronchiseptica, B. parapertussis, and B. petrii) to 72 hours (B. pertussis and B. holmesii) on Bordet Gengou agar containing 15% defibrinated sheep blood (Bouchez et al., 2008). Bacterial DNA was isolated with DNeasy blood and tissue kits (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s recommendations. DNA was isolated from 200 μL of dilutions of bacterial culture and from human sputum samples with High Pure PCR Template Preparation kits (Roche Diagnostics, GmbH, Mannheim, Germany). These DNA preparations were eluted in a 100-μL volume and used to determine the lower limit of detection (LLOD) of the real-time PCR (RT-PCR) assays. 2.4. MLST of B. bronchiseptica isolates
Reference strains of B. bronchiseptica (RB50), B. parapertussis (12822), B. pertussis (Tohama), and B. petrii (KMBW), B. holmesii (Bho1), clinical isolates of these species (Tizolova et al., 2013), and sputum samples (collected from patients with confirmed B. bronchiseptica infection by culture) were used and are listed in Table 1.
MLST was performed as previously described (Diavatopoulos et al., 2005). All alleles were sequenced on both strands for each isolate at the public health sequencing platform of the Pasteur Institute. The sequences were trimmed, and sequence types (STs) were designated using the Bordetella MLST database (http:// pubmlst.org/bordetella). The isolates were assigned to the complex I or IV according to their ST number; several isolates with novel STs have not yet been assigned to either of the 2 complexes and are noted NA (not assigned; Table 1).
2.2. Ethical statement
2.5. Real-time PCR assay
All clinical isolates and samples collected from patient were part of the collection of the National Reference Centre and are
Primers and Taqman probes were designed to amplify part of the intergenomic sequence located between the flaA structural gene
2.1. Strains, isolates and biological samples
Table 1 List of reference strains and clinical isolates included in the study. Bordetella species
Sample descriptiona
B. bronchiseptica
RB50 Reference strain, positive controlb 136 Clinical isolates
Human
Animal
4 Sputum samples 12822 Reference strain, positive controlb 15 Clinical isolates Tohama Reference strain 20 Clinical isolates
B. parapertussis B. pertussis
B. holmesii
Bho1 strain 12 Clinical isolates
B. petrii Other respiratory agents S. pneumoniae H. parainfluenzae M. catarrhalis A. baumannii L. pneumophila
48 isolates in complex I 30 isolates in complex IV 24 isolates in complex NA 30 isolates in complex I 1 isolate in complex IV 3 isolates in complex NA
7 isolates with no production of PRN 2 isolates with no production of PRN, 1 isolate with no production of PRN and FHA, 1 isolate with no production of pertussis toxin 6 isolates collected from blood, 2 isolates from arthritic liquid (knee aspirate), and 4 isolates collected from respiratory swabs
Reference strain KMBW 10 Clinical isolates c
NCTC NCTC NCTC NCTC NCTC
7465 7857 11020 12156 11192
NA = Isolate with novel ST and not assigned in the clonal complex I or IV. a Tizolova et al. (2013). b Reference strains B. bronchiseptica RB50 (rabbit origin) and B. parapertussis 12822 (human origin) were used as positive controls for the tests of RT-PCR. Although the strain RB50 is not from human origin, we used it for the PCR assays after verifying the highly conserved sequence flanking the gene coding the flagellar of B. bronchiseptica isolates, whatever their origin. We compared published sequences available in the Genbank and, in particular, the isolate MO149, from human origin, whom the complete genomic sequence has been published (Park et al., 2012). c List of other respiratory agents, not tested by RT-PCR but checked with blast against sequences of designed primers and probes, is: Mycoplasma pneumoniae (M129, 309, FH), Streptococcus pyogenes, Streptococcus agalactica, Chlamydophila pneumoniae, Neisseria meningitis, and Bacillus cereus.
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
349
Table 2 List of primers and probes combinations, their sequences, and the detected species. Species detected
Primers and probesa
Oligonucleotide sequenceb 5′– 3′
Positionc
Assay name
B. bronchiseptica/B. parapertussis
Fla2 Fla12 Fla-FAM3 Fla2 Bpp-Fla4c BppFla-FAMbis Fla2 Fla5
AGGCTCCCAAGAGAGAAAGGCTT AAACCTGCCGTAATCCAGGC ACCGGGCAGCTAGGCCGC ~d CCTGCCGCATCCCGT CGCCGCACGGGTGTCTGT ~d TGCAGATCCTGCACTACGAA
5-27 122-103 34-51 236-222 218-201
Bb/Bpp-Fla
414-395e
Sequencing primers
B. parapertussis
B. bronchiseptica/B. parapertussis a b c d e
Bpp2-Fla
The probes were dually labelled with the reported fluorophore FAM and BlackBerry Quencher. The sequence is given according to deposited RB50 sequence (NC002927) for Bb/Bpp-Fla assay, Fla5, and according to deposited 12822 sequence (NC002928) for Bpp2-Fla. The FLA assays target a region approximately 300-bp upstream from the flaA gene. The numbering begins after the start codon of the flaA gene. The sequence of this oligonucleotide is given above. Fla5 spanned bases 414-395 downstream from the start codon of the fliA gene.
encoding the flagellum and the fliA gene encoding a RNA polymerase sigma factor for flagellar operon. They were selected using the Primer Blast program (Yeh et al., 2012) from gene sequences in the GenBank and as reported previously (Hozbor et al., 1999). A LightCycler 480 (Roche Applied Science) was used for PCR. The 20-μL reaction mixture for detection of B. bronchiseptica/B. parapertussis (Bb/Bpp-Fla; Table 2) contained a final concentration of 1× real-time buffer, 0.5 μmol/L of each of the primers Fla2 and Fla12, the fla-FAM3 probe (Table 2) at a final concentration 0.2 μmol/L, 5% dimethyl sulfoxide (DMSO), and a 5-μL aliquot of the DNA preparation. The 20-μL reaction mixture for differentiation of B. parapertussis (Bpp2-Fla; Table 2) contained a final concentration of 1× real-time buffer, 0.5 μmol/L of each of the primers Fla2 and BppFla4c, 0.1 μmol/L of the probe BppFla-FAMbis (Table 2), and 10% DMSO and a 5-μL aliquot of the DNA preparation. The cycling conditions included 1 cycle of 95 °C for 1 minute, followed by 45 cycles of 95 °C for 10 s, 60 °C for 40 s, and 72 °C for 1 s. Acquisition of the fluorescence signal was set at 60 °C during each cycle. Positive control samples of DNA purified from the reference strains B. bronchiseptica RB50 and/or B. parapertussis 12822 and no-template control samples (PCR-grade water) were included in each run. We used the second derivative method developed by Roche for the determination of the threshold cycle (Ct) value. All experiments were performed at least 3s times. An additional internal control (as the separate amplification of a phocine herpes virus or an alternative system to the IS481 PCR) for the molecular Bordetella diagnostic of respiratory samples must be used as recommended by the European Pertussis PCR Consensus Group (Riffelmann et al., 2005).
