Developmental Regulation of Nuclear Gene Expression in Trypanosoma brucei CHRISTINE CLAYTON Zentrum fur Molekulare Biologie I m Neuenheimer Feld 282 D-6900 Heidelberg, Germany I. Trypanosome Developmental Biology . . 11. Regulation of Housekeeping Gene Expre 111. Transcription of Surface Protein Genes ......................... A. The “VSG Polymerase” ............. .... B. The VSG Gene Transcription Unit .......................... C. The PARP Genes .......................................... D. Transcription of the PARP Genes ..... ... E. Detailed Promoter Analysis. . ..... ... F. Is Transcription Initiation Re ................... G. A Peculiarity: The Effect of UV Irradiation on Trypanosome mRNA .................................................... IV. Kinetic Analysis of the Differentiation Process ......... ..................................... V. Future Prospects References. ...................................................

38 41 46 46 47 49 51 51 55 56 57 61 62

The African trypanosomes are flagellated protozoan parasites of the blood and tissue fluid of mammals, causing significant veterinary and medical problems in 36 countries of sub-Saharan Africa. About 50 million people are at risk for infection by the human parasites Trypanosoma brucei rhodesiense and Trypanosoma gambiense, approximately 25,000 cases occurring per year. The disease is difficult to diagnose and treat, and is almost always fatal unless treated ( I ) . African trypanosomes are members of the Kinetoplastida, an order that also includes Trypanosoma cruzi and Leishmania, both major causes of tropical disease. Each of these pathogenic kinetoplastids is transmitted from one mammalian host to the next by biting insects: In the case of African trypanosomes, by tsetse flies. The kinetoplastids branched very early in eukaryotic evolution (2, 3) and exhibit several remarkable aspects of biochemistry and molecular biology. For example, post-transcriptional editing of mitochondria1 mRNAs ( 4 )and trans splicing of nuclear transcripts (5)were first discovered in this group of organisms. In addition to increasing our appreciation of the range of options available in eukaryotic biochemistry, 37 Progress in Nucleic Acid Research and Molecular Biology, V d . 43

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

38

CHRISTINE CLAYTON

each discovery of a difference between trypanosomes and their hosts gives hope for the development of new types of drugs. African trypanosomes grow in two rather different environmentsthe mammalian extracellular fluids and the alimentary system of the tsetse fly. Survival in the mammal depends on an ability to evade the host immune response; the different conditions in the fly necessitate numerous metabolic adapations. How does the trypanosome achieve the requisite changes in gene expression? This review describes what is known about the development regulation of nuclear gene expression in T . brucei brucei, a close relative of T . b. rhodesiense that is a favorite model organism because it infects cattle and other animals, but not humans. Particular emphasis is given to transcription of the genes encoding the major surface proteins, as these have been studied in the most detail both here and in other laboratories. Some important examples from other kinetoplastids, particularly Leishmania species, are also mentioned. Control of mitochodrial transcripts through editing is important, but has been covered elsewhere. ( e g ,4 ) .

1. Trypanosome Developmental Biology A. Biochemistry When trypanosomes are taken up by a tsetse fly, the temperature of their environment decreases by about l O T , and amino acids replace glucose as the major nutrient source. The trypanosomes undergo many compensatory morphological and biochemical changes during differentiation from the “bloodstream form” found in the mammal to the “procyclic form” that divides in the tsetse midgut. One of the most important changes is in energy metabolism. Trypanosomes in the bloodstream depend entirely on substrate-level phosphorylation, having a rudimentary mitochondrion and very active glycolysis. The procyclic forms, in contrast, have slower glycolysis, an elaborate mitochondrion, and oxidative phoshorylation (6,6a).

B. Surface Coat Changes While in the mammalian host, African trypanosomes evade the humoral immune response by antigenic variation (7).On the surface of every trypanosome is a uniform cost of glycoprotein (the variant surface glycoprotein, or VSG) 50-65 kDa. Normally, all the VSG molecules on a given trypanosome are identical in primary amino-acid sequence. There are up to 1000 different VSG genes in each trypanosome, but usually only one is expressed at a time. At a rate of about

GENE EXPRESSION IN

Trypanosoma brucei

39

X lop6 cells per generation, the gene encoding the current VSG gene is turned off and another is activated. This process, which does not require specific induction, can occur by genetic rearrangement (e.g., teloniere exchange, recombination, or gene conversion) or by transcriptional control. This process has been very well reviewed elsewhere (7,8), so it is not covered in detail here. When bloodstream trypanosomes enter the tsetse fly (or culture at 27”C), the VSG coat is rapidly shed and replaced by the procyclic acidic repetitive protein (PARP, or procyclin) (9,lO). While the function of the VSG is clear, that of PARP is unknown. The PARP sequence predicts a polypeptide of around 15,000molecular weight with a signal sequence, a hydrophilic N terminus, a central region of around 15-22 (Glu-Pro) repeats, and a hydrophobic C terminus (see Fig. 3a in Section 111,C).After post-translational processing, which involves cleavage of the signal sequence and replacement of the C terminus by a glycosyl-phosphatidylinositol anchor, very little but the repeat and a short hydrophilic N terminus remains (11). The procyclic forms undergo about 2 weeks of growth in the tsetse midgut before migrating to the salivary glands, where they re-express VSG and become infective “metacyclic forms”(7).

4

C. The Short Stumpy Form In a normal bloodstream trypanosonie infection in the wild, the trypanosome population includes rapidly dividing long slender forms, nondividing stumpy-looking forms, and intermediate forms somewhere between the two. In general, “pleomorphic” trypanosome isolates grow rather slowly in laboratory rodents, but infect tsetse flies readily. After prolonged serial passage in laboratory rodents, with continuous selection for the most rapidly dividing cells, the parasites become “monomorphic.” The ability to form the intermediate and stumpy forms is reduced or eliminated, and the parasites have a greatly reduced ability to infect tsetse flies (see references in 12,13 and 13a). When irradiated mice or rats are infected with a pleomorphic trypanosome strain, the parasite population is initially almost 100%long and slender, but cell division gradually stops and by 6-8 days after infection stumpy forms predominate (12, 13a). A closely analogous process occurs when bloodstream forms cultured in vitro are left at cell densities above lo6 per milliliter (which is one-hundredth the level of the parasitemias seen in rodents infected with pleomorphic trypanosome strains). The change is irreversible and has nothing to do with either depletion of nutrients or accumulation of metabolic end products (at least, those that have been assayed) (13). If the trypano-

40

CHRISTINE CLAYTON

somes are somehow communicating with one another, it is unlikely to be through soluble mediators, as medium changes have no effect. The transition to stumpy forms can also be mimicked by culture of bloodstream trypansomes with Dt-a-difluoromethylornithine (DFMO), an inhibitor of polyamine biosynthesis (14). The intermediate and stumpy forms retain the VSG coat, but biochemically the stumpy forms appear to have some of the characteristics of procyclic forms: For example, the mitochondria have some citratecycle enzyme activities (15) and increased abundance of some mitochondrial transcripts (13a, 16), and may even be able to produce ATP (17 ) . Nondividing forms transform more synchronously than do dividing forms (18).The morphological change could therefore be an intermediate stage in the transition between long slender bloodstream trypomastigotes and the procyclic form. This idea of pre-adaptation is supported b y reports that initiation of cultures with stumpy-form trypanosomes enhances the ability to differentiate (13a, 14), although these results were directly contradicted in another study by Bass and Wang (12),who reported that unless the cells had been cultured so long with DFMO that they could no longer survive, each of the morphological forms behaved similarly when transferred to optimal in uitro conditions for procyclic differentiation; short stumpy forms did not have increased levels of CAMP or decreased levels of ornithine decarboxylase, and (contrary to previous reports) DFMO, putrescine, dibuQry1 CAMP, and theophylline all had no effect on the differentiation process (12). It is very difficult to reconcile these conflicting reports, which in some cases describe contradictory results with the same parasite strain. Bass and Wang (112) could have missed short stumpy forms that can appear transiently after a few hours in culture (E. Wirtz, personal communication), and the media and conditions used are different in every laboratory. Even if differentiation to nondividing short stumpy forins is not required for procyclic transformation, it could have another biological role. hfonomorphic trypanosome strains typically kill susceptible laboratory rodents before the host has any chance to mount an immune response. Much slower growth, achieved by a longer division time, programmed transition to the stationary phase (as with the stumpyform development), or a combination of the two, would predispose to the sort of chronic infections actually observed in the field, and consequently to a prolonged opportunity for tsetse transmission-essential for parasite survival.

GENE EXPRESSION IN

Trypanosoma brucei

41

D. Requirementsfor Differentiation in vifro The transformation of bloodstream forms to procyclic forms has been extensively studied by transferring trypanosomes grown in animals to in uitro culture at 27°C. The temperature change is absolutely required for the transformation process. The addition of citrate and cis-aconitate stimulates transformation of monomorphic strains (most recently quantitated in 12) that normally transform poorly (see, e.g., 19), but is superfluous for plemorphic strains. The addition of these two intermediates alone induces an abortive transformation, with afew ofthe changes seen in full transformation (see Section IV,A).

