Placenta 35 (2014) 1079e1088

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Developmental differences in the expression of FGF receptors between human and mouse embryos T. Kunath a, *, Y. Yamanaka b, J. Detmar c, D. MacPhee d, I. Caniggia c, J. Rossant c, e, f, A. Jurisicova c, * a

MRC Centre for Regenerative Medicine, School of Biological Sciences, University of Edinburgh, 5 Little France Drive, Edinburgh EH16 4UU, UK Rosalind and Morris Goodman Cancer Research Centre, Department of Human Genetics, McGill University, 1160 Pine Avenue West, Montr eal, Quebec H3A 1A3, Canada c Department of Obstetrics and Gynecology, University of Toronto, Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, 25 Orde Street, Toronto, Ontario M5T 3H7, Canada d Western College of Veterinary Medicine, University of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4, Canada e Program in Developmental & Stem Cell Biology, Hospital for Sick Children, Toronto, Ontario, Canada f Department of Molecular Genetics, University of Toronto, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada b

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 13 September 2014

Introduction: Fibroblast growth factor (FGF) signaling is essential for early trophoblast expansion and maintenance in the mouse, but is not required for trophectoderm specification during blastocyst formation. This signaling pathway is stably activated to expand the trophoblast stem cell compartment in vivo, while in vitro, FGFs are used for the derivation of trophoblast stem (TS) cells from blastocysts and early post-implantation mouse embryos. However, the function of FGFs during human trophoblast development is not known. Methods: We sought to derive TS cells from human blastocysts in a number of culture conditions, including in the presence of FGFs and stem cell factor (SCF). We also investigated the expression of FGF receptors (FGFRs) in blastocysts, and the expression of FGFR2 and activated ERK1/2 in first trimester human placentae. Results: We found that SCF, but not FGF2/4, improved the quality of blastocyst outgrowths, but we were unable to establish stable human TS cell lines. We observed CDX2 expression in the trophectoderm of fully blastocysts, but rarely observed transcription of FGFRs. FGFR2 protein was not detected in human blastocysts, but was strongly expressed in mouse blastocysts. However, we found robust FGFR2 expression and activated ERK1/2 in the cytotrophoblast layer of early human placenta. Discussion: Our data suggests that initiation of FGF-dependent trophoblast expansion may occur later in human development, and is unlikely to drive maintenance of a TS cell compartment during the periimplantation period. These findings suggest that cytotrophoblast preparations from early placentae may be a potential source of FGF-dependent human TS cells. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Blastocyst Trophoblast Human Mouse FGF receptors FGFR2 CDX2

1. Introduction Specification of trophectoderm (TE) is an essential first step for mammalian preimplantation development. This lineage is critical for mediating early events such as blastocyst expansion, hatching from the zona pellucida, implantation into the uterus, as well as

* Corresponding authors. E-mail addresses: [email protected] (T. Kunath), [email protected] (A. Jurisicova). http://dx.doi.org/10.1016/j.placenta.2014.09.008 0143-4004/© 2014 Elsevier Ltd. All rights reserved.

providing signals for epiblast development. Defects in trophectoderm function result in severe developmental consequences, which can lead to the demise of the developing early embryo. After implantation, the TE must proliferate to generate the supportive trophoblastic cells needed for continued development. In the mouse, polar TE adjacent to the epiblast expands rapidly to form the extraembryonic ectoderm (ExE) and this process is dependent on FGF-ERK signaling [1,2]. Furthermore, knock-out of the ligand, FGF4, or the receptor, FGFR2, results in embryonic lethality at the peri-implantation stage [3,4]. We have proposed that the lethality is due to a failure of polar TE expansion shortly after implantation

1080

T. Kunath et al. / Placenta 35 (2014) 1079e1088

[2]. ERK2, a MAP kinase downstream of FGF signaling, is also essential for expansion of the nascent trophoblast tissue to form the ExE [5]. The mouse blastocyst, and the post-implantation ExE, are a source of stable FGF-dependent trophoblast stem (TS) cell lines that possess the unique potential to contribute to all trophoblast lineages in chimeras [6]. TS cell lines are distinct in their growth factor dependency and developmental potential in chimeras, in comparison to embryonic stem (ES) cells and extraembryonic endoderm stem (XEN) cells [7e9]. TS cells also exhibit distinct molecular signatures, characterized by unique expression of key trophoblast determinants, such as CDX2 and eomesodermin (EOMES) [10,11]. ES cells express the critical pluripotency factors OCT4 and NANOG [12e14], in addition to ESRRB and SOX2 which are important for both ES and TS cells [15,16]. While these key transcriptional players have been functionally characterized in mouse stem cell systems, less is known about their involvement in other mammalian species. Human embryonic stem (hES) cells express the pluripotency factors OCT4 and NANOG, as observed in mouse ES cells [17,18]. However, when the expression of OCT4 was carefully analyzed in human blastocysts, it was found to be expressed in both inner cell mass (ICM) and TE [19]. In contrast, NANOG has been reported to be restricted to the ICM of human blastocysts [20,21]. The involvement of CDX2 in human preimplantation development is not known, although it has been correlated to a switch in developmental fate of human ES cells from embryonic to extraembryonic in vitro [21]. This suggests a conservation of molecular regulation in lineage specification between mouse and human preimplantation embryos. Despite the successful derivation of three distinct stem cell lines from preimplantation mouse embryos, it is currently unknown if TS cells or XEN cells can be derived from human blastocysts and if they would have identical cytokine dependency as the mouse stem cell systems. BMP4 is proposed to induce trophoblast differentiation in hES cells [22,23], although this has been debated [24]. Recent work has shown that BMP4-induced cells from hES cells have a transcriptional signature most similar to the trophoblast compartment of human placenta and not extraembryonic mesoderm [25]. Using an embryoid body selection procedure self-renewing cytotrophoblast stem (CTBS) cell lines were successfully established from hES cells [26]. More recently, human trophoblast progenitor cells