2.7. Analytical sensitivity assay DNA extracted from series of dilutions of cultures of B. bronchiseptica RB50 and B. parapertussis 12822 (from 1 × 10 6 CFU/mL to 1 × 10 0 CFU/mL) was analysed in at least 3 independent experiments to calculate the LLOD (Table 3). A stock concentration of DNA isolated from B. bronchiseptica isolates and B. parapertussis isolates was determined on the basis of the adsorption at 260 nm with a NanoDrop ND-1000 and diluted to 100 pg/μL and used for at least 3 independent PCR experiments. 2.8. Analytical specificity assay The analytical specificity of the assay was determined by testing DNA, at 10 ng/μL, prepared from other Bordetella species (including the reference strains listed above and isolates of B. pertussis, B. holmesii, and B. petrii). DNA samples (10 ng/μL) from type strains of selected causative agents of respiratory infections were also tested: Streptococcus pneumoniae NCTC 7465, Haemophilus parainfluenzae NCTC 7857, Moraxella catarrhalis NCTC 11020, Acinetobacter baumannii NCTC 12156, and Legionella pneumophila NCTC 11192. 3. Results The starting point for the development of a B. bronchiseptica detection assay was the work we previously published (Hozbor et al., 1999), involving a set of primers, Fla2 and Fla4, for detecting B. bronchiseptica DNA. For the development of the real-time PCR, a new primer named Fla4c (differing from the original primer Fla4) was designed to improve the discrimination between B. bronchiseptica and B. parapertussis sequences. Also, 2 probes were designed for B. bronchiseptica detection (sequence of primers and probes not
2.6. Sequencing PCR Primers for sequencing were designed to amplify part of the intergenomic sequence and part of the fliA gene. Primers Fla2 and Fla5 were used for sequencing purposes (Table 2).
Table 3 Comparison of insertion sequences or single-copy gene targets for Bordetella RT-PCR diagnostic assay. Target/species
IS481
IS1001
hIS1001a
ptxA-Pra
Bb/Bpp-Fla
Bpp2-Flaa
B. pertussis B. parapertussis B. holmesii B. bronchiseptica Sensitivity (CFU/reaction)
+ − + +/− 0.5d
− + − +/− 1d
− − + − 0.2e
+b − − − 30d
− (20/20)c + (15/15) − (12/12) + (80/80) 24f
− (20/20) + (15/15) − (12/12) − (102/102) 22f
a b c d e f
Species-specific diagnostic assay. Except B. pertussis isolate lacking the sequence of the Pertussis Toxin promoter. Number of samples of corresponding species with a positive or negative PCR result/total tested. Njamkepo et al. (2011). The LLOD of the hIS1001 assay was determined according to Tatti et al. (2011); data not shown. The LLOD as determined in this study.
350
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
Fig. 1. Alignment of intergenomic region (complement sequence) between flaA gene and fliA B. bronchiseptica RB50 (BB/RB50) and B. parapertussis 12822 (BPP/12822) with indicated position primers and probes: Fla2 primer, Fla-FAM3 probe, Fla12 primer, BppFla-FAMbis probe, and Bpp-Fla4c probe; colored code dark gray for Bb/Bpp-Fla PCR assay and light gray for Bpp2-Fla PCR assay.
shown). After optimization, this PCR assay was then applied to the entire available collection of B. bronchiseptica isolates (n = 136), including those of human and animal origin, and those belonging to complexes I, IV, and NA (Table 1). DNA from the B. bronchiseptica complex I isolates was detected with the same sensitivity as the DNA of the reference strain, RB50 (n = 83/136). However, the DNA from some isolates mostly from human origin, belonging to the complex IV or NA, was not detected or was detected with only poor sensitivity (n = 53/136). We determined the sequence of a fragment of the intergenomic region of the fla locus and a part of neighbouring fliA gene in isolates from the 2 groups. This revealed that the genomes of the group of isolates that was not detected carried deletions and sequence variants in the sequences recognized by the fla-FAM2bis probe and Fla4c primer (accession number [GenBank: KC852863-7]); the corresponding sequences in the genomes of the isolates that were unambiguously detected were very similar to that in the reference strain RB50. Analysis of the sequences also revealed a region that is highly conserved in the genomes of all clinical isolates of B. bronchiseptica and B. parapertussis. This region contains regulatory sites, including a ribosome-binding site and polymerase-binding site. We, therefore, developed a diagnostic scheme for the differential detection of B. bronchiseptica and B. parapertussis, consisting of 2 steps (Fig. 1): first, a PCR with primers Fla2/Fla12 and probe Fla-FAM3 targeting the conserved region; as expected, this reaction amplified a fragment from both B. parapertussis and B. bronchiseptica DNA (Bb/Bpp-Fla assay; Table 2). The second step was a PCR specific for B. parapertussis, allowing discrimination between the 2 species. This PCR exploits the differences between the B. bronchiseptica and B. parapertussis sequences corresponding to the primer Fla4c. It involves the use of the primer Fla2, a new primer named BppFla4c, and the probe Bppfla-FAMbis (Bpp2-Fla assay; Table 2). The diagnostic scheme developed for the clinical diagnosis of Bordetella is described in Table 3. No cross-reaction with B. pertussis, B. holmesii, B. petrii, or other bacterial species was observed. The LLOD of the B. bronchiseptica/B. parapertussis realtime PCR was 24 CFU/reaction, and that of the B. parapertussis real-time PCR was 22 CFU/reaction (Table 3). Four B. bronchiseptica– positive clinical sputa were tested and all scored positive.