II. Regulation of Housekeeping Gene Expression

A. Genetics Both the parasites in the bloodstream and those in the insect gut (procyclic forms) are approximately diploid (20)and multiply by binary fission, but at some stage during replication in the insect, sexual reproduction can occur (21).Trypanosome chromosomes cannot be condensed for normal karyotyping, but can be separated by pulse-field gel electrophoresis. Chromosomes vary from the megabase range to minichromosomes with sizes of 50-150 kb; although the karyotype is somewhat variable, homologous chromosomes can be identified by hybridization (22). The genetics of the Trypanosomatidae is in its infancy. Their requirement for complex media has prevented the development of auxotrophic mutants. Most attention has focused on Leishmania species, which can grow as clonal colonies on agar plates. Attempts to derive drug-resistant mutants have yielded either Leishmania that have amplified the gene encoding the target protein (23),or transport mutants (24).DNA transfection was only recentIy developed for the Trypanosomatidae (25-28). Selection of permanent transformants is possible using dominant selectable markers. In Leishmania, the selected plasmid can replicate as an extrachromosomal circle (see, e.g., 29 and 30), although integration is possible (31),whereas T . brucei is most readily transformed by linearized plasmids, which invariably integrate into the genome by homologous recombination (32-34). It should therefore be possible to create mutant trypanosomes by targeted gene disruption.

42

CHRISTINE CLAYTON

B. Gene Organization and RNA Processing Like most other eukaryotic mRNAs, trypanosome mRNAs are polyadenylated at the 3‘ end. However, they are also modified by a “ trans-splicing reaction that places a capped 39-nucleotide miniexon” sequence at the 5’ end (5).N cis splicing has been found. In crude (Stanstead cell disruptor) nuclear preparations, 3’ cleavage for polyadenylation occurs rapidly after transcription, preventing accumulation of precursors (35).Subsequent exonucleolytic trimming probably reduces apparent transcription rates (as measured in run-ons) in regions just downstream from the cleavage site. Since truns splicing has not been detected in these cell disruptor preparations (35),it i s not possible to say which processing event occurs first in vitio. However, it seems probable that cotranscriptional processing is responsible for the very low abundance of mRNA precursors. More information will probably emerge from study of trans-splicing-competent permeabilized cells (36,377. Of the trypanosome genes cloned so far, a surprising number are arranged as direct tandem repeats of two or more identical copies. Examples include the genes encoding calmodulin (38),hsp-70 (39), and glyceraldehyde-phosphate dehydrogenase (40).In other cases, such as a- and P-tubulin (41) and the phosphoglycerate kinases (42), related genes are grouped together. In the aldolase locus, unrelated genes are interspersed in the repeat (43).The trypanosome genome is only about 10 times the size of the Escherichia coli genome, so perhaps it is not surprising that the distance between the polyadenylation site of one gene and the splice acceptor of the next can be as short as 110 bp (42).

C. Evidence for Polycistronic Transcription Evidence to date indicates that most trypanosomatid mRNAs are made by post-transcriptional processing of polycistronic precursors. So far there is no evidence for the regulation of transcriptional initiation by RNA polymerase 11. For example, trypanosomes have three phosphoglycerate kinase genes. The farthest upstream (“A”) is related to phosphoglycerate kinase, but contains an internal insertion; its transcript is present at a low level throughout the life cycle. The transcript from the central “B” gene predominates in procyclic forms, and that from the downstream “C” gene is abundant in bloodstream forms (Fig. 1). Analyses of transcription rates in crude nuclear preparations show constant rates of transcription across all three genes, regardless of life-cycle stage, and large putative precursor RNAs containing interge-

GENE EXPRESSION IN

Trypanosoma brucei

+ +

Procyclic Bloodstream

U Procyclic Bloodstream

+ +

+i

+/-

43

+

+++

Aldolase

I

Aldolase

1

+

+

+ +++

+ +

+++

i

FIG. 1. Maps of the phosphoglycerate kinase genes (A, B, and C) (42) and the aldolase locus (43). Genes of unknown function are indicated upstream (U) and downstream (I) from the aldolase genes. Amounts of mRNA are shown beneath the genes.

nic sequences can be detected by blot hybridization and S 1-nuclease analysis (42).Fructose-biophosphate aldolase, and the corresponding mRNA, is six to 10 times more abundant in bloodstream forms (where it is required for rapid glycolysis) than in procyclic forms (44).The aldolase genes are interspersed with genes showing no development regulation (Fig. 1);transcription is constant across the whole locus, including the intergenic regions (43).Tschudi and Ullu (45)demonstrated convincingly by nuclease protection, the existence of polycistronic mRNA precursors from the calmodulin locus. Other examples include actin (46)and the tandem a-p-tubulin repeat (41). Because of polycistronic transcription and trans splicing, trypanosomatid RNA-polymerase-I1 promoters are very elusive. “Promotertrap” transfection experiments are compromised by the fact that a low level of expression of a transfected gene is possible in the absence of a bona fide promoter: the only absolute requirement for expression appears to be a trans-splicing acceptor site (26, 28). Some workers actually question the existence of specific promoters. Transfection experiments with Leishmania (47) demonstrated efficient expression of the neomycin phosphotransferase gene from a construct containing only 2.6 of leishmania1 DNA. This 2.6-kb sequence ought to contain the Leishmania dihydrofolate reductase gene promoter. The promoter for actin gene transcription has been localized by UV mapping (E. Pays, personal communication).

44

CHRISTINE CLAYTON

D. The Effect of Heat Shock Heat shock is clearly important in Trypanosoma brucei and the other insect-transmitted trypanosomatids. Not only do the parasites experience a temperature change of 10°C when transferred between insect vector and mammal; they must also, especially in the case of the African trypanosomes, survive the fever that they cause. The genes encoding the 70-kDa heat-shock protein (hsp-70) genes from T . brucei (48) and Leishmania major (50)and the hsp 83-90 from T . cruzi (49) have been cloned. L. major grows as intracellular “amastigotes” in the mammalian host, and as “promastigotes” in its sandfly vector; it shows induction of several proteins upon heat shock (e.g., 51).The T . cruzi hsp 83 does not show developmental regulation. In both L. major (50) and T . brucei (48, 51a), the level of hsp-70 rnRNA is higher at 37°C (amastigotes, or bloodstream forms) than at 27°C (promastigotes, or procyclic forms); this is true even in Leishmania incapable of full differentiation (50). Shifting of T . brucei to 42°C results in further induction of hsp-70 mRNA. As in higher eukaryotic cells (52),such a heat shock appears to disrupt splicing (here, trans splicing) of mRNAs, apart from those encoding the hsp 70, causing accumulation of abnormally large transcripts (53-55). It has not been possible to demonstrate that these RNA species really are precursors; possibly, they are exported to the cytoplasm and so are no longer available for processing (56). The T . cruxi, T . brucei, and L. major hsp genes are all arranged as multiple tandem repeats (48-50). The T . brucei and L. major repeats both include one member whose mRNA is not developmentally regulated. Upstream from the regulated genes of these organisms, and also of the T . crud genes, occur sequences that could be heat-shock promoters, as they bear some resemblance to the heat-shock response elements of higher eukaryotes (57), although the homology is not good (39, 51a). The T. brucei hsp-70 intergenic region is reported to have promoter function in a transfection assay, and the genes are transcribed by RNA polymerase I1 (35).However, there is compelling evidence for polycistronic transcription of the T . brucei hsp-70 repeat (39),attempts to detect a primary transcript initiating at the proposed promoters have failed (354, and published evidence for regulation of transcription is conspicuously absent. It is therefore probable that control of hsp-70 mRKA levels is post-transcriptional.

E. Mechanisms of Post-transcriptional Regulation Since no regulation of transcription by RNA polymerase I1 has been reported, something else presumably controls transcript abundance.

GENE EXPRESSION IN

Trypanosomn brucei

45

Such control could be at the level of polyadenylation, RNA turnover, transport from the nucleus, or trans splicing. For each of these, abundant examples are found in other eukaryotes, including protozoa (58-61). The necessary information must reside in the primary transcript, so it should be possible to identify the sequences responsible in transfection experiments. RNA turnover is definitely affected during the switch from bloodstream to procyclic forms (see Section IV,A). Is this mediated through 3'-end sequences (58)?We have observed that a construct bearing the p a r p 3'-untranslated region and polyadenylation site as expressed about three times better than one lacking it (62),and Jefferies et al. (63) could only detect CAT expression in bloodstream trypanosomes if a VSG gene 3' end was present. Conversely, in our preliminary experiments, exchanging the 3' untranslated region of PARP for that of an actin gene (no regulation of mRNA levels) or aldolase (marked down-regulation in procyclics; see Section I1,C) had very little effect on the level of luciferase expression from a transfected reporter construct. Transfection experiments should soon reveal the sequences required for polyadenylation. [Once again, no homology to polyadenylation signals (64) is present.] If the 3' end turns out to be important, future work may also implicate specific sequences in stageregulated polyadenylation, stability, or degradation, and lead further to the mechanisms involved. Transfection is also beginning to yield evidence for the developmental regulation of trans splicing. In procyclic forms, CAT was expressed about 20 times better in a construct bearing a PARP spliceacceptor site than in one with the corresponding VSG sequence (65), although this has not been proved to be a splicing effect. Polypyrimidine tracts are very common upstream from trypanosome trunssplicing acceptor sites. Not unexpectedly, alterations in the p a r p splice-acceptor sequence, particularly in the poly(dT) regions, can have drastic effects on the efficiency of trans splicing and the level of mature mRNA (93a).If control of trans splicing is important, the situation in the nucleus will, in a sense, mirror that in the mitochondrion, as control of levels of functional transcripts from the mitochondria1 genome (outside the scope of this article) is also at least partially mediated by modulations of RNA edititing, rather than of transcription ( 4 ) . In several cases, the regulation of mRNA abundance is insufficient to account for the differences in protein levels or activity observed, implicating translational or post-translational control points (44). So far, the most extreme example is the finding (66) of only 5-fold more cytochrome-c mRNA in procyclic trypanosomes than in bloodstream

46

CHRISTINE CLAYTON

forms, although there is 100-fold more cytochrome-c protein. The explanation could be that the protein is unstable in blood forms because it has nowhere to go (the mitochondrion is rudimentary).