(TBPCs) have been established from 7 to 8 week chorionic tissue [27], while isolation and culture of cytotrophoblasts from term placenta always results in a decline in proliferation and rapid syncytialisation [28,29]. Here we describe our attempts to derive human TS cells from in vitro cultured blastocysts under a variety of conditions. Although we were unable to derive any stable human TS cell lines, we show that FGF receptor (FGFR) expression is not easily detected in expanded human blastocysts. However, we observed significant expression of FGFR1 and FGFR2 in first trimester placenta. FGFR2 protein was specifically observed in the cytotrophoblast layer of placentae by 5 weeks of gestation, where it was associated with activated ERK1/2. This suggests that FGF signaling is initiated later in human development and may reflect a delayed cytotrophoblast proliferative response. Thus, a potential source of self-renewing FGF-dependent human TS cells is the chorionic villi of early placental preparations. 2. Materials and methods 2.1. Human blastocyst culture and manipulation Spare human preimplantation embryos were obtained from the IVF Program, Division of Reproductive Sciences, at the Toronto General Hospital and Mount Sinai Hospital. Those patients who elected not to freeze their spare embryos for future transfers, either by choice or because the embryos were not suitable for cryopreservation, were counseled and informed consent was obtained. This project was approved by the human ethics committees of the Toronto General Hospital and Mount Sinai Hospital, respectively. Most human embryos were hatched from the zona pellucida with acid Tyrode's solution. Human embryonic fibroblasts (EMFIs) were derived from a 13-week old fetus and have been previously described [30]. TS cell medium used was RPMI 1640 (Life Technologies) supplemented with 20% fetal bovine serum (HyClone, Utah, cat no. SH30071.03, lot no. AGB6156), 1 mM sodium pyruvate (Life Technologies), 1 mM L-glutamine (Life Technologies), and 100 mM bmercaptoethanol (Sigma) [6]. Hatched blastocysts were plated on: (i) mitomycin-Ctreated mouse embryonic fibroblasts (EMFIs), (ii) mitomycin-C-treated human EMFIs, (iii) 0.1% porcine gelatin (Sigma, cat no. G1890), (iv) Matrigel (BD, cat no. 356234), or (v) fibronectin (0.15 mg/cm2, Life Tech, cat no. 33010-018). Human recombinant FGF4 (R&D Systems, cat no. 235-F4) or FGF2 (R&D Systems, cat no. 233FB) was supplemented in the range of 25e50 ng/ml in the presence of 1e2 mg/ml of heparin (Sigma). Human recombinant SCF (Stem Cell Technologies, cat no. 02630) or GM-CSF (R&D Systems, cat no. 215-GM) was supplemented at 50 ng/ml. Two human blastocysts were cultured in DMEM/F12 (Life Technologies) supplemented with FGF4 (50 ng/ml), heparin (2 mg/ml) and acetylsalicylic acid (ASA) (Sigma). All media were supplemented with 100 U/ml penicillin, and 100 mg/ml streptomycin. Human EMFIs (passage 3) were inactivated with mitomycin C (20 mg/ml) for 3 h [30]. 70% conditioned (70cond) medium from mouse and human EMFIs was prepared as

Table 1 Culture conditions for human blastocysts. Condition

Medium and substrate description

# of embryos

Blastocyst ID

A B B-low C D D-low E F G H I J K L-low M M-low N O

TS þ FGF4 þ Hep on mouse EMFIs TS þ FGF4 þ Hep on human EMFIs TS þ FGF4 þ Hep on human EMFIs TS þ FGF4 þ Hep þ SCF on human EMFIs 70cond þ FGF4 þ Hep on gelatin 70cond þ FGF4 þ Hep on gelatin 70cond þ FGF2 þ Hep on gelatin 70cond on gelatin Hs 70cond þ FGF4 þ Hep on gelatin Hs 70cond þ FGF4 þ Hep þ SCF on gelatin 70cond þ FGF4 þ Hep on Matrigel DMEM/F12 þ FGF4 þ Hep þ ASA on Matrigel DMEM/F12 þ FGF4 þ Hep þ ASA þ 20% FBS on Matrigel 70cond þ FGF4 þ Hep þ SCF on gelatin 70cond þ SCF on gelatin 70cond þ SCF on gelatin 70cond þ FGF4 þ GM-CSF on gelatin 70cond þ FGF4 þ GM-CSF on fibronectin

13 5 2 5 9 2 2 3 4 9 2 1 1 2 2 1 3 2

1, 2, 3, 4, 6, 7, 8, 20, 21, 22, 23, 28, 30 32, 33, 37, 38, 40 34, 39 49, 50, 51, 52, 53 5, 11, 12, 15, 16, 17, 31, 70, 71 18, 19 76, 79 75, 78, 81 35, 36, 41, 64 54, 55, 56, 57, 58, 59, 60, 62, 63 13, 14 9 10 72, 73 77, 80 74 67, 68, 69 65, 66

TOTAL

68

Various culture conditions for each human blastocyst. Conditions at low (5%) oxygen are indicated by ‘low’. TS, TS cell medium. Hep, heparin. EMFIs, embryonic fibroblasts. SCF, stem cell factor. 70cond, 70% conditioned medium (mouse). Hs, human. ASA, acetylsalicylic acid. GM-CSF, granulocyte-macrophage colony-stimulating factor.