4. Discussion The first description of a PCR-based diagnostic assay specific for B. bronchiseptica reported no cross-reaction with other Bordetella species (Hozbor et al., 1999). However, the availability of whole genome sequences for reference strains and, for some clinical isolates, has led to the heterogeneity of the B. bronchiseptica species being more clearly documented in the last 10 years. While developing a real-time PCR based on our previous design (Hozbor et al., 1999), we confirmed the heterogeneity of the B. bronchiseptica species. The intergenomic sequence of the fla locus differs significantly between independent B. bronchiseptica clinical isolates, preventing the design of a single-step diagnostic test. Furthermore, the intergenomic sequence of the fla locus in some B. bronchiseptica clinical isolates was found to be identical to that in B. parapertussis clinical isolates. Our analyses, like some previous reports, demonstrate that the reference strains for Bordetella species are not representative of the isolates currently circulating (Caro et al., 2008). Although our first objective to develop a PCR for specific detection of B. bronchiseptica has not been reached, we describe a 2-step diagnostic real-time PCR method: the first step detects B. bronchiseptica/B. parapertussis DNA, and the second is a specific test detecting B. parapertussis DNA; no test for B. parapertussis DNA was previously available. This 2-step diagnostic method is expected to be useful for samples that are positive for IS1001 or positive for IS481 and negative for ptxA-Pr and hIS1001, as it will confirm the presence of either B. parapertussis or B. bronchiseptica DNA (Table 3). However, cases of co-infection with B. parapertussis and B. bronchiseptica isolates not carrying IS in their genome or carrying IS1001 would be problematic (Tizolova et al., 2013): B. bronchiseptica would not be detected in the samples. However, no such case of co-infection has ever been reported. The sensitivity of our real-time PCR assay for detection of B. bronchiseptica/B. parapertussis and B. parapertussis was 24 and 22 CFU per reaction, respectively. The sensitivity of the original endpoint PCR test was 100 CFU per reaction (Hozbor et al., 1999). The sensitivity of our real-time PCR assays is comparable to those of other similar tests with single-copy targets, but lower than those with multi-copies targets (generally IS) (Loeffelholz, 2012). Despite
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
improved real-time amplification technology, the use of a single-copy target is still problematic particularly for clinical samples containing only small amounts of detectable genetic material. The good specificity and sensitivity of our test are such that it should prove diagnostically useful for immunosuppressed patients (including the elderly) and patients with persistent infections. Nevertheless, we believe that it should be used mostly by specialised reference laboratories (McIntyre and Sintchenko, 2013). 5. Conclusion Our aim was to develop a specific and sensitive tool to detect B. bronchiseptica DNA in clinical samples. Because of the substantial nucleotide sequence similarities between B. bronchiseptica and B. parapertussis, we developed a specific diagnostic assay for the differential detection of these 2 species. The development of these assays led to various observations: i) reference strains are not representative of clinical isolates; ii) the difficulties encountered while developing a specific and sensitive diagnostic tool were such that assays of this type should be used only by highly trained personnel in specialised laboratories; iii) the evolution and adaptation of the species have major consequences for diagnostics and need to be considered when developing or using molecular diagnostic tests. We believe that the tests we have developed are most suitable for use by specialised reference laboratories and could be applied to epidemiological studies, both of immuno-compromised adults suffering from cystic fibrosis or persistent respiratory infections, and also immunecompetent adolescents and adults. The diagnostic method that we describe specifically detects currently circulating B. parapertussis isolates, including both those with and without PRN production, and also, by differential detection, indicates B. bronchiseptica belonging to complexes I and IV or not yet assigned in 1 of the 2 complexes. Acknowledgments We thank the Institut Pasteur Foundation, CNRS-URA 3012, the Clara Belliveau foundation, and the University Research Grant from the Institute of Chemical Technology in Prague (MSMT No. 21/2012), for financial support provided to the Unit of Molecular Prevention and Therapy of Human Diseases of A. Tizolova. References Andre P, Caro V, Njamkepo E, Wendelboe AM, Van Rie A, Guiso N. Comparison of serological and real-time PCR assays to diagnose Bordetella pertussis infection in 2007. J Clin Microbiol 2008;46(5):1672–7. http://www.ncbi.nlm.nih.gov/pubmed/ 18367565. Bottero D, Griffith MM, Lara C, Flores D, Pianciola L, Gaillard ME, et al. Bordetella holmesii in children suspected of pertussis in Argentina. Epidemiol Infect 2013(4):714–7. http://www.ncbi.nlm.nih.gov/pubmed/22874073. Bouchez V, Caro V, Levillain E, Guigon G, Guiso N. Genomic content of Bordetella pertussis clinical isolates circulating in areas of intensive children vaccination. PLoS ONE 2008;3(6):e2437. http://www.ncbi.nlm.nih.gov/pubmed/18560590. Caro V, Bouchez V, Guiso N. Is the sequenced Bordetella pertussis strain Tohama I representative of the species? J Clin Microbiol 2008;46(6):2125–8. http://www. ncbi.nlm.nih.gov/pubmed/18385436. Cherry JD, Seaton BL. Patterns of Bordetella parapertussis respiratory illnesses: 2008– 2010. Clin Infect Dis 2012;54(4):534–7. http://www.ncbi.nlm.nih.gov/pubmed/ 22156857. de la Torre MJ, de la Fuente CG, de Alegria CR, Del Molino CP, Aguero J, MartinezMartinez L. Recurrent respiratory infection caused by Bordetella bronchiseptica in an immunocompetent infant. Pediatr Infect Dis J 2012;31(9):981–3. http://www.ncbi. nlm.nih.gov/pubmed/22572751. Diamini NR, Bhamjee A, Levick P, Uniacke E, Ismail H, Smith A. Spontaneous bacterial peritonitis and pneumonia caused by Bordetella bronchiseptica. J Infect Dev Ctries 2012;6:588–91. http://www.ncbi.nlm.nih.gov/pubmed/22842947.
351