111. Transcription of Surface Protein Genes Interest in the phenomenon of antigenic variation has led to intensive study of VSG gene structure and expression. VSG mRNA comprises 10%of the total bloodstream poly(A)+RNA and is undetectable in procyclics; about 3% of procyclic mRNA encodes PARP, with a barely detectable level in bloodstream forms ( 6 6 4 66b). As the PARP mRNA is less than half as long as that encoding \ISG, the molar mRNA levels are approximately equivalent [so are the numbers of PARP and VSG protein molecules ( l l ) ]Transcription . of the PARP genes is easier to analyze because the procyclic parasites are easier to grow in vitro and the transcription unit is shorter (see Section 111,D). The two proteins have in common their surface location (anchored by a glycolipid anchor) (67) and the fact that they appear to be transcribed by RNA polymerase I (see Section 111,A). Their genes may, in fact, be the only ones in trypanosomes to be subect to transcriptional reguht’ion.

A. The “VSG Polymerase” Both the VSG expression sites (68)and the PARP genes (69,70)are transcribed b y an a-amanitin-resistant RNA polymerase. Teloineric sequences are also transcribed in an a-amanitin-resistant fashion; the significance of this transcription is unknown (72),but is is probably not restricted to sequences downstream from the VSG and PARP genes. For several years, the nature of this “VSG polymerase” was controversial (8,71),but the weight of evidence is now definitely in favor of RNA polymerase I ( 7 2 ~ RNA ) . polymerase I is capable of producing mRNA in trypanosomes (72a),presumably because capping function is provided by trans splicing (74). African trypanosomes have two genes for the largest RNA-polymerase-I1 subunit, but the three or four amino-acid differences between them are not conserved in different trypanosome strains (75,76) and are not in the region normally associated with a-amanitin resistance. In addition, during protein purifications, only three RNA polymerases, identifiable as RNA polymerases I, 11, and 111, have been separated so far (71).(Criteria used were a-amanitin sensitivity, activity in the presence of magnesium and manganese, and effect of template denaturation.) Because VSG transcription in run-on reactions

GENE EXPRESSION IN

47

Trypanosoma brucei

exhibited a divalent cation dependance almost identical so that of other protein-coding genes, it was suggested (71) that the so-called VSG polymerase is actually RNA polymerase I1 with an associated factor that confers a-amanitin resistance. However, transcription from the PARP promoter occurs in the nucleolus, tipping the balance in favor of RNA polymerase I ( 7 2 ~ )Possibly, . the difference in cation dependence could be explained as a consequence of the difference in promoter sequence (see below) or use of stage-specific transcription factors. The selective inhibition of PARP and VSG transcription by cold shock (28,68)remains unexplained. So far, only the genes encoding the largest trypanosome RNApolymerase subunits have been investigated; other eukaryotic and prokaryotic polymerases can have five to 10 subunits (77, 78).

B. The VSG Gene Transcription Unit The VSG is transcribed from a single gene located at a telomeric “expression site” (Fig. 2). There are probably around 20 expression sites (only one usually being active at a time) and maybe 1,000 silent “basic-copy” VSG genes at other positions in the genome, some in tandem arrays (7). Measurement of transcription in trypanosome nuclear preparations, combined with UV-inactivation analysis, gave results indicating that the active VSG gene is at the end of a polycistronic 40 to 60-kb transcription unit (Fig. 2) (79), and provided the first evidence for a-amanitin-resistant transcription (68).

1. EXPRESSION SITE-ASSOCIATED GENES Upstream from the VSG gene are at least eight “expression siteassociated genes” (ESAGS), some of whose mRNAs are several orders of magnitude less abundant than those encoding the VSGs. The map in

p ----+

B

TR R

4

AC

LR LR

MP

10 kb

-

VSG

.......................................................... +

FIG. 2. Map of the VSG AnTat 1.3 A expression site, with added information from several other sites of similar structure. Transcription in bloodstream (B) and procyclic (P) trypanosomes is indicated by broken lines; the promoter, by a solid arrow. ESAG numbers are above the genes, and possible functional assignments are below. TR, Transferrin receptor; R, Rime transposable element; AC, adenylate cyclase; LR, leucine repeat protein; MP, membrane protein. Details and references are in the text.

48

CHRIST1

YTON

Fig. 2 i s of the AnTat 1.3A expression site (81, 84, 87). Others show similar features (81u, 83).l ESAG 1 appears to code for a membrane an adenylate cyclase-like protein (82).In protein (80);ESAG 4 enc sites, there is a VSG pseudogene downsome T. brucei-427 exp stream from it (e.g., 88). Yeast complementation and show the products of both ESAG 4 and the related brane forms of a below) encode distinct omes, not proc Only bloodstream try transferrin receptor; it is probably encoded by ESAC 6 (82).ESAGs X 427 expression sites share homology with ESAGs 6 ene (ESAG 8) downstream from the adenylate cyclase has the capacity to encode a protein with leucine repeats, a putative zinc finger, and a basic region (83,84);this gene is duplicated (S. Lips and E. Pays, personal communication). The position of all these genes in the expression site could be chance, or could have a selective advantage. For example, procyclics probably do not need a transferrin receptor, and both the leucine repeat protein and the adenylate cyclase could have some regulatory role. Genes homologous to some of the ESAGs, transcribed by RNA polymerase 11, are present elsewhere in the genome (85,85a, 86). 2. THEVSG PROMOTER(S) Promoters for several VSG expression sites have been ident The promoter for VSG 221 (in variant 2214 is 60 kb upstream fro VSG 221 gene. A single promoter is present and the sequences required for activity in a transfection assay are within 100 bp of the transcription start site (65).There is very little homology to either the rRNA promoter or the PARP promoter (see below). The promoter for VSG AnTat 1.3 was similarly identified by transcription assays, UV Note on trypanosome strain nomenclature: Trypanosome “strains” are populations originally isolated from a particular animal, then propagated in the laboratory. They are usually designated by a prefix denoting the institute in which they were first chaiacterized (e.g., LUMP, TREU, An, MI, and EATRO), complicated by the fact that a rationalized nomenclat not attained universal use. Cloned populations of de with an additional number after a period. For example, AnTat 1.3 (An, Antwerp, T, trypanozoon; at, antigenic type) is a cloned population derived after antigenic variation in a mouse infected with cloned population AnTat 1.1.Ifthe same antigenic type appears independently more than once, additional letters are added (e.g., AnTat M A , AnTat 1.3B). Strain MIT 1 (Molteno Institute trppanozoon 1) is commonly known by older nomenclature, “427.” Strain 427, type 117 is MITat 1.4;type 221 is ltlITat 1.2. CRESAG = genes related to ESAGs (expression site-associated genes). [Eds.]

GENE EXPRESSION IN

Trypanosoma brucei

49

mapping, and transfection (63).The minimal elements of the VSG 221 promoter are confined to the region between -60 and +77 ( J . Zomerdijk, R. Kieft, P. Shiels and P. Borst, personal communication). Gottesdiener et al. ( l l l a ) cloned several more VSG expression site promoters, all in similar positions relative to the ESAGs and with almost identical sequences, suggesting strong functional selection. This promoter homology makes it impossible to tell which promoter(s) is active in a given trypanosome population (IIf a). Results of mutational analyses are not yet available. Intriguingly, three of the expression sites isolated by Gottesdiener et al. ( I l l a ) had an additional promoter farther upstream from the expected site; this promoter was absent in two reactivated versions of the same expression site. The same observation was made by Zomerdijk et al. (86a), who also saw rearrangements in a region of 50-bp repeats upstream from the downstream promoter. The significance of the additional promoter, and of the upstream rearrangements, in the control of VSG expression is unknown, as both upstream and downstream promoters are functional, but it was speculated that promoter rearrangement can-at least sometimes-have some role in antigenic variation. There is some evidence for gaps in transcription within the VSG expression site, either just upstream from ESAG 3 (87)or downstream from ESAG 1 (88).There have been hypothesized to represent “polymerase re-entry sites,” or “subsiduary internal promoters,” as their activity is dependent on the upstream promoter (89). One of them has some homology to the T. brucei polymerase-I promoter (but none to the main promoter farther upstream) (88)and functions in a transfection assay (cited in f l l a ) .

C. The PARP Genes The map of the PARP genes is shown in Fig. 3. In the 427 (or MITat 1) strain of T . brucei, two unlinked loci (A and B) each contain two

PARP genes (upstream, a ; downstream, p) arranged in a direct repeat ( 6 6 ~ )[Koenig . et al. (70) designated the A locus “pro C.”] The 3‘untranslated regions of the a and genes differ substantially and the number of Glu-Pro repeats varies between the genes and between strains (70,91). The A-a gene contains a Gly-Pro-Glu-Glu-Thr repeat instead of Glu-Pro; this enables its transcripts to be identified unambiguously. The A-a mRNA shows similar regulation to the other PARP mRNAs: The combination of this result and the availability of cDNAs proved unambiguously that both PARP loci are expressed in a differentially regulated fashion, although not necessarily in the same

50

CHRISTINE CLAYTON

5‘-untranslated

hydrouhilic

3’-untranslated

a N-terminal signal

(EP)or (GPEET)repeats

5 kb

b

MAW

FIG. 3. PARP gene organization. (a) Structure of the mature m R S A [excluding poly(A) and mini-exon]. The length varies, but is around 0.9 kb. (b) The PARP loci.