T. Kunath et al. / Placenta 35 (2014) 1079e1088 previously described [6,31]. Briefly, TS cell medium was conditioned on inactivated EMFIs (72 h for mouse, and 48 h for human) before collection and centrifugation to remove cell debris. The conditioned medium was then filtered (0.22 mm) and frozen. To prepare ‘70cond’ medium, mouse- or human-conditioned medium (70%) and fresh TS cell medium (30%) were mixed just prior to use. The majority of embryos were plated in normoxic conditions, while seven embryos were plated in hypoxic (90% N2, 5% CO2, 5% O2) conditions. A full list of culture conditions is described in Table 1. Blastocyst outgrowths were disaggregated with dispase (Stem Cell Technologies) and a hand-drawn glass mouth-pipette before re-plating.

1081

second assay was performed by applying 50 ml of sample diluted 1:49 in fresh culture medium. 2.4. Gene expression studies

Each blastocyst outgrowth was given a qualitative score at 4 days after attachment. Score 1: Attachment occurred, but no evidence of further outgrowth. Score 2: Small outgrowth with evidence of differentiation around edges. Score 3: Medium outgrowth that may be accompanied with differentiation. Score 4: Large outgrowth with minimal differentiation. Blastocysts that did not attach to the EMFIs or substrate were not scored. See Supplementary Table S1 for all outgrowth scoring data.

The expression of all four FGF receptor genes was investigated in human blastocysts by RT-PCR. Nuclei acid was precipitated form single blastocysts (n ¼ 11) using glycogen as a carrier and samples were subjected to RT-PCR using gene-specific primers as previously described [32]. Total RNA extracted from human first trimester placenta or MCF7 cells were used a positive control. The amplified products were separated through a 1.5% agarose gel and identification was confirmed by sequencing. The individual intron-spanning primers were as follows: FGFR1 forward: GATGTTGAAGTCGGACGCA, reverse: TGGTGGGTGTAGATCCGGT; FGFR2 forward: GTACATGATGATGAGGGACTG, reverse: GTCCACCTTGAGTCCTACTGGT; FGFR3 forward: AAGCCTGTCACCGTAGCCG, reverse: GACAGGTCCAGGTACTCGTCG; FGFR4 forward: CATCATCCTGTACGCGTCG, reverse: ATGTTCTTGTGTCGGCCGA. As an internal control for cDNA quality, PCR was performed to amplify b-actin cDNA (forward: ATCATGTTTGAGACCTTCAA; reverse: CATCTCTTGCTCGAAGTCCA).

2.3. Quantification of hCG in blastocyst outgrowth culture medium

2.5. Immunocytochemistry of human and mouse blastocysts

To determine human chorionic gonadotropin (hCG) levels in culture medium obtained from human blastocyst outgrowths, a commercial kit was employed (ICN Pharmaceuticals, Orangeburg, NY, USA) and the manufacturer's protocol was followed. Briefly, the samples were applied to a single well with 100 ml of hCG Zero Buffer for 60 min at room temperature, with shaking. Washes, secondary detection, substrate development and derivation of final hCG concentrations using a linear standard curve, were all performed according to the manufacturer's directions. For those samples that exceeded the upper limits of the standard curve, a

To characterize expression of CDX2, human blastocysts were fixed with 4% paraformaldehyde (PFA) in PBS overnight at 4  C and permeabilized with 0.5% Triton X-100 in PBS (PBS-T) for 15 min. After blocking with 10% FBS in PBS with 0.1% Tween20 (PBT), embryos were treated with primary antibody, anti-CDX2 (1:200 dilution, CDX2-88 from BioGenex, cat no. MU392-UC) overnight at 4  C. After several washes in PBS-T, embryos were treated with a secondary antibody conjugated with AlexaFluor 488 (1:400 dilution, Molecular Probes) in PBT for 1 h at room temperature. After the last wash, embryos were treated with 10 mM YOYO-3 (Molecular Probes)

2.2. Scoring of blastocyst outgrowths

Fig. 1. Qualitative scoring of human blastocyst outgrowths at day 4. (A) Score 1, blastocyst No. 22 cultured on mouse EMFIs in FGF4 and heparin. (B) Score 2, blastocyst No. 5 cultured on gelatin in 70cond supplemented with FGF4 and heparin. (C) Score 3, blastocyst No. 19 cultured on gelatin in 70cond supplemented with FGF4 and heparin in 5% oxygen. (D) Score 4, blastocyst No. 11 cultured on gelatin in 70cond supplemented with FGF4 and heparin. Scale bar, 10 mm. (E) Levels of hCG in conditioned media were measured from blastocyst outgrowths of different quality (n ¼ 3 for Score 1, n ¼ 3 for Score 2, n ¼ 4 for Score 3, and n ¼ 5 for Score 4).