Diavatopoulos DA, Cummings CA, Schouls LM, Brinig MM, Relman DA, Mooi FR. Bordetella pertussis, the causative agent of whooping cough, evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog 2005;1(4):373–83. http://www.ncbi.nlm.nih.gov/pubmed/16389302. Gisel JJ, Brumble LM, Johnson MM. Bordetella bronchiseptica pneumonia in a kidneypancreas transplant patient after exposure to recently vaccinated dogs. Transpl Infect Dis 2010;12(1):73–6. http://www.ncbi.nlm.nih.gov/pubmed/19874567. Gueirard P, Weber C, Le Coustumier A, Guiso N. Human Bordetella bronchiseptica infection related to contact with infected animals: persistence of bacteria in host. J Clin Microbiol 1995;33(8):2002–6. http://www.ncbi.nlm.nih.gov/pubmed/ 7559937. Hegerle N, Guiso N. Epidemiology of whooping cough and typing of Bordetella pertussis. Future Microbiol 2013;8:1391–403. http://www.ncbi.nlm.nih.gov/pubmed/ 24199799. Hozbor D, Fouque F, Guiso N. Detection of Bordetella bronchiseptica by the polymerase chain reaction. Res Microbiol 1999;150(5):333–41. http://www.ncbi.nlm.nih.gov/ pubmed/10422694. Loeffelholz M. Towards improved accuracy of Bordetella pertussis nucleic acid amplification tests. J Clin Microbiol 2012(7):2186–90. http://www.ncbi.nlm.nih. gov/pubmed/22442315. McIntyre PB, Sintchenko V. The "how" of polymerase chain reaction testing for Bordetella pertussis depends on the "why". Clin Infect Dis 2013;56(3):332–4. http:// www.ncbi.nlm.nih.gov/pubmed/23087394. Njamkepo E, Bonacorsi S, Debruyne M, Gibaud SA, Guillot S, Guiso N. Significant finding of Bordetella holmesii DNA in nasopharyngeal samples from French patients with suspected pertussis. J Clin Microbiol 2011(12):4347–8. http://www.ncbi.nlm.nih. gov/pubmed/22012009. Park J, Zhang Y, Buboltz AM, Zhang X, Schuster SC, Ahuja U, et al. Comparative genomics of the classical Bordetella subspecies: the evolution and exchange of virulenceassociated diversity amongst closely related pathogens. BMC Genomics 2012;13 (1):545. http://www.ncbi.nlm.nih.gov/pubmed/23051057. Patel AK, Prescott-Focht JA, Kunin JR, Essmyer CE, Rosado-de-Christenson ML. Imaging findings in human Bordetella bronchiseptica pneumonia. J Thorac Imaging 2011;26 (4):W146–9. http://www.ncbi.nlm.nih.gov/pubmed/21263355. Petrocheilou-Paschou V, Georgilis K, Kostis E, Prifti H, Zakopoulos N, Stamatelopoulos S. Bronchitis caused by Bordetella bronchiseptica in an elderly woman. Clin Microbiol Infect 2000;6(3):147–8. http://www.ncbi.nlm.nih.gov/pubmed/11168091. Rath BA, Register KB, Wall J, Sokol DM, Van Dyke RB. Persistent Bordetella bronchiseptica pneumonia in an immunocompetent infant and genetic comparison of clinical isolates with kennel cough vaccine strains. Clin Infect Dis 2008;46(6):905–8. http://www.ncbi.nlm.nih.gov/pubmed/18260750. Register KB, Sanden GN. Prevalence and sequence variants of IS481 in Bordetella bronchiseptica: implications for IS481-based detection of Bordetella pertussis. J Clin Microbiol 2006;44(12):4577–83. Epub 2006 Oct 4525. http://www.ncbi.nlm.nih. gov/pubmed/17065269. Register KB, Sukumar N, Palavecino EL, Rubin BK, Deora R. Bordetella bronchiseptica in a paediatric cystic fibrosis patient: possible transmission from a household cat. Zoonoses Public Health 2012;59(4):246–50. http://www.ncbi.nlm.nih.gov/ pubmed/22212633. Reischl U, Lehn N, Sanden GN, Loeffelholz MJ. Real-Time PCR Assay Targeting IS481 of Bordetella pertussis and molecular basis for detecting Bordetella holmesii. J Clin Microbiol 2001(5):1963–6. http://www.ncbi.nlm.nih.gov/pubmed/11326023. Riffelmann M, von Konig CH Wirsing, Caro V, Guiso N. Nucleic Acid amplification tests for diagnosis of Bordetella infections. J Clin Microbiol 2005;43(10):4925–9. http:// www.ncbi.nlm.nih.gov/pubmed/16207944. Rodgers L, Martin SW, Cohn A, Budd J, Marcon M, Terranella A, et al. Epidemiologic and laboratory features of a large outbreak of pertussis-like illnesses associated with cocirculating Bordetella holmesii and Bordetella pertussis—Ohio, 2010–2011. Clin Infect Dis 2013;56(3):322–31. http://www.ncbi.nlm.nih.gov/pubmed/ 23087388. Tatti KM, Sparks KN, Boney KO, Tondella ML. Novel multitarget real-time PCR assay for rapid detection of Bordetella species in clinical specimens. J Clin Microbiol 2011 (12):4059–66. http://www.ncbi.nlm.nih.gov/pubmed/21940464. Tizolova A, Guiso N, Guillot S. Insertion sequences shared by Bordetella species and implications for the biological diagnosis of pertussis syndrome. Eur J Clin Microbiol 2013;32(1):89–96. http://www.ncbi.nlm.nih.gov/pubmed/22886091. van der Zee A, Agterberg C, Peeters M, Schellekens J, Mooi FR. Polymerase chain reaction assay for pertussis: simultaneous detection and discrimination of Bordetella pertussis and Bordetella parapertussis. J Clin Microbiol 1993;31(8):2134–40. http://www.ncbi.nlm.nih.gov/pubmed/8370741. Wernli D, Emonet S, Schrenzel J, Harbarth S. Evaluation of eight cases of confirmed Bordetella bronchiseptica infection and colonization over a 15-year period. Clin Microbiol Infect 2011;17(2):201–3. http://www.ncbi.nlm.nih.gov/pubmed/ 20459438. Yeh HH, Chiang YM, Entwistle R, Ahuja M, Lee KH, Bruno KS, et al. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like (NRPS-like) gene in Aspergillus nidulans is responsible for microperfuranone biosynthesis. Appl Microbiol Biotechnol 2012;96(3):739–48. http://www.ncbi.nlm.nih.gov/pubmed/ 22627757.
Contents lists available at ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Development of real-time PCR assay for differential detection of Bordetella bronchiseptica and Bordetella parapertussis☆,☆☆,★ Anette Tizolova a, b, c, Delphine Brun b, c, Nicole Guiso b, c, Sophie Guillot b, c,⁎ a b c
Institute of Chemical Technology, Department of Biochemistry and Microbiology, Technicka 5, 166 28 Prague 6, Czech Republic Institut Pasteur, Unité Prévention et Thérapie Moléculaires des Maladies Humaines, 25 rue du Dr Roux, 75015 Paris, France Centre National de la Recherche Scientifique (CNRS) -URA 3012, Paris, France
a r t i c l e
i n f o
Article history: Received 19 September 2013 Received in revised form 16 December 2013 Accepted 22 December 2013 Available online 14 January 2014 Keywords: Bordetella bronchiseptica Bordetella parapertussis Real-time PCR Diagnosis
a b s t r a c t Bordetella parapertussis is a causative agent of whooping cough in humans, and B. bronchiseptica is causing wide variety of respiratory infections in mammals, including humans. Specific diagnostic tests are not currently available. Our first objective was to develop a real-time PCR test for the specific detection of B. bronchiseptica based on the previously described end-point PCR, targeting an intergenomic sequence of the fla gene locus, but it has not been reached. However, there is cross-reactivity between B. parapertussis and B. bronchiseptica. Therefore, the targeted region of several clinical isolates of both species was sequenced, and alignment of the sequences allowed the development of a 2-step real-time PCR assay. The first PCR assay detected the DNA of all clinical isolates of both B. bronchiseptica and B. parapertussis tested. The second PCR assay detected only the DNA of B. parapertussis clinical isolates, thereby allowing discrimination between B. parapertussis and B. bronchiseptica. © 2014 Elsevier Inc. All rights reserved.