Aiternate designations for the loci are shown in parentheses. For details, see the text.

organism (92). This result was confirmed by Koenig et aE. (70), who hybridized specific oligonucleotide probes to Northern blots. The two different loci were readily distinguished by their lack of homology upstream and downstream from the tandem repeats. The restriction maps diverge less than 1 kb downstream from the @ genes. At this point, the A locus has a gene (GRESAG 2) with homology to ESAG 2 (93). The two B alleles (B1 and B2 in 66a, probably corresponding to “pro B” and “pro A” respectively, in 70) show divergent downstream restriction maps, although they share some crosshybridizing sequences (70). Just 140 bp downstream from the B2-@ PARP gene is another gene (procyclin-associated gene, or PAG) of about 2.5 kb, containing an open reading frame. A gene with 5‘ homology to PAG is found at the B1 locus (1. Roditi and E. Koenig, personal communication). In strain ILTat 1.21, the parp 82 locus contains an additional PARP B-@lar hybrid gene (70). T h e sequences of the A and B loci diverge only 640 b p upstream from the a gene trans-splicing acceptor sites (25, 28). About 4kb upstream in the B loci is a gene encoding a microtubule-associated protein (MARP) (70); 1. Roditi and E. Koenig, personal communication).

GENE EXPRESSION IN

Trypanosoma brucei

51

D. Transcription of the PARP Genes Each PARP gene splice acceptor is preceded by 40 bp of a very dT-rich sequence necessary and sufficient for trans-splicing of the PARP transcripts (93a). Apart from this, the intergenic sequence (between a and p genes) is completely different from that upstream from the a genes. Because both A and B loci show regulated transcription, we and others hypothesized that all sequences for such regulation, hence, the promoter, might lie within the 640-bp region of shared upstream homology. Although PARP gene transcription is insensitive to a-amanitin, transcription of the MARP gene is a-amanitin-sensitive. (70).Nuclear run-on and UV-inactivation analyses show that the promoter is likely to lie within about 100 bases of the cw-gene spliceacceptor sites (25, 28, 86). Upstream from this point, transcription is a-amanitin-sensitive and not developmentally regulated (25, 28, 86). The a-amanitin-resistant transcription extends beyond the end of the GRESAG 2.1 in the A locus (93), but may terminate only 3 kb or so downstream from the B-@ genes (25),just beyond the end of the PAG gene (I. Roditi and E. Koenig, personal communication).

E. Detailed Promoter Analysis Our first transfection assays (28) showed that constructs containing the PARP promoter were about 100 times more active than any other previous trypanosomatid construct [those for Leptomonas seymouri (27)and Leishmania (26)l.The PARP promoter did not work in Leptomonas seymouri; this is in keeping with the apparent inability of a Leishmania expression vector to work in T . brucei (30).The promoters, or the mini-exon splice-acceptor sites, may be incompatible, although with the Leishmania vector other explanations are possible (e.g., inability to maintain an episome or inappropriate transfection conditions). The region between the PARP a and @ genes has no promoter activity in the transfection assay (25), confirming that transcription of the locus in polycistronic.

1. PROMOTER BOUNDARIES Deletion analyses indicate that wild-type promoter and spliceacceptor activity is contained within a region of330 bp (Fig. 4) (28,62), of which the 3’-most 40 bp comprise the splice-acceptor sequences (Section 111,D).Primer-extension results with either transiently transfected or permanently transformed cells suggest that the CAT RNAs produced from the PARP promoter are trans-spliced at the correct position (33, 62). Searches in several laboratories for PARP mRNA precursors in normal cells (by reverse transcriptions using primers

52

CHRISTINE CLAYTON *-240

*-230

*-220

GTCATTGGGGTTAAGCGGAAASGTGTGTGT '-210

*-200

*-190

*-180

*-170

*-160

*-150

*-140

*-130

*-120

*-110

*-loo

CAGTAGGTTGTGAGGTGAAAGCGTTTTCAGATGCATAGTGAGCTTAATGTCCTTTTCACA CTTtA-GTaCTTTTCACA

GTATATCGTGTCTGATAGGTATCTCTTATTAGTATAGTCGAATACTAGTCAATAGTGC~ GggT *-go '-80 * -70 *-60 *-50 *-40 TTTG?GC~TGTCCATTTTGTG~AGTGATGG~TTGTTTTAT~CTATTCCG~-~

*-30

*-20

*-lo

*t1

*+lo

*+20

ITGGG'IJGGG agtAAAAgTAGcGcTTA-CGGcgtAc

*+30

*c40

*+50

*+60

*+70

*+80

GTGATCGCTGCACGCGCCTTCGAGTTTTTTTTCCTTTTCCCCATTTTTTTCAACTTG~~~

FIG. 4. Sequence of the PARP promoter up to the splice-acceptor site at +80 (double type). The putative transcription-initiation site is numbered + 1 and is in bold type. The four repeats of the sequence YRTTTTRTG are indicated by arrows. Sequences essential for promoter activity are boxed. Matching sequences from the VSC promoter and rRNA promoter (initiation site in bold type) are beneath the PARP sequence starting at -176 and -23, respectively.

upstream from the splice-acceptor site) have proved fruitless. However, possible precursors are detected in cells given small amounts of UV irradiation (Section II1,G) (86, 34). Primer extensions using as template RNA from such cells yield products terminating around position -84 relative to the splice-acceptor site (Fig. 4) (86,94). Primer extensions using a CAT primer or a precursor-specific primer on RNA from transfected cells also give a faint band either at -83 (62); J. Flaspohler and C. Clayton, unpublished) or at -86 (93a)relative to the splice acceptor. This band could represent either the transcription initiation site or the branch-acceptor site for truns splicing (5), although the results of a recent mutational analysis (93a)make the latter rather unlikely. In summary, the results so far indicate that the region required for full PARP promoter activity is twice the size of the VSG promoter.

2. INTERESTING SEQUENCE ELEMENTS The PARP promoter lacks concensus prokaryotic (78)and eukaryotic (95, 96) polymerase-I1 promoter elements, and has only vague

GENE EXPRESSION IN

53

Trypanosoma brucei

homology to VSG promoters and the trypanosome rRNA promoter (98). Results of deletion analysis showed that the region from -115 to the transcription initiation site can direct expression at 10-20% of wildtype levels (62). Therefore, sequences upstream have a stimulatory role. A “linker-scanner”-type analysis (62) from position -190 to +5 identified just two vital sequences, mutation of either of which reduces promoter activity to less than 5%: -72 to -63 and -42 to -33 (boxed in Fig. 4).Preliminary results of finer mutational analysis suggest that, in each case, it is the GT-rich region that is most important. Mutations of 10 bp between -33 and -3 also decrease expression markedly. In particular, alteration of the sequence AAAATAG (-20 to - 14) inhibits by 85%. This sequence bears a passing resemblance to a TATA box, but probably would not function as such in yeast or mammals (97).The whole sequence from -20 to 1also resembles the T. brucei rRNA promoter (98) (Fig. 4). Polymerase-I1 transcription usually initiates at a fixed position downstream from the TATA box: 40- 120 bp in yeast (99) and about 30 nucleotides in higher eukaryotes (100).The effect of the AAATAG mutation on initiation accuracy has yet to be assessed. A TATA box is far from essential, even in mammals (100-104), so even if PARP is a polymerase-I1 transcription unit, it may not have one. It is notable that mutations around the transcription start site had very little effect. Transcription of rRNA usually initiates on an A or G residue (105); mutation of the A at the trypanosome rRNA initiation site to T abolished expression, and to C caused severe inhibi. the PARP initiation site, the G at +2 has been tion (72a; 1 0 5 ~ )At mutated to T and to C, and the A ( + l ) to G with very little effect on expression (62; R. Huangand L. H. T. Van der Ploeg, personal communication). The two VSG 221 expression-site initiation sites were mapped by Zomerdijk et al. (65) to T residues. It is possible that the mapping of some of these initiation sites is inaccurate. Alternatively, the requirements for initiation at VSG, PARP, and rRNA promoters are different. Deletion of base-pairs -109 to -69 reduces expression to background levels; replacement of the sequence with 40 bp of different sequence restores expression of 20%. This region must therefore have both a spacer role and some other sequence-dependent activity. Between -99 and -33 are four repeats of the sequence YRTTTTRTG, one of them in inverted orientation. The arrangement (but not the sequence) of these elements, indicated by arrows in Fig. 4, is rather reminiscent of hormone-response elements (106,107).Individual mutation of these repeats (including mutation of the inverted element, which could form a stem-loop) has absolutely no effect on promoter