1082

T. Kunath et al. / Placenta 35 (2014) 1079e1088

and 100 mg/ml RNaseA in PBT for 15 min at room temperature to visualize nuclei. After washing, embryos were placed in the wells of Secure Seal (Molecular Probes) between two cover slips. Embryo images were taken with a Leica TCS2 confocal microscope using a 20 (NA ¼ 0.7) objective lens. To examine FGFR2 protein expression, indirect immunocytochemistry was performed. Human or mouse embryos that had reached the blastocyst stage were fixed in formalin and air-dried on slides. Following antigen retrieval in citrate buffer, samples were washed and preblocked in 10% normal goat serum with 0.1% Triton X-100 in PBS. Embryos were incubated overnight at 4  C with sheep polyclonal anti-FGFR2 antibody raised against the extracellular domain of human FGFR2 (1:200 dilution, gift from P. Lonai, Weizmann Institute, Israel) [33,34]. After several washes a donkey anti-sheep Cy5conjugated (Jackson Immunological Laboratories) was applied at a 1:200 dilution for 1 h at room temperature. Embryos were counterstained with DAPI and visualized using deconvolution microscopy with DeltaVision software (Applied Precision, Issaquah, WA, USA). 2.6. Immunocytochemistry of human placenta Placental tissue was obtained from elective terminations by dilatation and curettage. The tissue was collected in ice-cold sterile PBS containing 100 mM sodium orthovanadate and complete Mini EDTA-free protease inhibitors (Roche Molecular Biochemicals) and transported to the laboratory within 20 min of the procedure. All tissue samples were extensively washed, then dissected with cold PBS containing inhibitors and fixed in 4% paraformaldehyde in sterile PBS, followed by processing and embedding in paraffin and sectioned. After endogenous peroxidase quenching in 1% H2O2, high-temperature (microwave) antigen retrieval in 10 mM citrate buffer was performed. Sections were incubated overnight at 4  C with sheep polyclonal anti-FGFR2 antibody (1:200 dilution). Subsequent detection was carried out using appropriate secondary biotinylated IgG antibody and Vectastain ABC kit (DAKO) with diaminobenzidine as a peroxidase substrate (Sigma). The sections were counterstained with hematoxylin, dehydrated and mounted in DPX mounting medium. Activated ERK1/2 immunofluorescence staining was carried out as previously described [35]. Briefly, first trimester placental tissue sections were deparaffinized

using xylene and heat-induced antigen retrieval was performed using 10 mM sodium citrate buffer solution. Placental sections were then treated with 5% normal horse serum in PBS to block non-specific binding and then incubated overnight at 4  C with primary antibody (phospho-p44/42 ERK1/2 rabbit polyclonal, 1:200 dilution, Cell Signaling). For negative controls, the primary antibodies were replaced with isotype IgG antibodies. Sections were washed in PBS and incubated with fluorescence conjugated AlexaFluor secondary antibodies (1:200). Fluorescence images were captured using DeltaVision Deconvolution microscopy with z-stacking (Applied Precision, Issaquah, WA, USA). Four placentae were analyzed at 5e6 weeks of gestation and an additional four placentae at 10e11 weeks.

3. Results 3.1. Human blastocyst outgrowths in TS cell culture conditions We attempted to derive trophoblast stem (TS) cell lines from human IVF blastocysts in TS cell derivation conditions that were optimized for the mouse, in addition to a number of novel culture conditions (Table 1). A total of 68 human blastocysts were cultured in different conditions and only 8 embryos failed to attach. All outgrowths were given qualitative scores 4 days after attachment (Supplementary Table S1). A representative outgrowth of each score is shown in Fig. 1. We found that our qualitative scores were consistent with levels of human chorionic gonadotropin (hCG) in the conditioned medium of a subset of outgrowths (Fig. 1E). Using the qualitative outgrowth scores as a means to compare the different culture conditions, a number of comparisons were made. There were no significant differences in blastocyst outgrowths cultured on mouse or human EMFIs nor between mouse-

Fig. 2. SCF, but not FGF, improved the quality of human blastocyst outgrowths in different culture conditions. No significant differences in blastocyst outgrowth quality were observed between: (A) mouse and human embryonic fibroblasts (EMFIs), (B) mouse and human 70% conditioned medium (70cond), (C) EMFIs or gelatin substrate, or (D) 20% or 5% oxygen culture conditions. (E) FGF2 or FGF4 did not significantly improve outgrowth quality. (F) Conditions supplemented with SCF showed a trend towards improved blastocyst outgrowth. The letters on the X-axis refer to the culture conditions in Table 1. (G) Conditions that included SCF exhibited a significant increase (**p < 0.003, Student's unpaired t-test) in outgrowth quality when compared to conditions without SCF (n ¼ 18 for without SCF, n ¼ 15 for with SCF). (H) Average hCG levels were higher in cultures exposed to SCF, but this was not statistically significant (n ¼ 5 for without SCF, n ¼ 9 for with SCF).