1. Introduction The genus Bordetella includes the causative agents of pertussis syndrome: Bordetella pertussis and Bordetella parapertussis. Although vaccines against B. pertussis are available, outbreaks are still reported (Rodgers et al., 2013), and the incidence of B. parapertussis is higher than was recently suspected (Cherry and Seaton, 2012). B. pertussis and B. parapertussis isolates not expressing the vaccine antigen, pertactin (PRN), are currently circulating (Hegerle and Guiso, 2013). Furthermore, other related species, particularly the opportunistic pathogens Bordetella holmesii, Bordetella petrii, and Bordetella bronchiseptica have been becoming more clinically significant. B. bronchiseptica is primarily a respiratory tract pathogen that can infect various animal species and occasionally in humans. It has been isolated mostly from immunocompromised patients and, indeed, is usually associated with underlying medical conditions (Gisel et al., 2010; Gueirard et al., 1995; Patel et al., 2011; Petrocheilou-Paschou et al., 2000; Register et al., 2012; Wernli et al., 2011). Recently, this species was isolated from immunocompetent infants with persistent pneumonia (de la Torre et al., 2012; Rath et al., 2008). Numerous phylogenetic and genomic
☆ Conflict of interest: The authors declare that they have no conflicts of interest. ☆☆ Authors' contributions: Conceived and designed the experiments: AT, SG. Performed the experiments: AT, DB. Analyzed the data: AT, SG, and NG. Wrote the paper: AT, SG, and NG. Obtained the financial support: NG. All authors read and approved the final manuscript. ★ The GenBank accession number for the intergenomic fla region is [KC852863-7]. ⁎ Corresponding author. Tel.: +33-1-40-61-32-92; fax: +33-1-40-61-35-33. E-mail address: [email protected] (S. Guillot). 0732-8893/$ – see front matter © 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2013.12.020
studies have indicated that B. bronchiseptica is the closest common ancestor of the human-adapted Bordetella, B. pertussis and B. parapertussis, evolving independently from different B. bronchiseptica lineages. Multilocus sequence typing (MLST) analysis led to the description of 2 B. bronchiseptica lineages, complex I and complex IV (Diavatopoulos et al., 2005). The detection of B. bronchiseptica currently involves classic cultivation and biochemical characterisation (Vitek system, API system; matrix-associated laser desorption ionization-time of flight mass spectrometry) (Diamini et al., 2012). In 1999, we published an endpoint PCR diagnostic assay for the detection of B. bronchiseptica, based on a specific intergenomic sequence upstream from the flagellin structural gene (flaA) (Hozbor et al., 1999). Nucleic acid amplification tests, including PCR and more recently real-time PCR, overcome some of the limitations of culture and serological methods for the diagnosis of Bordetella infections. Most of the PCR tests are based on detection of insertion sequences (IS) present in multiple copies per genome, increasing the sensitivity of PCR tests. The IS481 and IS1001 are the most targets used for the detection of B. pertussis and B. parapertussis, respectively. However, the IS481 sequence is also present in B. holmesii that has been associated with pertussis-like disease (Bottero et al., 2013; Njamkepo et al., 2011; Reischl et al., 2001). B. bronchiseptica is also interfering with current consensus molecular diagnostic tests for pertussis (Riffelmann et al., 2005) because some isolates harbour IS481 (Register and Sanden, 2006; Tizolova et al., 2013) and/or IS1001 (Tizolova et al., 2013; van der Zee et al., 1993). Therefore, the presence of B. bronchiseptica can confound current molecular B. pertussis or B. parapertussis diagnostic test results. Although B. bronchiseptica may be rare, its prevalence is not known with any certainty, and it may cause
348
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
erroneous diagnosis, in particular in adolescents and adults. Clearly, a specific diagnostic assay would be useful for routine use or for use in reference laboratories (McIntyre and Sintchenko, 2013). In fact, there were only 2 specific molecular diagnostic approaches available and previously published: for B. pertussis, the target is the sequence of the pertussis toxin gene promoter (Andre et al., 2008), and for B. holmesii, the target is the hIS1001 sequence (Tatti et al., 2011). The initial objective of this work was the development of a more sensitive molecular diagnostic assay for detecting B. bronchiseptica i) collected from immunocompromised (including elderly) patients with cough resembling whooping cough or from patients with persistent cough ii) or in respiratory samples with positive Bordetella DNA harbouring IS481 sequences but not identified as a B. pertussis or B. holmesii. We adapted the fla PCR to a real-time amplification format to increase sensitivity. We optimised the assay as a 2-step PCR to overcome the cross reactivity between the B. bronchiseptica and B. parapertussis species. The specificity of this 2-step PCR for differential detection of B. bronchiseptica and B. parapertussis was then evaluated by testing recently circulating clinical isolates of B. pertussis, B. holmesii, and B. petrii. 2. Materials and methods
declared at the French Ministry of Research under the Reference: DC-2009-1067. 2.3. Culture and DNA isolation Clinical isolates and reference strains were cultivated at 36 °C for 48 hours (B. bronchiseptica, B. parapertussis, and B. petrii) to 72 hours (B. pertussis and B. holmesii) on Bordet Gengou agar containing 15% defibrinated sheep blood (Bouchez et al., 2008). Bacterial DNA was isolated with DNeasy blood and tissue kits (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s recommendations. DNA was isolated from 200 μL of dilutions of bacterial culture and from human sputum samples with High Pure PCR Template Preparation kits (Roche Diagnostics, GmbH, Mannheim, Germany). These DNA preparations were eluted in a 100-μL volume and used to determine the lower limit of detection (LLOD) of the real-time PCR (RT-PCR) assays. 2.4. MLST of B. bronchiseptica isolates
Reference strains of B. bronchiseptica (RB50), B. parapertussis (12822), B. pertussis (Tohama), and B. petrii (KMBW), B. holmesii (Bho1), clinical isolates of these species (Tizolova et al., 2013), and sputum samples (collected from patients with confirmed B. bronchiseptica infection by culture) were used and are listed in Table 1.
MLST was performed as previously described (Diavatopoulos et al., 2005). All alleles were sequenced on both strands for each isolate at the public health sequencing platform of the Pasteur Institute. The sequences were trimmed, and sequence types (STs) were designated using the Bordetella MLST database (http:// pubmlst.org/bordetella). The isolates were assigned to the complex I or IV according to their ST number; several isolates with novel STs have not yet been assigned to either of the 2 complexes and are noted NA (not assigned; Table 1).
2.2. Ethical statement
2.5. Real-time PCR assay
All clinical isolates and samples collected from patient were part of the collection of the National Reference Centre and are
Primers and Taqman probes were designed to amplify part of the intergenomic sequence located between the flaA structural gene
2.1. Strains, isolates and biological samples
Table 1 List of reference strains and clinical isolates included in the study. Bordetella species
Sample descriptiona
B. bronchiseptica
RB50 Reference strain, positive controlb 136 Clinical isolates
Human
Animal
4 Sputum samples 12822 Reference strain, positive controlb 15 Clinical isolates Tohama Reference strain 20 Clinical isolates
B. parapertussis B. pertussis
B. holmesii
Bho1 strain 12 Clinical isolates
B. petrii Other respiratory agents S. pneumoniae H. parainfluenzae M. catarrhalis A. baumannii L. pneumophila
48 isolates in complex I 30 isolates in complex IV 24 isolates in complex NA 30 isolates in complex I 1 isolate in complex IV 3 isolates in complex NA
7 isolates with no production of PRN 2 isolates with no production of PRN, 1 isolate with no production of PRN and FHA, 1 isolate with no production of pertussis toxin 6 isolates collected from blood, 2 isolates from arthritic liquid (knee aspirate), and 4 isolates collected from respiratory swabs
Reference strain KMBW 10 Clinical isolates c
NCTC NCTC NCTC NCTC NCTC
7465 7857 11020 12156 11192
NA = Isolate with novel ST and not assigned in the clonal complex I or IV. a Tizolova et al. (2013). b Reference strains B. bronchiseptica RB50 (rabbit origin) and B. parapertussis 12822 (human origin) were used as positive controls for the tests of RT-PCR. Although the strain RB50 is not from human origin, we used it for the PCR assays after verifying the highly conserved sequence flanking the gene coding the flagellar of B. bronchiseptica isolates, whatever their origin. We compared published sequences available in the Genbank and, in particular, the isolate MO149, from human origin, whom the complete genomic sequence has been published (Park et al., 2012). c List of other respiratory agents, not tested by RT-PCR but checked with blast against sequences of designed primers and probes, is: Mycoplasma pneumoniae (M129, 309, FH), Streptococcus pyogenes, Streptococcus agalactica, Chlamydophila pneumoniae, Neisseria meningitis, and Bacillus cereus.