+

54

CHRISTINE CLAYTON

activity (62; M. Hug, unpublished). However, it could be that the presence of just one or two of the elements is sufficient for promoter function. As noted above, deletion analysis suggests that the sequences between - 189 and - 114 stimulate PARP transcription at least 4-fold. However, we have been unable to identify the sequences responsible. The region does have a 16-nucleotide homoIogy to a region about 300 bp upstream from the VSG 221 promoter (65).It would be nice to think that this region is a specific enhancer element. I n support of this idea, changing the orientation of the sequence does not affect the level of transcription much. Unfortunately, however, mutations of this sequence do not have enough effect to account for the deletion results. It is possible that some sequences further upsteam in the vector are influencing promoter activity, and that the deletions are amplifying an inhibition by bringing them closer. The binding of the different factors to the promoter element enables them to interact with each other to promote the formation of an active initiation complex. For this reason, the spacing between the different protein-binding elements is often critical, and can determine the nature and type of response to different DNA-binding proteins (106,107,107a) or even the nature ofthe transcribingpolymerase (108, 109).The PARP promoter exhibits profound spacing effects. For example, addition of either 4 b p bust under half a helix-turn) or 11b p (a little over a helix-turn) in the -80 region abolishes expression of a reporter gene. Such results are perplexing because we have been unable, b y mutation, to identify any upstream sequence that might be responsible for them. Perhaps different sequence changes would have more deleterious effects, or perhaps the sequence requirements for activity of the upstream region are not very stringent. However, the results do fit the general overall pattern seen for polymerase-I promoters. Comparison with, for example, the Xenopus Euevis rRNA promoter is instructive. Two domains were identified by mutational analysis as being essential for its activity in viuo-one at around - 134 and one from -36 to + 10 (IOga)-and precise spacing between these elements was critical. It is possible to see in the PARP promoter a similar pattern, although the upstream region is stimulatory, rather than essential. As in other polymerase-I promoters (105),the essential element might bind some SL1-like factor and active RNA polymerase; the upstream element might bind to an upstream binding factor, which could be stagespecific. Could disruption of the spacing between these elements cause inhibitory interactions between the factors? The very limited homology between VSG, PARP, and rRNA promoters implies that

GENE EXPRESSION IN

Trypanosoma brucei

55

[as suggested by Zomerdijk et al., (105a)l either they do not all bind the same factors or the requirements for binding do not include strict contiguous sequence homologies.

F. Is Transcription Initiation Regulated? When expression of a particular VSG is turned off during differentiation into procyclic forms, the promoter is still active (65, 86, 110). [Whether just one promoter is active, or several or all are trickling at a very low level ( I l l a ) ,is not known.] However, transcription terminates only a short distance downstream from the promoter, within ESAG 6 or 7 (65,110)(Fig. 2 ) . No genomic sequence changes in, or downstream from, the promoter are required for this termination (65). In DNA transfection, the VSG promoter is as active as the PARP promoter in procyclic trypanosomes (65). This is consistent with the idea that VSG synthesis is switched off by premature termination, rather than by control of initiation. Zomerdijk et aE., (65) argued, however, that the same thing is not happening during the switch from one VSG expression site to another. In the expression sites identified so far, the probable promoter regions all cross-hybridize. If all the promoters were active all the time, but controlled by downstream termination, one would expect, contrary to their observation, the apparent rate of transcription of promoterproximal sequences to be five to 20 times that of regions further downstream in the expression site. This issue remains controversial. What happens when VSG is re-expressed in the tsetse fly salivary glands is not clear and has received little attention, as the differentiation does not occur readily in vitro and most experimenters do not have regular access to tsetse files. Metacyclic trypanosomes express a limited range of VSGs, whose expression is activated in the salivary glands without gene rearrangement ( 1 1 1 ) . Upon return to a mammal, the metacyclic antigen is rapidly replaced with nonmetacyclic types. Pays et al. (86)argued that VSG and PARP transcriptional initiation is constitutive. The apparent difference in the transcription rates of the PARP genes between bloodstream and procyclic trypanosomes is rather variable, but usually between 5- and 10-fold (25, 28, 86): certainly insufficient to account for the observed 104-foldregulation in the levels of mature mRNA, but by no means constitutive. Control of PARP could nevertheless be by premature termination, but to be consistent with the evidence [transcription of the repeat region of the A-a gene is developmentally regulated (28)] the termination would have to occur within a couple of hundred base-pairs of the transcription initiation site.

56

CHRISTINE CLAYTON

G. A Peculiarity: The Effect of UV Irradiation on Trypanosome mRNA

Transcriptional inactivation by UV irradiation was initially used in trypanosomes to measure the length of the VSG transcription unit (79). T h e trypanosomes are irradiated with varying doses of UV light, incubated for about 90 min to allow polymerase run-off, then prepared for transcription assay by either mechanical breakage or detergent treatment. UV irradiation introduces thymidine dirners in DNA, past which RNA polymerase cannot transcribe. The higher the dose, the shorter the average distance between dimers. In theory, the apparent rate of transcription along a transcription unit after UV irradiation is inversely related to the distance from the promoter, the logarithm of the rate decreasing linearly with the dose. Using as a standard the RNA locus, whose promoter has been identified by transcriptional analysis, such a relationship was obtained (25, 79). In these experiments, trypanosome “nuclei” (really a very crude low-speed pellet of disrupted trypanosomes) were prepared in a Stanstead cell disruptor and transcription was allowed to proceed for 5 min. Within 1-2 kb downstream from the VSG and PARP promoters, no effect of UV irradiation on transcription could be seen. In contrast, nuclei prepared by NP-40 permeabilization and allowed to transcribe for 30 min show an apparent promoter-proximal transcriptional stimulation (at rRNA, VSG, and PARP loci) of up to 20-fold (28,81,86). It is not clear to what extent this effect is method-dependent. Gottesdiener et al. (1I l a ) documented an increase in promoter-proximal transcription in Stanstead cell-disruptor preparations allowed to transcribe for 5 min, but the stimulation was only 2-fold. Pays et al. analyzed this effect in detail. RNA from trypanosomes irradiated with low doses of UV show a marked increase in the level of transcripts that are larger than the mature species. These larger transcripts contain promoter-proximal and intergenic sequences (81, 86, 112).It was originally postulated (86)that UV irradiation inhibits RNA processing, thus stabilizing intergenic transcripts. More recently, they reported that the major effect is an inhibition of RKA decay. Transcription in NP-40 nuclei is linear for less than 10 min (94) and levels out at around 15 min for UV-treated cells and between 30 and 60 rnin for normal cells. However, the apparent UV stimulation of promoterproximal transcription is constant for the first 60 min and is unaffected by inhibition of protein synthesis during irradiation a i d incubation. In these experiments (94), no effect of a 30-min protein-synthesis inhibition on the abundance of PAKP and VSG transcripts was noted.

GENE EXPRESSION IN

Trypanosoma brucei

57

During trypanosome transformation, UV irradiation stabilized VSG and 5' expression-site transcripts and potentiated the accumulation of PARP mRNA; abnormal RNA species accumulated, including both possible precursors and, in the case of rRNA, species that could be a consequence of abnormal processing. RNA turnover (measured by pulse-chase with [3H]adenine) was apparently inhibited by the UV irradiation, and the half-lives of all transcripts measured (expression site, VSG, PARP, and actin) were 2.5 hours. This half-life does not agree at all with other results (113) (see Section IV,A), but as the temperature in the UV experiments was 20°C rather than 2TC, direct comparison is, unfortunately, not possible. Whatever the cause of the UV effect, it may prove useful in the identification and cloning of promoters. Indeed, Ben Amar et al. (113a) have mapped the promoter of the T. brucei actin gene to 4 kb upstream of the first actin gene using this phenomenon. Further assessment of the mechanism may be possible in lysolecithin-permeabilized cells, in which RNA processing is known to take place but can be effectively inhibited by changes in incubation conditions (36,37).Very preliminary results show no UV-mediated stimulation of PARP promoterproximal transcription in such cells, under conditions in which splicing can occur (C. Clayton, unpublished).

IV.

Kinetic Analysis of the Differentiation Process

During the transformation of bloodstream to procyclic forms, there is presumably some sort of cascade of signals to change the levels of mRNAs. Most questions about this are unanswered. We need to know the signals, what happens, and the temporal sequence of events. It is clear that in vitro the temperature shift is critical but that a change in chemical environment is strongly stimulatory. How does the parasite detect these changes? What are the first intracellular changes that occur? Some of the many things that might be expected include the following. 1. Activation of new PARP-specific transcription factors or inactivation of PARP-specific termination factors or repressors 2. Inactivation of VSG-specific transcription factors or activation of VSG-specific termination factors or repressors 3. Secondary modification of DNA (e.g., methylation) 4. Activation of factors favoring transsplicing (or polyadenylation)

58

CHRISTINE CLAYTOX

of mRNAs that are up-regulated in procyclic forms; inactivation of the corresponding bloodstream-specific factors 5. Activation of factors promoting degradation of bloodstream transcripts or stabilization of procyclic-specific transcripts; inactivation of the corresponding bloodstream-specific factors. 6. Activation of mechanisms causing movement of genes to appropriate positions in the nucleus In each case, the factors involved could be protein, RNA, a combination of the two, or conceivably something else. Activation and inactivation could be by de nouo synthesis and degradation, or by secondary (post-translation) modification. Events requiring protein synthesis should (in theory) be secondary (post-translational) modification. Events requiring protein synthesis should (in theory) be inhibited by protein-synthesis inhibitors. Changes in protein phosphorylation have indeed been reported (114).Is a novel nucleotide present only in bloodstream-form DNA (115)important in gene regulation? Does its elimination in the procyclic transition require DNA replication? How important is subnuclear organization (116)in the regulation of gene expression? Presumably, if the PARP or VSG genes are not in the nucleolus, they will not be transcribed. Considerable effort has been expended trying to establish the basic parameters of mRNA turnover and its dependence on protein synthesis and DNA replication. Unfortunately, the results published so far serve mainly to confuse, as different trypanosome isolates give different results. There is not even agreement on the extent of mRNA regulation. Levels of fructose-bisphosphate aldolase mRNA are regulated to a similar degree in both the monomorphic MITat 1.4 (427)strain and in pleomorphic strains (44). However, the regulation of phosphoglycerate kinase mRNA (described in Section I1,C) may be very exaggerated in monomorphic trypanosome strains. Parsons and Hill (117) found that monomorphic slender bloodstream forms had dramatically more glycosomal phosphoglycerate kinase mRNA than the slender bloodstream forms of pleomorphic strains, and that levels of gPGK mRNA could be induced simply by rapid serial passage of the pleomorphic strain.