T. Kunath et al. / Placenta 35 (2014) 1079e1088

or human-conditioned medium (Fig. 2A,B). Blastocyst outgrowths on gelatin were also not significantly different from outgrowths on mouse EMFIs (Fig. 2C). All four blastocysts cultured on Matrigel™ attached, but failed to form outgrowths (Supplementary Table S1). Blastocyst outgrowths cultured in low oxygen (5%) were more robust on average, but the number of embryos was too low to reach significance (Fig. 2D). This is in agreement with work showing human cytotrophoblasts undergo less apoptosis in 2% and 5% oxygen [36]. Interestingly, we did not observe a difference in outgrowths cultured in the presence or absence of FGF2 or FGF4 (Fig. 2E). Since SCF has been shown to promote the growth of early cytotrophoblast cells in explants as indicated by increased DNA

1083

synthesis [37], we tested the effect of this ligand in blastocyst outgrowth culture. Blastocysts cultured in the presence of SCF plus FGF4 showed a trend towards more robust outgrowths, and this reached statistical significance when multiple experiments were grouped (Fig. 2F,G). Furthermore, measurement of hCG in the conditioned medium from outgrowths cultured in the presence of SCF showed a trend towards increased hCG production (Fig. 2H). Of the 60 embryos that attached and went through the various derivations protocols, only one (No. 57) give rise to cells that expanded upon passaging. The cells did not have the appearance of mouse TS cells, nor of human ES cells in culture. The identity of the cells could not be unequivocally determined, since they expired after 3 passages. Interestingly, they produced large amounts of hCG in the

Fig. 3. Culture and passage of human blastocyst No. 57. (A) At day 2, blastocyst No. 57 produced a robust outgrowth in FGF4 and SCF on gelatin substrate. Cells from this outgrowth could be passaged 3 times and the culture was maintained for more than 50 days. Scale bar, 20 mm. (B) The level of hCG was substantial at days 17 and 20, but declined dramatically by day 23 and remained low/negative for the remainder of culture.

1084

T. Kunath et al. / Placenta 35 (2014) 1079e1088

early stages of culture, but this production was reduced dramatically after 3 weeks, although the cells remained viable for an additional 2 weeks (Fig. 3). 3.2. CDX2 and FGF receptor expression in human blastocysts and placentae Since we failed to observe an obvious mitogenic response in the presence of FGF2 or FGF4, we wondered whether genes essential for TS cell formation in the mouse blastocyst are expressed in the human blastocyst. First, we examined the expression and cellular distribution of CDX2 protein, known to be essential for early trophoblast specification in the mouse [10]. Results of wholemount immunocytochemistry revealed that CDX2 was expressed in the nucleus of all TE cells of the expanded human blastocyst (Fig. 4A). This is in agreement with mouse embryos [10], and with recent data on human blastocysts [38]. CDX2 was clearly downregulated in the ICM as expected, and z-sections revealed it was expressed in the nucleus of all TE cells (Supplementary Fig. S1). Next, we investigated the expression of FGF receptors in human blastocysts. We analyzed expression of FGFR1e4 in several expanded human blastocysts using RT-PCR. While early first trimester human placenta expressed FGFR1/2 abundantly and FGFR3 at a low level (Fig. 5A), no detectable expression of these receptors was observed in the majority (9/11) of human blastocysts,

while 2/11 blastocysts produced a faint PCR product for FGFR1. FGFR4 was not detected either in human blastocyst or first trimester placenta (data not shown). We also performed immunocytochemistry for FGFR2 and these experiments confirmed results of the RT-PCR analyses. Using an FGFR2-specific antibody, we observed membrane staining of FGFR2 in mouse blastocysts (Fig. 5B), while under the same conditions, human blastocysts did not exhibit any immunoreactivity with this antibody (Fig. 5C). However, all cytotrophoblast cells of both floating and anchoring villi were positive for FGFR2 immunostaining in early (5 week) first trimester placenta (Fig. 6A). The pattern of expression dramatically changed at 10 weeks of gestation, when expression of FGFR2 shifted to the syncytial layer (Fig. 6B). Moreover, consistent with this observation, activated diphosphorylated ERK1/2, known to be downstream of FGFRs and other receptor tyrosine kinases, was observed only in very early placenta (5 weeks), but was not detectable at 10 weeks of gestation (Fig. 6CeE). 4. Discussion Here we have attempted to culture human blastocysts with the aim of deriving human TS cell lines in conditions similar to murine TS cells. We observed no effect of FGF4 or FGF2, which is essential for mouse TS cell derivation, on human blastocyst outgrowth

Fig. 4. CDX2 expression in human blastocysts. (A) The trophectoderm of the late human blastocyst was positive for CDX2, while the ICM (arrow) was negative. Scale bars, 40 mm for upper panels and 20 mm for lower panels. (B) A confocal section of a late human blastocyst showing the ICM and the overlying polar trophectoderm where CDX2 was specifically observed in the TE nuclei (arrowhead) and not in the ICM (arrow). Scale bar, 20 mm.

T. Kunath et al. / Placenta 35 (2014) 1079e1088

1085

Fig. 5. FGFR expression in human blastocysts. (A). RT-PCR on cDNA from three individual human blastocysts, and 6 week placenta for FGFR1, FGFR2, FGFR3, and b-actin. Expression of FGFR1e3 was not detected in these human blastocysts. (B) FGFR2 was strongly expressed at the cell surface in mouse blastocysts as determined by immunofluorescence with an FGFR2-specific antibody. Scale bar, 20 mm. (C) FGFR2 protein was not detected in similarly staged human blastocysts. Scale bar, 20 mm.