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
349
Table 2 List of primers and probes combinations, their sequences, and the detected species. Species detected
Primers and probesa
Oligonucleotide sequenceb 5′– 3′
Positionc
Assay name
B. bronchiseptica/B. parapertussis
Fla2 Fla12 Fla-FAM3 Fla2 Bpp-Fla4c BppFla-FAMbis Fla2 Fla5
AGGCTCCCAAGAGAGAAAGGCTT AAACCTGCCGTAATCCAGGC ACCGGGCAGCTAGGCCGC ~d CCTGCCGCATCCCGT CGCCGCACGGGTGTCTGT ~d TGCAGATCCTGCACTACGAA
5-27 122-103 34-51 236-222 218-201
Bb/Bpp-Fla
414-395e
Sequencing primers
B. parapertussis
B. bronchiseptica/B. parapertussis a b c d e
Bpp2-Fla
The probes were dually labelled with the reported fluorophore FAM and BlackBerry Quencher. The sequence is given according to deposited RB50 sequence (NC002927) for Bb/Bpp-Fla assay, Fla5, and according to deposited 12822 sequence (NC002928) for Bpp2-Fla. The FLA assays target a region approximately 300-bp upstream from the flaA gene. The numbering begins after the start codon of the flaA gene. The sequence of this oligonucleotide is given above. Fla5 spanned bases 414-395 downstream from the start codon of the fliA gene.
encoding the flagellum and the fliA gene encoding a RNA polymerase sigma factor for flagellar operon. They were selected using the Primer Blast program (Yeh et al., 2012) from gene sequences in the GenBank and as reported previously (Hozbor et al., 1999). A LightCycler 480 (Roche Applied Science) was used for PCR. The 20-μL reaction mixture for detection of B. bronchiseptica/B. parapertussis (Bb/Bpp-Fla; Table 2) contained a final concentration of 1× real-time buffer, 0.5 μmol/L of each of the primers Fla2 and Fla12, the fla-FAM3 probe (Table 2) at a final concentration 0.2 μmol/L, 5% dimethyl sulfoxide (DMSO), and a 5-μL aliquot of the DNA preparation. The 20-μL reaction mixture for differentiation of B. parapertussis (Bpp2-Fla; Table 2) contained a final concentration of 1× real-time buffer, 0.5 μmol/L of each of the primers Fla2 and BppFla4c, 0.1 μmol/L of the probe BppFla-FAMbis (Table 2), and 10% DMSO and a 5-μL aliquot of the DNA preparation. The cycling conditions included 1 cycle of 95 °C for 1 minute, followed by 45 cycles of 95 °C for 10 s, 60 °C for 40 s, and 72 °C for 1 s. Acquisition of the fluorescence signal was set at 60 °C during each cycle. Positive control samples of DNA purified from the reference strains B. bronchiseptica RB50 and/or B. parapertussis 12822 and no-template control samples (PCR-grade water) were included in each run. We used the second derivative method developed by Roche for the determination of the threshold cycle (Ct) value. All experiments were performed at least 3s times. An additional internal control (as the separate amplification of a phocine herpes virus or an alternative system to the IS481 PCR) for the molecular Bordetella diagnostic of respiratory samples must be used as recommended by the European Pertussis PCR Consensus Group (Riffelmann et al., 2005).
2.7. Analytical sensitivity assay DNA extracted from series of dilutions of cultures of B. bronchiseptica RB50 and B. parapertussis 12822 (from 1 × 10 6 CFU/mL to 1 × 10 0 CFU/mL) was analysed in at least 3 independent experiments to calculate the LLOD (Table 3). A stock concentration of DNA isolated from B. bronchiseptica isolates and B. parapertussis isolates was determined on the basis of the adsorption at 260 nm with a NanoDrop ND-1000 and diluted to 100 pg/μL and used for at least 3 independent PCR experiments. 2.8. Analytical specificity assay The analytical specificity of the assay was determined by testing DNA, at 10 ng/μL, prepared from other Bordetella species (including the reference strains listed above and isolates of B. pertussis, B. holmesii, and B. petrii). DNA samples (10 ng/μL) from type strains of selected causative agents of respiratory infections were also tested: Streptococcus pneumoniae NCTC 7465, Haemophilus parainfluenzae NCTC 7857, Moraxella catarrhalis NCTC 11020, Acinetobacter baumannii NCTC 12156, and Legionella pneumophila NCTC 11192. 3. Results The starting point for the development of a B. bronchiseptica detection assay was the work we previously published (Hozbor et al., 1999), involving a set of primers, Fla2 and Fla4, for detecting B. bronchiseptica DNA. For the development of the real-time PCR, a new primer named Fla4c (differing from the original primer Fla4) was designed to improve the discrimination between B. bronchiseptica and B. parapertussis sequences. Also, 2 probes were designed for B. bronchiseptica detection (sequence of primers and probes not
2.6. Sequencing PCR Primers for sequencing were designed to amplify part of the intergenomic sequence and part of the fliA gene. Primers Fla2 and Fla5 were used for sequencing purposes (Table 2).
Table 3 Comparison of insertion sequences or single-copy gene targets for Bordetella RT-PCR diagnostic assay. Target/species
IS481
IS1001
hIS1001a
ptxA-Pra
Bb/Bpp-Fla
Bpp2-Flaa
B. pertussis B. parapertussis B. holmesii B. bronchiseptica Sensitivity (CFU/reaction)
+ − + +/− 0.5d
− + − +/− 1d
− − + − 0.2e
+b − − − 30d
− (20/20)c + (15/15) − (12/12) + (80/80) 24f
− (20/20) + (15/15) − (12/12) − (102/102) 22f
a b c d e f
Species-specific diagnostic assay. Except B. pertussis isolate lacking the sequence of the Pertussis Toxin promoter. Number of samples of corresponding species with a positive or negative PCR result/total tested. Njamkepo et al. (2011). The LLOD of the hIS1001 assay was determined according to Tatti et al. (2011); data not shown. The LLOD as determined in this study.
350
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
Fig. 1. Alignment of intergenomic region (complement sequence) between flaA gene and fliA B. bronchiseptica RB50 (BB/RB50) and B. parapertussis 12822 (BPP/12822) with indicated position primers and probes: Fla2 primer, Fla-FAM3 probe, Fla12 primer, BppFla-FAMbis probe, and Bpp-Fla4c probe; colored code dark gray for Bb/Bpp-Fla PCR assay and light gray for Bpp2-Fla PCR assay.