A. Induction and Turnover of VSG and PARP

Proteins and mRNA The developmental regulation of mRNA levels during differentiation appears to depend on the type of trypanosome strain studied. In MITat 1.4, a strain with intermediate morphology that does not trans-

GENE EXPRESSION IN

Trypanosonza brucei

59

form between life-cycle stages very readily, pulse-chase experiments using C3H]adenine as tracer showed that addition of citrate and cisaconitate and a shift to 27°C reduced the half-life of VSG mRNA from 4.5 to 1.2 hr (113).At the same time, the rate ofVSG gene transcription in vivo was reduced to about one-ZSth, and decreased to undetectable levels after 7 hr. However, return of the parasites to bloodstream conditions within 8 hr reversed these effects (118).Oddly, the tubulin mRNA half-life was 7 hr in established procyclics and bloodstream forms, but only 1.4 hr in cultured bloodstream forms. Transfer of cultured bloodstream forms to transformation conditions had no effect on the turnover of tubulin mRNA, and also no effect on the half-life of the 139-nucleotide RNA that serves as a donor for mini-exon trans splicing (medRNA) (1.2-2 hr). However the half-life of medRNA measured in this way is much too long; measurements are compromised by the presence of a large internal ATP pool. By including analyses of pool turnover, Laird e t al. (118a)showed a medRNA half-life of less than 6 min in pulse-chase experiments, confirming a similar result obtained after inhibition of mRNA synthesis by chloroquine (119). During the transformation process, PARP increases as VSG decreases, and both proteins can be expressed simultaneously in the same cell (10). Induction of PARP mRNA follows a course complementary to the decrease in VSG. In asynchronously transforming MIT at 1.4 trypanosomes, an increase in PARP mRNA is detectable within 15 min. (120). Three hours after addition of citrate and/or cisaconitate at 37"C, PARP mRNA increased to 1.5times the bloodstream level. A shift to 27°C increased induction to 9-fold (120).Both mRNA and protein reach final steady-state procyclic levels within about 24 hr (10). Synchronously transforming pleomorphic AnTat 1.1cells, in contrast, acquire their full complement of PARP in about 12 hr (9).

B. Dependence on Protein Synthesis The level of VSG mRNA is rapidly reduced in bloodsteam MITat 1.4 trypanosomes incubated with protein-synthesis inhibitors. The VSG mRNA is labilized (the half-life decreases to 45 min), whereas tubulin and medRNA transcripts are unaffected (113,118).Inhibition of protein synthesis, therefore, has an effect on VSG mRNA levels that is very similar to that of the inducers of trypanosome transformation, citratelcis-aconitate, and the temperature shift. The parallel goes further, as the effects of each are reversible, for a few hours at least. Removal of the protein synthesis inhibitor from the bloodstream forms, or removal of citric-acid-cycle intermediates, or a temperature shift back to 37°C were each individually able to lead to a partial or complete

60

CHRISTINE CLAYTON

restoration of VSG mRNA levels. In separate experiments, inhibition of protein synthesis potentiated the induction or PARP mRNA and could, in fact, induce PARP expression on its own (5-fold in 3 hr) (120). The overall picture from the studies described so far is that PARP and VSG expression behave in complementary fashion. Whether the inducing agent is a temperature shift with citrate and cis-aconitate or protein-synthesis inhibition, VSG transcription falls (and the mRNA half-life is reduced) as PARP transcription is induced. From these observations, one might conclude that VSG gene transcription requires some specific protein factor that is absent in procyclic parasites, and that in bloodstream trypanosomes PARP transcription is prevented by a labile protein repressor. VSG mRNA stabilization could require either some labile protein factor or ongoing translation. These conclusions cannot all be sustained because pleomorphic strains (LUMP 1026 and EATRO 1895)give different results. In these strains, induction of PARP niRNA by the 27°C temperature shift (these strains do not require citrate and cis-aconitate for rapid transformation to the procyclic form) was completely inhibited by protein-synthesis inhibition (121). Induction of the procyclic-specific mRNA dr6 (encoding a protein of unknown function) was not inhibited in the absence of protein synthesis. Consistent with this apparent difference in regulation mechanism, in the strain EATRO 110, which is incapable of full procyclic differentiation, dr6 can be turned on, but the PARP genes cannot. Unfortunately, no study as yet has measured the effect of proteinsynthesis inhibition on PARP, dr6, and VSG mRNA simultaneously; it would be interesting to include some of the other developmentally regulated mRNAs as well, and to compare strains under identical conditions. For example, in experiments with pleomorphic strains, citrate and cis-aconitate are often omitted from the transformation media; for monomorphic strains, they are required. Could this explain some of the discrepancies in the results? Relationship to Cell Division Transformation of MITat 1.4 trypanosomes is not synchronous, so correlation with division is difficult (20). Using a pleomorphic strain, Ziegelbauer et al. (9)observed synchronous transformation. Division was halted for 12 hr after transfer to medium containing citrate and cis-aconitate, then resumed with a division time of 12 hr. During this time, PARP was detectable by immunofluorescence within 2-4 hr. Surface VSG was constant for 4 hr, then decreased with a half-life of about 8 hr. Clearly, neither change requires cell division. DNA replication was not assayed in this study. If the changes in PARP and VSG

C.

T

transciption occur before replication, and if changes in DNA modification occur only during DNA replication, such changes would probably not be a primary event in the gene regulation. The short stumpy or DFMO-treated forms discussed earlier Section 1,C) are nondividing. Is a halt in cell division a necessary part ofthe differentiation process? Is it in itself a signal for some of the biochemical changes that occur?

V. Future Prospects The recent development o f trypanosomatid DNA transfection has completely changed the outlook for trypanosomatid molecular and developmental biology. By the time this review is published, detailed mutational analyses will probably be available for several VSG promoters and the ribosomal promoter, and it is quite likely that promoters of RNA-polymerase-I1 transcription will have been identified. Transfection experiments will also tell us which sequences in the transcripts are required for post-transcriptional regulation. Gene replacement will enable us to make mutants, and may enable us to determine the importance of premature termination, as we should tie able to delete the termination sites. Possibilities are currently limited by the fact that DNA transfection of bloodstream trypanosomes, although possible, achieves only one-hundredth of the expression of the reporter gene than transfection of procyclic trypanosomes (63); V. Curruthers and G. A. M. Cross, personal communication). To look at developmental regulation, it must be possible to make direct comparisons of the activity of constructs in t)loodstream and procyclic forms. Some of the difficulties may be circumvented by passing permanently transformed procyclic trypanosomes through tsetse flies (E. Pays, personal communication), but this cannot be done routinely in most laboratories, and the activity of genes in permanently transformed parasites may be influenced by the genomic context at the integration site. We need better culture systems, particularly for the development of metacyclic forms. Another limitation is the current absence of methods to induce expression of genes after transfection. What is the effect o f overexpressing the ESAGs? Or of expressing antisense KNA to PARP? In order to look at the behavior of even marginally detrimental constructs, an inducible expression system would be an enormous advantage. Possibly, a prokaryotic system can be introduced (122). We have been using transfection for about 2 years, and are already beginning to fell its limitations keenly. Despite the expenditure of several person-years in a number of laboratories, the nearest thing we have to a trypanosome in vitro transcription or KNA-processing system

62

CHRISTINE CLAYTON

is a permeabilized cell or a crude nuclear pellet. Direct evidence for transcription factors can only be obtained through in vitro studies of sequence-specific DNA binding and transcription. This is the goal toward which the next technical effort must be directed. No amount of technical progress i s likely to tell us why the African trypanosomes use polymerase I to transcribe their surface antigen genes. Is this the only polymerase that can be regulated? No polymerase-I proteins have been found in the other trypanosomatids. And why have the trypanosomatids evolved such an apparently wasteful way of controlling their mRNA abundance, in both the nucleus and the mitochondrion? I know of no other organism, prokaryotic or eukaryotic, that achieves all (or nearly all) mRNA control by post-transcriptional mechanisms. Could this have evolved in concert with trans splicing? If so, will similar phenomena be seen in truns-spliced helminth and plant mRNAs? Whereas in multicellular eukaryotes some mRNAs are composed of cis-spliced exons from genes that are more than 10 times as long as the final-product mRNAs, trypanosomes have tiny intergenic regions and no introns. Perhaps this compensates for the apparent profligacy in trypanosome transcription.