quality. Interestingly, SCF improved the quality of blastocyst outgrowths, although it was not sufficient to establish human TS cell lines. The receptor for SCF, c-kit, is expressed at all stages of human preimplantation development [39], and SCF mRNA has been detected in the cytotrophoblast and the intermediate trophoblastic column of early placentae [37]. This suggests that SCF would be a beneficial factor for in vitro culture of human preimplantation embryos and early placental villi. We wondered what could be different between mouse and human blastocysts? We investigated the expression of the lineagespecific transcription factor CDX2 in human blastocysts and found it to be specifically expressed in the nucleus of TE cells and downregulated in the ICM, in agreement with mouse expression data. CDX2 is also expressed in a subset of highly proliferative human cytotrophoblast cells suggesting this transcription factor may be a

reliable marker of the TS cell compartment in human [40]. In contrast, we did not observe FGFR expression in human blastocysts as determined by RT-PCR and immunostaining for FGFR2 (Fig. 5). This is consistent with our observation of FGFs having no effect on outgrowth quality, but is in sharp contrast to the mouse blastocyst where FGFR2 is expressed and plays important functional roles in peri-implantation development [4]. FGFR2 is also expressed in early TE of porcine blastocysts [41]. In the mouse blastocyst, FGF signaling plays essential roles in primitive endoderm specification [42,43], but this mechanism does not appear to be conserved in human, as chemical inhibition of the FGF-ERK pathway does not prevent the emergence of this lineage in cultured human blastocysts [20,44]. Reduced FGFR expression in human blastocysts supports these observations. Interestingly, recent work described detectable expression of FGFR1 protein in the TE of expanded

1086

T. Kunath et al. / Placenta 35 (2014) 1079e1088

Fig. 6. FGF receptor 2 expression and ERK1/2 activity in human placenta. (A) FGFR2 was expressed uniformly in the cytotrophoblast (arrows) of 5-week human placenta, and in a punctate pattern in the syncytiotrophoblast layer (arrowheads). (B) By 10 weeks gestation, FGFR2 expression was down-regulated in cytotrophoblast cells, and strongly expressed in the overlying syncytiotrophoblast layer. Scale bar, 50 mm. (C) Di-phosphorylated (dp) ERK1/2 expression was detected in the cytotrophoblast (ct) layer of 5 week placenta, and (D) in extravillous trophoblast (evt). (E) By 10 weeks of gestation dp-ERK1/2 expression was not observed in either the cytotrophoblast layer or extravillous trophoblast. Scale bar, 25 mm.

human blastocysts [38]. The discrepancy with our lack of FGFR1 mRNA expression may be due to the sensitivity of our RT-PCR. Consistent with this, we did detect faint FGFR1 signals in 2/11 human blastocysts. There may also be considerable variability amongst embryos due to a number of factors, like maturation of blastocysts, ethnic (genetic) background, diagnosis of infertility, and in vitro culture conditions. We used an antibody raised against the extracellular domain of FGFR2, which does not have crossreactivity to FGFR1 [34]. This suggests human blastocysts preferentially express FGFR1 over FGFR2. Indeed, single-cell RNAseq profiling of thirty cells from three expanded human blastocysts revealed that FGFR2 had the lowest transcript counts of the four FGFRs [45]. Although FGFR expression was not detected by RT-PCR in the majority of human blastocysts in our study, we observed robust expression of FGFR2 in the cytotrophoblast and syncytiotrophoblast layers at 5 weeks of human gestation, but this was lost in the cytotrophoblast layer by 10 weeks of gestation (Fig. 6). It was previously reported that expression of FGFR2 in villous cytotrophoblast at 7e8 weeks is down-regulated in second and third trimester placentae [46], suggesting that FGF-dependent expansion of cytotrophoblast may occur only in the first trimester. This is consistent with the view that highly proliferative trophoblast progenitors are most abundant during early gestation [47]. This is also the case for the mouse where FGF-dependent TS cells can be isolated from trophoblast prior to chorio-allantoic fusion, but not later [48]. Furthermore, FGF1 and FGF2 are strongly expressed in the human cytotrophoblast layer in the first trimester, but weakly expressed in villous trophoblast at term [49,50], further supporting the notion that FGF-dependent trophoblast expansion may occur only in early pregnancy. In support of this model, we observed activation of ERK1/2 in the cytotrophoblast layer, but not in syncytiotrophoblast layers at 5 weeks gestation suggesting this is the site of active FGF signaling. At 10 weeks gestation, phospho-ERK1/2 was undetectable, suggesting that putative FGF-dependent expansion of the cytotrophoblast lineage is finished by this point. This, however,

does not exclude expansion of trophoblast cells mediated by other signaling pathways. Since it has been shown that culture conditions with FGF4 alone promote differentiation of primary naïve cytotrophoblast towards extravillous trophoblast cells [46,51], additional factors may be required to maintain this proliferative cell population in culture. Potential candidates are the TGFb/activin family because of their requirement to maintain mouse TS cells through SMAD2/ 3 activation [52]. Expression levels of TGFb receptors and SMAD2/ 3 are highest in first trimester cytotrophoblast layers and are significantly down-regulated in the second and third trimester [53], coincident with the peak of FGF activity during human trophoblast development. Furthermore, TGFb1 treatment of explanted first trimester chorionic villi resulted in a significant increase in proliferation and DNA synthesis of the cytotrophoblast compartment [54]. Activation of the BMP pathway may also be important for derivation of human TS cells, since this is the major signaling molecule used to promote hESC differentiation towards the trophoblast lineage [22,25,55]. The timing of FGF signaling may also be critical, since early inhibition of this pathway is important for hESCs to make trophoblast cells, but continued inhibition leads to terminal differentiation into syncytiotrophoblast [55,56]. Our data suggests TE of human blastocysts may require exposure to a unique combination of signaling molecules or some in vitro maturation before TS cells can be derived. Alternatively, villous cytotrophoblast cells from early (4e8 week) human placenta could be a more accessible source of human TS cells if the factors needed to complement FGF are identified.