shown). After optimization, this PCR assay was then applied to the entire available collection of B. bronchiseptica isolates (n = 136), including those of human and animal origin, and those belonging to complexes I, IV, and NA (Table 1). DNA from the B. bronchiseptica complex I isolates was detected with the same sensitivity as the DNA of the reference strain, RB50 (n = 83/136). However, the DNA from some isolates mostly from human origin, belonging to the complex IV or NA, was not detected or was detected with only poor sensitivity (n = 53/136). We determined the sequence of a fragment of the intergenomic region of the fla locus and a part of neighbouring fliA gene in isolates from the 2 groups. This revealed that the genomes of the group of isolates that was not detected carried deletions and sequence variants in the sequences recognized by the fla-FAM2bis probe and Fla4c primer (accession number [GenBank: KC852863-7]); the corresponding sequences in the genomes of the isolates that were unambiguously detected were very similar to that in the reference strain RB50. Analysis of the sequences also revealed a region that is highly conserved in the genomes of all clinical isolates of B. bronchiseptica and B. parapertussis. This region contains regulatory sites, including a ribosome-binding site and polymerase-binding site. We, therefore, developed a diagnostic scheme for the differential detection of B. bronchiseptica and B. parapertussis, consisting of 2 steps (Fig. 1): first, a PCR with primers Fla2/Fla12 and probe Fla-FAM3 targeting the conserved region; as expected, this reaction amplified a fragment from both B. parapertussis and B. bronchiseptica DNA (Bb/Bpp-Fla assay; Table 2). The second step was a PCR specific for B. parapertussis, allowing discrimination between the 2 species. This PCR exploits the differences between the B. bronchiseptica and B. parapertussis sequences corresponding to the primer Fla4c. It involves the use of the primer Fla2, a new primer named BppFla4c, and the probe Bppfla-FAMbis (Bpp2-Fla assay; Table 2). The diagnostic scheme developed for the clinical diagnosis of Bordetella is described in Table 3. No cross-reaction with B. pertussis, B. holmesii, B. petrii, or other bacterial species was observed. The LLOD of the B. bronchiseptica/B. parapertussis realtime PCR was 24 CFU/reaction, and that of the B. parapertussis real-time PCR was 22 CFU/reaction (Table 3). Four B. bronchiseptica– positive clinical sputa were tested and all scored positive.
4. Discussion The first description of a PCR-based diagnostic assay specific for B. bronchiseptica reported no cross-reaction with other Bordetella species (Hozbor et al., 1999). However, the availability of whole genome sequences for reference strains and, for some clinical isolates, has led to the heterogeneity of the B. bronchiseptica species being more clearly documented in the last 10 years. While developing a real-time PCR based on our previous design (Hozbor et al., 1999), we confirmed the heterogeneity of the B. bronchiseptica species. The intergenomic sequence of the fla locus differs significantly between independent B. bronchiseptica clinical isolates, preventing the design of a single-step diagnostic test. Furthermore, the intergenomic sequence of the fla locus in some B. bronchiseptica clinical isolates was found to be identical to that in B. parapertussis clinical isolates. Our analyses, like some previous reports, demonstrate that the reference strains for Bordetella species are not representative of the isolates currently circulating (Caro et al., 2008). Although our first objective to develop a PCR for specific detection of B. bronchiseptica has not been reached, we describe a 2-step diagnostic real-time PCR method: the first step detects B. bronchiseptica/B. parapertussis DNA, and the second is a specific test detecting B. parapertussis DNA; no test for B. parapertussis DNA was previously available. This 2-step diagnostic method is expected to be useful for samples that are positive for IS1001 or positive for IS481 and negative for ptxA-Pr and hIS1001, as it will confirm the presence of either B. parapertussis or B. bronchiseptica DNA (Table 3). However, cases of co-infection with B. parapertussis and B. bronchiseptica isolates not carrying IS in their genome or carrying IS1001 would be problematic (Tizolova et al., 2013): B. bronchiseptica would not be detected in the samples. However, no such case of co-infection has ever been reported. The sensitivity of our real-time PCR assay for detection of B. bronchiseptica/B. parapertussis and B. parapertussis was 24 and 22 CFU per reaction, respectively. The sensitivity of the original endpoint PCR test was 100 CFU per reaction (Hozbor et al., 1999). The sensitivity of our real-time PCR assays is comparable to those of other similar tests with single-copy targets, but lower than those with multi-copies targets (generally IS) (Loeffelholz, 2012). Despite
A. Tizolova et al. / Diagnostic Microbiology and Infectious Disease 78 (2014) 347–351
improved real-time amplification technology, the use of a single-copy target is still problematic particularly for clinical samples containing only small amounts of detectable genetic material. The good specificity and sensitivity of our test are such that it should prove diagnostically useful for immunosuppressed patients (including the elderly) and patients with persistent infections. Nevertheless, we believe that it should be used mostly by specialised reference laboratories (McIntyre and Sintchenko, 2013). 5. Conclusion Our aim was to develop a specific and sensitive tool to detect B. bronchiseptica DNA in clinical samples. Because of the substantial nucleotide sequence similarities between B. bronchiseptica and B. parapertussis, we developed a specific diagnostic assay for the differential detection of these 2 species. The development of these assays led to various observations: i) reference strains are not representative of clinical isolates; ii) the difficulties encountered while developing a specific and sensitive diagnostic tool were such that assays of this type should be used only by highly trained personnel in specialised laboratories; iii) the evolution and adaptation of the species have major consequences for diagnostics and need to be considered when developing or using molecular diagnostic tests. We believe that the tests we have developed are most suitable for use by specialised reference laboratories and could be applied to epidemiological studies, both of immuno-compromised adults suffering from cystic fibrosis or persistent respiratory infections, and also immunecompetent adolescents and adults. The diagnostic method that we describe specifically detects currently circulating B. parapertussis isolates, including both those with and without PRN production, and also, by differential detection, indicates B. bronchiseptica belonging to complexes I and IV or not yet assigned in 1 of the 2 complexes. Acknowledgments We thank the Institut Pasteur Foundation, CNRS-URA 3012, the Clara Belliveau foundation, and the University Research Grant from the Institute of Chemical Technology in Prague (MSMT No. 21/2012), for financial support provided to the Unit of Molecular Prevention and Therapy of Human Diseases of A. Tizolova. References Andre P, Caro V, Njamkepo E, Wendelboe AM, Van Rie A, Guiso N. Comparison of serological and real-time PCR assays to diagnose Bordetella pertussis infection in 2007. J Clin Microbiol 2008;46(5):1672–7. http://www.ncbi.nlm.nih.gov/pubmed/ 18367565. Bottero D, Griffith MM, Lara C, Flores D, Pianciola L, Gaillard ME, et al. Bordetella holmesii in children suspected of pertussis in Argentina. Epidemiol Infect 2013(4):714–7. http://www.ncbi.nlm.nih.gov/pubmed/22874073. Bouchez V, Caro V, Levillain E, Guigon G, Guiso N. Genomic content of Bordetella pertussis clinical isolates circulating in areas of intensive children vaccination. PLoS ONE 2008;3(6):e2437. http://www.ncbi.nlm.nih.gov/pubmed/18560590. Caro V, Bouchez V, Guiso N. Is the sequenced Bordetella pertussis strain Tohama I representative of the species? J Clin Microbiol 2008;46(6):2125–8. http://www. ncbi.nlm.nih.gov/pubmed/18385436. Cherry JD, Seaton BL. Patterns of Bordetella parapertussis respiratory illnesses: 2008– 2010. Clin Infect Dis 2012;54(4):534–7. http://www.ncbi.nlm.nih.gov/pubmed/ 22156857. de la Torre MJ, de la Fuente CG, de Alegria CR, Del Molino CP, Aguero J, MartinezMartinez L. Recurrent respiratory infection caused by Bordetella bronchiseptica in an immunocompetent infant. Pediatr Infect Dis J 2012;31(9):981–3. http://www.ncbi. nlm.nih.gov/pubmed/22572751. Diamini NR, Bhamjee A, Levick P, Uniacke E, Ismail H, Smith A. Spontaneous bacterial peritonitis and pneumonia caused by Bordetella bronchiseptica. J Infect Dev Ctries 2012;6:588–91. http://www.ncbi.nlm.nih.gov/pubmed/22842947.