ACKNOWLEDGMENTS I thank Vern Curruthers and George Cross (The Rockefeller University); Mary Gwo-Shu Lee and Lex Van der Ploeg (Columbia University); Joost Zomerdijk and Piet Borst (Netherlands Cancer.Institute); Etienne Pays (UniversitC Libre de Bruxelles); and Isobel Roditi (Universitat Bern) for communicating unpublished results. Thanks also to Peter Overath (h.Iax Planck Institut fur Biologie, Tubingen); Isobel Roditi; Ingrid Grummt (Deutsche Krebsforschungzentrum, Heidelberg); Steve Beverley (Harvard University); and Ernst Grondal (Zentrum fur Molekulare Biologie, ZMBH, Heidelberg) for interesting discussions. I thank Barbara Sollner-Webb (the Johns Hopkins [Jniversity), who convinced me that the VSG polymerase is polymerase I; Etienne Pays, Joost Zomerdijk, and Elizabeth Wirtz (ZMBH) for detailed critique and for pointing out omissions in this article; John Flaspohler (ZMBH) for reading, and Lex Van der Ploeg for attempting to read, the manuscript; and Gaik-Pin Wee for final editing and formating.

REFERENCES 1. World Health Organization, “Tropical Diseases. Progress in Research 1989-1990,”

10th Programme Report of the UNDPlWorld Bank/WHO Special Programme for Research and Training in Tropical Diseases. World Health Organization, Geneva, 1991. 2. M. L. Sogin, H. J. Elwood and J. H. Gunderson, PNAS 83,1383 (1986). 3. hi. L. Sogin, J. H. Gunderson, H. J . Elwood, R. A. Alonso and D. A. Peattie, Science 243,75 (1989). 4. K. Stuart, Trends Biochem. Sci. 16,68(1991). 5. N . Agabian, Cell 61, 1157 (1990).

GENE EXPRESSION IN

Trypnnosomn brucei

63

6. A. H. Fairlamb and F. R. Opperdoes, in “Carbohydrate Metabolism in Cultured Cells” (M. J. Morgan, ed.), p. 183. Plenum, New York, 1986. 6u. R. F. Steiger, Actu Trop. 30,65 (1973). 7. J . E. Donelson, in “Mobile DNA,” p. 763. American Society for Microbiology, Washington, D.C. 1989. 8. L. H. T . Van der Ploeg, New Biologist 3,324 (1991). 8u. G. A. M . Cross, Annu. Reu. Immunol. 8,83 (1990). 9. K. Ziegelbauer, M. Quinten, H. Schwarz, T. W. Pearson and P. Overath, EJB 192, 373 (1990). 10. I. Roditi, H. Schwartz,T. W. Pearson, E. P. Beecroft, M. K. Liu, J. P. Richardson, H. Biiring, J . Pleiss, R. Biilow, R. 0. Williams and P. Overath,JBC 108,737 (1989). 11. C. E. Clayton and M. R. Mowatt,JBG 264,15088 (1989). 12. K. E. Bass and C. C. Wang, Mol. Biochem. Purusitol44,261 (1991). 13. B. Hamm, A. Schindler, D. Mecke and M. Duszenko, MoZ. Biochem. Purusitol40, 13 (1990). 13a. E. F. Michelotti and S. L. Hajduk,JBC 262,927 (1987). 14. B. F. Giffin, P. P. McCann, A. J. Bitonti and C. J. Bacchi,]. Protozool. 33,238 (1986). 15. G. C. Hill, BBA 465, 149 (1976). 16. J. E. Feagin, D. P. Jasmer and K. Stuart, MoZ. Biochem. Purusitol. 20,207 (1986). 17. E. J. Bienen, M. Saric, G . Pollakis, G. Grady and A. B. Clarkson, Mol. Biochem. Purusitol. 45, 185 (1991). 18. K. Ziegelbauer, M . Quinten, H. Schwarz, T. W. Pearson and P. Overath, EJB 192, 373 (1990). 19. P. Overath, J. Czichos and C. Haas, EJB 160, 175 (1986). 20. W. C. Gibson, K. A. Osinga, P. A. M.Michels and P. Borst, Mol. Biochem. Purusitol. 16,231 (1985). 21. C. M . R. Turner, J. Sternberg, N. Buchanan, E. Smith, G. Hide and A. Tait. Purasitology 101,377 (1990). 22. K. Gottesdiener, J. Garcia-Anoveros, M. G.-S. Lee and L. H. T. Van der Ploeg, MCBioZ 10,6079 (1990). 23. S. M . Beverley, Annu. Rez;. MicrobioZ. 45,417 (1991). 24. K. Kaur, K. Emmett and B. Ullman,JBC 263,7020 (1988). 25. G. Rudenko, S . Le Blancq, J. Smith, M. Gwo Shu Lee, A. Rattray and L. H. T. Van der Ploeg, MCBioZ 10,3492 (1990). 26. A. Laban and D. F. Wirth, PNAS 86,9119 (1989). 27. V. Bellofatto and G. A. M. Cross, Science 244,1167 (1989). 28. C. E. Clayton, J . P. Fueri, J. E. Itzhaki, V. Bellofatto, G . S. Wisdom, S. Vijayasarathy and M. R. Mowatt, MCBioZ 10,3036 (1990). 29. G. M. Kapler, C. M. Coburn and S. M. Beverley, MCBioZ 10,1084 (1990). 30. C. M. Coburn, K. M. Otteman, T. McNeely, S. J. Turco and S. M. Beverley, Mol. Biochem. Parusitol. 46, 169 (1991). 31. A. Cruz and S. Beverley, Nature 348, 171 (1990). 32. J. Eid and B. Sollner-Webb, PNAS 88,2118 (1991). 33. M. G.-S. Lee and L. H. T. Van der Ploeg, Science 250,1583 (1990). 34. A. L. M. A. ten Asbroek, M. Ouellette and P. Borst, Nature 348, 174 (1990). 35. J. Huang and L. H. T. Van der Ploeg, MCBiol11,3180 (1991). 36. E. Ullu and C. Tschudi, NARes 18,3319 (1990). 37. C. Tschudi and E. Ullu, Cell 61,459 (1990). 38. C. Tschudi, A. S. Young, L. Ruben, C. L. Patton and F. F. Richards, PNAS 82,3998 (1985).

64

CHRISTINE CLAYTON

39. M.G . Lee and L. H. Van der Ploeg, MoZ. Biochem. Pnrasitol. 41,221 (1990). 40. P. A. hl. Michels, A. Poliszczak, K. A. Osinga, 0. iMisset, J. Van Beeumen, R. K.

Wierenga, P. Borst and F. R. Opperdoes, EMBO J . 5,1049 (1986). M.A. Imboden, P. W.Laird, X.1. Affolter and T. Seebeck, NARes 15,7357 (1987). 42. W. C. Gibson, B. W. Swinkels arid P. Borst, JMB 201,315 (1988). 43. S . Vijayasarathy, I. Ernst, J. E. Itzhaki, D. Sherman, hl. R . hlowatt, P. A. M.Michels and C. E. Clayton, NARes 18,2967 (1990). 44. C. E. Clayton, EMBOJ. 4,2997 (1985). 45. C. Tschudi and E. Ullu, EMBOJ. 7,455 (1988). 46. M. F. Ben Amar, A. Pays, P. Tebabi, B. Dero, T. Seebeck, M. Steinert and E. Pays, MCBioZ 8,2166 (1988). 47. J. H.Lebowitz, C. M.Coburn, D. McMahon-Pratt and S. Beverley, PNAS 87,9736 ( 1990). 48. D. J . Glass, R. I. Polvere and L. H. T. van der Ploeg, MCBiol6,4657 (1986). 49. E. A. Dragon, S. R. Sias, E. A. Kato and J. D. Gabe, MCBiol7, 1271 (1987). 50. M.G.-S. Lee, B. L. Atkinson, S. H. Giannini and L. H. T. Van der Ploeg, NARes 16, 9567 (1988). 51. F. Lawrence and bi. Robert-Gero, PNAS 82,4414 (1985). 5 l a . h.1. G. Lee, R. I. P. Polvere and L. H. Van der Ploeg, Mol. Riochem. Purnsitol. 41, 213 (1990). 52. H. J. Yost and S. Lindquist, CeEl45, 185 (1986). 53. M.hluhich and J. C. Boothroyd, MCBiol8,3837 (1988). 54. M . L. Muhich, hl. P. Hsu, and J. C. Boothroyd, Gene 82, 169 (1989). 55. M. L. Muhich and J. C. Boothroyd,JBC 264,7107 (1989). 56. H. J. Yost and S. Linquist, Science 242, 1544 (1989). 57. J. Amin, J. Anathan and R. Voellmy, MCBiol8,3761 (1988). 58. J. A. Atwater, R. Wisdom and I. h.1. Verma, ARGen 24,519 (1990). 59. M. h,loore, J. Schaack, S . B. Baurn, R. I. Morimoto and T. Schenk, MCBiol12,4505 (1987). 60. R . E. Breitbart. A. Andreadis and B. Nadal-Ginard, ARB 56,467 (1987). 61. H. D. Love, A. Allen-Nash, Q. Zhao and G. A. Bannon, MCBiol8,427 (1988). 62. D. Sherman, L. Janz, M. Hug and C. E. Clayton, EMBO J. 10,3379 (1991). 63. D. Jefferies, P. Tebabi and E. Pays, MCBioZ 11,338 (1991). 64. N. J . Proudfoot, Cell 64,671 (1991). 65. J. C. B. h4. Zomerdijk, M.Ouellette, A. L. M. A. ten Asbroek, R. Kieft, A. M. Y . Bommer, C. E. Clayton and P. Borst, EMBOJ. 9,2791 (1990). 66. A. F. Torri and S. L. Hajduk, MCBiol8,4625 (1988). 66a. hl. R. Mowatt and C. E. Clayton, MCBiol7,2838 (1987). 66b. I. Roditi, M. Carrington and M. Turner, Nature 325,272 (1987). 67. J. R. Thomas, R. A. Dwek and T. W.Rademacher, Bchern 29,5413 (1990). 68. J. M.Kooter and P. Borst, NARes 12,9457 (1984). 69. G. Rudenko, D. Bishop, K. Gottesdiener and L. H. T. Van der Ploeg, EAIEO J . 4259 (1989). 70. E. Koenig, H. Delius, M . Carrington, R. 0.Williams arid 1. Roditi, A'ARes 17,8727 (1989). 71. E. J . M. Grondal, R. Evers, K. Kosubek and A. \!:. C. A. Cornelissen, EMBO J . 8, 3383 (1989). 72. G. Rudenko and L. H. T. Van der Ploeg, EMBO J . 8,2633 (1989). 72u. G. Rudenko, H.-M. Chung, V. P. Pham and L. H. T. Van der Ploeg, E M B O J . 10, 3387 (1991). 41.