Conflict of interest statement We confirm that there are no conflicts of interest associated with this study and there has been no financial support for this work that could have influenced its outcome.

T. Kunath et al. / Placenta 35 (2014) 1079e1088

Acknowledgments We are indebted to the patients who donated their embryos for this study, and to the IVF staff at Toronto General Hospital and Mount Sinai Hospital. This work was funded by a Canadian Institutes of Health Research Doctoral Research Award to TK. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.placenta.2014.09.008. References [1] Corson LB, Yamanaka Y, Lai K-MV, Rossant J. Spatial and temporal patterns of ERK signaling during mouse embryogenesis. Development 2003;130: 4527e37. [2] Kunath T, Strumpf D, Rossant J. Early trophoblast determination and stem cell maintenance in the mouseda review. Placenta 2004;25:S32e8. [3] Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. Requirement of FGF-4 for postimplantation mouse development. Science 1995;267:246e9. [4] Arman E, Haffner-Krausz R, Chen Y, Heath JK, Lonai P. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci U S A 1998;95: 5082e7. [5] Saba-El-Leil MK, Vella FDJ, Vernay B, Voisin L, Chen L, Labrecque N, et al. An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. EMBO Rep 2003;4:964e8. [6] Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998;282:2072e5. [7] Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154e6. [8] Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 1981;78:7634e8. [9] Kunath T, Arnaud D, Uy GD, Okamoto I, Chureau C, Yamanaka Y, et al. Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development 2005;132:1649e61. [10] Strumpf D, Mao C-A, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, et al. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 2005;132:2093e102. [11] Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, et al. Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature 2000;404:95e9. [12] Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;95:379e91. [13] Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643e55. [14] Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631e42. [15] Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell-Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003;17:126e40. [16] Tremblay GB, Kunath T, Bergeron D, Lapointe L, Champigny C, Bader J-A, et al. Diethylstilbestrol regulates trophoblast stem cell differentiation as a ligand of orphan nuclear receptor ERR beta. Genes Dev 2001;15:833e8. [17] Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145e7. [18] Humphrey RK, Beattie GM, Lopez AD, Bucay N, King CC, Firpo MT, et al. Maintenance of pluripotency in human embryonic stem cells is STAT3 independent. Stem Cells 2004;22:522e30. [19] Cauffman G, Van de Velde H, Liebaers I, Van Steirteghem A. Oct-4 mRNA and protein expression during human preimplantation development. Mol Hum Reprod 2005;11:173e81. [20] Roode M, Blair K, Snell P, Elder K, Marchant S, Smith A, et al. Human hypoblast formation is not dependent on FGF signalling. Dev Biol 2012;361:358e63. [21] Hyslop L, Stojkovic M, Armstrong L, Walter T, Stojkovic P, Przyborski S, et al. Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages. Stem Cells 2005;23:1035e43. [22] Xu R-H, Chen X, Li DS, Li R, Addicks GC, Glennon C, et al. BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat Biotechnol 2002;20: 1261e4. [23] Das P, Ezashi T, Schulz LC, Westfall SD, Livingston KA, Roberts RM. Effects of fgf2 and oxygen in the bmp4-driven differentiation of trophoblast from human embryonic stem cells. Stem Cell Res 2007;1:61e74.