351
Diavatopoulos DA, Cummings CA, Schouls LM, Brinig MM, Relman DA, Mooi FR. Bordetella pertussis, the causative agent of whooping cough, evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog 2005;1(4):373–83. http://www.ncbi.nlm.nih.gov/pubmed/16389302. Gisel JJ, Brumble LM, Johnson MM. Bordetella bronchiseptica pneumonia in a kidneypancreas transplant patient after exposure to recently vaccinated dogs. Transpl Infect Dis 2010;12(1):73–6. http://www.ncbi.nlm.nih.gov/pubmed/19874567. Gueirard P, Weber C, Le Coustumier A, Guiso N. Human Bordetella bronchiseptica infection related to contact with infected animals: persistence of bacteria in host. J Clin Microbiol 1995;33(8):2002–6. http://www.ncbi.nlm.nih.gov/pubmed/ 7559937. Hegerle N, Guiso N. Epidemiology of whooping cough and typing of Bordetella pertussis. Future Microbiol 2013;8:1391–403. http://www.ncbi.nlm.nih.gov/pubmed/ 24199799. Hozbor D, Fouque F, Guiso N. Detection of Bordetella bronchiseptica by the polymerase chain reaction. Res Microbiol 1999;150(5):333–41. http://www.ncbi.nlm.nih.gov/ pubmed/10422694. Loeffelholz M. Towards improved accuracy of Bordetella pertussis nucleic acid amplification tests. J Clin Microbiol 2012(7):2186–90. http://www.ncbi.nlm.nih. gov/pubmed/22442315. McIntyre PB, Sintchenko V. The "how" of polymerase chain reaction testing for Bordetella pertussis depends on the "why". Clin Infect Dis 2013;56(3):332–4. http:// www.ncbi.nlm.nih.gov/pubmed/23087394. Njamkepo E, Bonacorsi S, Debruyne M, Gibaud SA, Guillot S, Guiso N. Significant finding of Bordetella holmesii DNA in nasopharyngeal samples from French patients with suspected pertussis. J Clin Microbiol 2011(12):4347–8. http://www.ncbi.nlm.nih. gov/pubmed/22012009. Park J, Zhang Y, Buboltz AM, Zhang X, Schuster SC, Ahuja U, et al. Comparative genomics of the classical Bordetella subspecies: the evolution and exchange of virulenceassociated diversity amongst closely related pathogens. BMC Genomics 2012;13 (1):545. http://www.ncbi.nlm.nih.gov/pubmed/23051057. Patel AK, Prescott-Focht JA, Kunin JR, Essmyer CE, Rosado-de-Christenson ML. Imaging findings in human Bordetella bronchiseptica pneumonia. J Thorac Imaging 2011;26 (4):W146–9. http://www.ncbi.nlm.nih.gov/pubmed/21263355. Petrocheilou-Paschou V, Georgilis K, Kostis E, Prifti H, Zakopoulos N, Stamatelopoulos S. Bronchitis caused by Bordetella bronchiseptica in an elderly woman. Clin Microbiol Infect 2000;6(3):147–8. http://www.ncbi.nlm.nih.gov/pubmed/11168091. Rath BA, Register KB, Wall J, Sokol DM, Van Dyke RB. Persistent Bordetella bronchiseptica pneumonia in an immunocompetent infant and genetic comparison of clinical isolates with kennel cough vaccine strains. Clin Infect Dis 2008;46(6):905–8. http://www.ncbi.nlm.nih.gov/pubmed/18260750. Register KB, Sanden GN. Prevalence and sequence variants of IS481 in Bordetella bronchiseptica: implications for IS481-based detection of Bordetella pertussis. J Clin Microbiol 2006;44(12):4577–83. Epub 2006 Oct 4525. http://www.ncbi.nlm.nih. gov/pubmed/17065269. Register KB, Sukumar N, Palavecino EL, Rubin BK, Deora R. Bordetella bronchiseptica in a paediatric cystic fibrosis patient: possible transmission from a household cat. Zoonoses Public Health 2012;59(4):246–50. http://www.ncbi.nlm.nih.gov/ pubmed/22212633. Reischl U, Lehn N, Sanden GN, Loeffelholz MJ. Real-Time PCR Assay Targeting IS481 of Bordetella pertussis and molecular basis for detecting Bordetella holmesii. J Clin Microbiol 2001(5):1963–6. http://www.ncbi.nlm.nih.gov/pubmed/11326023. Riffelmann M, von Konig CH Wirsing, Caro V, Guiso N. Nucleic Acid amplification tests for diagnosis of Bordetella infections. J Clin Microbiol 2005;43(10):4925–9. http:// www.ncbi.nlm.nih.gov/pubmed/16207944. Rodgers L, Martin SW, Cohn A, Budd J, Marcon M, Terranella A, et al. Epidemiologic and laboratory features of a large outbreak of pertussis-like illnesses associated with cocirculating Bordetella holmesii and Bordetella pertussis—Ohio, 2010–2011. Clin Infect Dis 2013;56(3):322–31. http://www.ncbi.nlm.nih.gov/pubmed/ 23087388. Tatti KM, Sparks KN, Boney KO, Tondella ML. Novel multitarget real-time PCR assay for rapid detection of Bordetella species in clinical specimens. J Clin Microbiol 2011 (12):4059–66. http://www.ncbi.nlm.nih.gov/pubmed/21940464. Tizolova A, Guiso N, Guillot S. Insertion sequences shared by Bordetella species and implications for the biological diagnosis of pertussis syndrome. Eur J Clin Microbiol 2013;32(1):89–96. http://www.ncbi.nlm.nih.gov/pubmed/22886091. van der Zee A, Agterberg C, Peeters M, Schellekens J, Mooi FR. Polymerase chain reaction assay for pertussis: simultaneous detection and discrimination of Bordetella pertussis and Bordetella parapertussis. J Clin Microbiol 1993;31(8):2134–40. http://www.ncbi.nlm.nih.gov/pubmed/8370741. Wernli D, Emonet S, Schrenzel J, Harbarth S. Evaluation of eight cases of confirmed Bordetella bronchiseptica infection and colonization over a 15-year period. Clin Microbiol Infect 2011;17(2):201–3. http://www.ncbi.nlm.nih.gov/pubmed/ 20459438. Yeh HH, Chiang YM, Entwistle R, Ahuja M, Lee KH, Bruno KS, et al. Molecular genetic analysis reveals that a nonribosomal peptide synthetase-like (NRPS-like) gene in Aspergillus nidulans is responsible for microperfuranone biosynthesis. Appl Microbiol Biotechnol 2012;96(3):739–48. http://www.ncbi.nlm.nih.gov/pubmed/ 22627757.