:op,

GENE EXPRESSION IN

Trypanosoma brucei

65

74. M. S . Freistadt, G. A. M. Cross and H. D. Robertson,JBC 263, 15071 (1988). 75. J. L. Smith, J. R. Levin, C. J. Ingles and N. Agabian, Cell 56,815 (1989). 76. R. Evers, A. Hammer, J. Kock, W. Jess, P. Borst, S. Memet and A. W. C. A. Cornelissen, Cell 56,585 (1989). 77. P. A. Kolodziej, N. Woychik, S.-M. Liao and R. A. Young, MCBiol 10, 1915 (1990). 78. M. S. Z. Horwitz and L. A. Loeb, This Series 38,137 (1990). 79. P. J. Johnson, J. M. Kooter and P. Borst, Cell 51,273 (1987). 80. D. F. Cully, C. P. Gibbs and G. A. M. Cross, Mol. Biochem. Purusitol. 21, 189 (1987). 81. E. Pays, P. Tebabi, A. Pays, H. Coquelet, P. Revelard, D. Salmon and M. Steinert, Cell 57,835 (1989). 81u. D. T. Ross, A. Raibaud, I. C. Florent, S. Sather, M. K. Gross, D. R. Storm and H. Eisen, EMBOJ.10,2047 (1991). 81b. P. Paindavoine, S. Rolin, S. van Assel, M. Geuskens, J.-C. Jauniaux, C. Dinsart, G. Huet and E. Pays, MCBioZ 12,1218 (1992). 82. D. Schell, R. Evers, D . Preis, K. Ziegelbauer, H. Kiefer, F. Lottspeich, A. W. C. A. Cornelissen and P. Overath, E M B O J . 10, 1061 (1991). 82u. M. R. Hobbs and J. C. Boothroyd, Mol. Biochem. Purusitol43,1(1990), 83. B. L. Smiley, A. W. Stadnyk, P. L. Myler and K. Stuart, MCBiol 10,6436 (1990). 84. P. Revelard, S . Lips and E. Pays, NARes 18,7299 (1990). 85. S. V. Graham and J. D. Barry, Mol. Biochem. Purusitol. 47,31 (1991). 85u. S. Alexandre, P. Paindavoine, P. Tebabi, A. Pays, S. Halleux, M. Steinert and E. Pays, Mol. Biochem. Purusitol. 43,279 (1990). 86. E . Pays, H. Coquelet, P. Tebabi, A. Pays, D. Jefferies, M. Steinert, E. Koenig, R. 0. Williams and I. Roditi, EMBOJ. 9,3145 (1990). 86a. J. C. B. M. Zomerdijk, R. Kieft, M. Duyndam, P. G. Shields and P. Borst, NARes 19, 1359 (1991). 87. S . Alexandre, M .Guyaux, N. B. Murphy, H. Coquelet, A. Pays, bl. Steinert and E. Pays, MCBiol8,2367 (1988). 88. C. Shea, M.G. S. Lee and L. H. T. Van der Ploeg, Cell 50,603 (1987). 89. M. Crozatier, L. H. T. Van der Ploeg, P. J. Johnson, J. Gommers-Ampt and P. Borst, Mol. Biochem. Purusitol. 42, 1 (1990). 91. M. R. Mowatt and C. E. Clayton, MCBiol8,4055 (1988). 92. M. R. Mowatt, G. S. Wisdom and C. E. Clayton, M C B i o l 9 , 1332 (1989). 93. M. Berberof, A. Pays and E. Pays, MCBiol11,1473 (1991). 93u. J. Huang and L. H. T. Van der Ploeg, E M B O J . 10,3877 (1992). 94. H. Coquelet, M. Steinert and E. Pays, Mol. Biochem. Purusitol. 44,33 (1991). 95. P. Johnson and S. L. McKnight, ARB 58,799 (1989). 96. P. J. Mitchell and R. Tjian, Science Cell 245,371 (1989). 97. T. C. White, G. Rudenko and P. Borst, NARes 14,9471 (1986). 98. C . R. Wobbe and K. Struhl, MCBiol10,3859 (1990). 99. K. Struhl, ARB 58, 1051 (1989). 100. A. G. Saltzman and R. Weinmann, FASEBJ. 3, 1723 (1989). 101. M. J. Walsh, A. Sanchez-Pozo, and N. S. Leleiko, MCBiol 10,4356 (1990). 102. J. Carcamo, S. Lobos, A. Merino, L. Buckbinder, R. Weinmann, V. Natarajan and D. Reinberg,JBC 264,3322 (1989). 103. J. E. Dahlberg and E. Lund, in “Structure and Function of Major and Minor Small Ribonucleoprotein Particles” (M. L. Birnstiel, ed.), p. 38. Springer, New York, 1988.

66

CHRISTINE CLAYTON

104. P. J. Farnham and A. L. Means, hKBiol 10,1390 (1990). 105. B. Sollner-Webb and E. B. h?Iougey,Trends Biochem. Sci. 16,58 (1991). 105a. J . C. B. M . Zomerdijk, R. Kieft, P. Shiels and P. Borst, MARes 19,5153 (1991). 106. K. Umesono, K. K. hlurakami, C. C. Thompson and R. M. Evans, Cell 65, 1255 (1991). 107. .4. M. Nlar, J. Buotin, S. M.Lipkin, V. C. Yu,J. M. Holloway, C. K. Glass and h.1. G . Rosenfeld, Cell 65,1267 (1991). 107a. L. K. Pape, J. J. Windle and B. Sollner-Webb, Genes Det'. 4,52 (1990). 108. F. Waibel and W.Filipowicz, N(1tut-e 346, 199 (1990). 109. T. Kiss, C. h*larshallsayand W. Filipowicz, Cell 65,517 (1991). 109a. J. J. Windle and B. Sollner-Webb, hfCBiol6,4585 (1986). 110. E. Pays, H. Coquelet, A. Pays, P. Tebabi and M. Steinert, MCBiot 9,4018 (1989). 1 1 I . M. J. Lenardo, K. hi. Esser, A. M. Moon, L. H. T. Van der Ploeg and J. E. Donelson, iMCBiol 6, 1991 (1986). 1 1 l a . K. Gottesdiener, H.-hl. Chung, S. D. Brown, h.1. G.4. Lee and L. H. T. Van der Ploeg, MCBiol 11,2467 (1991). 112. H. Coquelet, P. Tebabi, A. Pays, M.Steinert and E. Pays, MCAiol9,4022 (1989). 113. B. Ehlers, J. Czichos and P. Overath, lMCBiol7,1242 (1987). 113n. M. F. Ben Amar, D. Jefferies, A. Pays, K. Bakalara, G . Kendall and E. Pays, A'ARes 19,5857 (1991). 114. h?I. Parsons, h.1. Valentine, J. Deans, G. L. Schieven and J. A. Ledbetter, 3.201. Biochem. Purasitol45,241 (1990). 115. J. Gommers-Ampt, J. Lutgerink and P. Borst NARes 19, 1745 (1991). 116. M.-M. M . Chung, C. Shea, S . Fields, R. N. Taub and L. H. T. Van der Ploeg, E.IfBO J . 9,2611 (1990). 117. M.Parsons and T. Hill, Mol. Biochem. Purasitol. 33,215 (1989). 118. B. Ehlers, J. Czichos and P. Overath, FEBS Lett. 225,53 (1987). 118a. 1'. W.Laird, J. C. B. hi. Zomerdijk, D. d e Korte and P. Borst. EMBOJ.6: 1055 (1987). 119. P. W. Laird, A. L. M. A. ten Asbroek and P. Borst, NARes 15, 10087 (1987). 120. P. L. Dorn, R. A. Aman and J. C. Boothroyd, Mol. Biochem. Purnsitol. 44,133 (1991). 121. E. M'irtz, D. Sylvester and G. C. Hill, Mol. Riochem. Purusitol. 49, 119 (1991). 122. I:. Deuschle, R. Pepperkok, F. Wang, T. J. Giordano, W.T. McAllister, W. Ansorge atid H. Bujard, PNAS 86,5400 (1989).