1087

[24] Roberts RM, Loh KM, Amita M, Bernardo AS, Adachi K, Alexenko AP, et al. Differentiation of trophoblast cells from human embryonic stem cells: to be or not to be? Reproduction 2014;147:D1e12. [25] Li Y, Moretto-Zita M, Soncin F, Wakeland A, Wolfe L, Leon-Garcia S, et al. BMP4-directed trophoblast differentiation of human embryonic stem cells is mediated through a Np63þ cytotrophoblast stem cell state. Development 2013;140:3965e76. [26] Harun R, Ruban L, Matin M, Draper J, Jenkins NM, Liew GC, et al. Cytotrophoblast stem cell lines derived from human embryonic stem cells and their capacity to mimic invasive implantation events. Hum Reprod 2006;21: 1349e58. [27] Genbacev O, Donne M, Kapidzic M, Gormley M, Lamb J, Gilmore J, et al. Establishment of human trophoblast progenitor cell lines from the chorion. Stem Cells 2011;29:1427e36. [28] Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss III JF. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 1986;118:1567e82. [29] Morrish DW, Dakour J, Li H, Xiao J, Miller R, Sherburne R, et al. In vitro cultured human term cytotrophoblast: a model for normal primary epithelial cells demonstrating a spontaneous differentiation programme that requires EGF for extensive development of syncytium. Placenta 1997;18: 577e85. [30] Giuffrida D, Rogers IM, Nagy A, Calogero AE, Brown TJ, Casper RF. Human embryonic stem cells secrete soluble factors that inhibit cancer cell growth. Cell Prolif 2009;42:788e98. [31] Himeno E, Tanaka S, Kunath T. Isolation and manipulation of mouse trophoblast stem cells. Curr Protoc Stem Cell Biol 2008;(Suppl. 7). Unit 1E.4. [32] Jurisicova A, Antenos M, Kapasi K, Meriano J, Casper RF. Variability in the expression of trophectodermal markers beta-human chorionic gonadotrophin, human leukocyte antigen-G and pregnancy specific beta-1 glycoprotein by the human blastocyst. Hum Reprod 1999;14:1852e8. [33] Twigg SR, Burns HD, Oldridge M, Heath JK, Wilkie AO. Conserved use of a noncanonical 50 splice site (/GA) in alternative splicing by fibroblast growth factor receptors 1, 2 and 3. Hum Mol Genet 1998;7:685e91. [34] Haffner-Krausz R, Gorivodsky M, Chen Y, Lonai P. Expression of Fgfr2 in the early mouse embryo indicates its involvement in preimplantation development. Mech Dev 1999;85:167e72. [35] MacPhee DJ, Mostachfi H, Han R, Lye SJ, Post M, Caniggia I. Focal adhesion kinase is a key mediator of human trophoblast development. Lab Invest 2001;81:1469e83. [36] Kilani RT, Mackova M, Davidge ST, Guilbert LJ. Effect of oxygen levels in villous trophoblast apoptosis. Placenta 2003;24:826e34. [37] Saito S, Enomoto M, Sakakura S, Ishii Y, Sudo T, Ichijo M. Localization of stem cell factor (SCF) and c-kit mRNA in human placental tissue and biological effects of SCF on DNA synthesis in primary cultured cytotrophoblasts. Biochem Biophys Res Commun 1994;205:1762e9. [38] Niakan KK, Eggan K. Analysis of human embryos from zygote to blastocyst reveals distinct gene expression patterns relative to the mouse. Dev Biol 2013;375:54e64. [39] Sharkey AM, Dellow K, Blayney M, Macnamee M, Charnock-Jones S, Smith SK. Stage-specific expression of cytokine and receptor messenger ribonucleic acids in human preimplantation embryos. Biol Reprod 1995;53:974e81. [40] Hemberger M, Udayashankar R, Tesar P, Moore H, Burton GJ. ELF5-enforced transcriptional networks define an epigenetically regulated trophoblast stem cell compartment in the human placenta. Hum Mol Genet 2010;19: 2456e67. [41] Fujii T, Sakurai N, Osaki T, Iwagami G, Hirayama H, Minamihashi A, et al. Changes in the expression patterns of the genes involved in the segregation and function of inner cell mass and trophectoderm lineages during porcine preimplantation development. J Reprod Dev 2013;59:151e8. [42] Chazaud C, Yamanaka Y, Pawson T, Rossant J. Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Dev Cell 2006;10:615e24. [43] Yamanaka Y, Lanner F, Rossant J. FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development 2010;137: 715e24. [44] Kuijk EW, van Tol LTA, Van de Velde H, Wubbolts R, Welling M, Geijsen N, et al. The roles of FGF and MAP kinase signaling in the segregation of the epiblast and hypoblast cell lineages in bovine and human embryos. Development 2012;139:871e82. [45] Yan L, Yang M, Guo H, Yang L, Wu J, Li R, et al. Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat Struct Mol Biol 2013;20:1131e9. [46] Baczyk D, Dunk C, Huppertz B, Maxwell C, Reister F, Giannoulias D, et al. Bipotential behaviour of cytotrophoblasts in first trimester chorionic villi. Placenta 2006;27:367e74. [47] Genbacev O, Lamb J, Prakobphol A, Donne M, McMaster M, Fisher S. Human trophoblast progenitors: where do they reside? Semin Reprod Med 2013;31: 056e61. [48] Uy GD, Downs KM, Gardner RL. Inhibition of trophoblast stem cell potential in chorionic ectoderm coincides with occlusion of the ectoplacental cavity in the mouse. Development 2002;129:3913e24. [49] Shams M, Ahmed A. Localization of mRNA for basic fibroblast growth factor in human placenta. Growth Factors 1994;11:105e11.

1088

T. Kunath et al. / Placenta 35 (2014) 1079e1088

[50] Ferriani RA, Ahmed A, Sharkey A, Smith SK. Colocalization of acidic and basic fibroblast growth factor (FGF) in human placenta and the cellular effects of bFGF in trophoblast cell line JEG-3. Growth Factors 1994;10:259e68. [51] Anteby EY, Greenfield C, Natanson-Yaorn S, Goldman-Wohl D, Hamani Y, Khudyak V, et al. Vascular endothelial growth factor, epidermal growth factor and fibroblast growth factor-4 and -10 stimulate trophoblast plasminogen activator system and metalloproteinase-9. Mol Hum Reprod 2004;10:229e35. [52] Erlebacher A, Price KA, Glimcher LH. Maintenance of mouse trophoblast stem cell proliferation by TGF-beta/activin. Dev Biol 2004;275:158e69. [53] Xuan YH, Choi YL, Shin YK, Ahn GH, Kim KH, Kim WJ, et al. Expression of TGFbeta signaling proteins in normal placenta and gestational trophoblastic disease. Histol Histopathol 2007;22:227e34.

[54] Forbes K, Souquet B, Garside R, Aplin JD, Westwood M. Transforming growth factor-b (TGFb) receptors I/II differentially regulate TGFb1 and IGF-binding protein-3 mitogenic effects in the human placenta. Endocrinology 2010;151:1723e31. [55] Yu P, Pan G, Yu J, Thomson JA. FGF2 sustains NANOG and switches the outcome of BMP4-induced human embryonic stem cell differentiation. Cell Stem Cell 2011;8:326e34. [56] Sudheer S, Bhushan R, Fauler B, Lehrach H, Adjaye J. FGF inhibition directs bmp4-mediated differentiation of human embryonic stem cells to syncytiotrophoblast. Stem Cells Dev 2012;21:2987e3000.