Molecular and Cellular Endocrinology 407 (2015) 9–17

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / m c e

Di-(2-ethylhexyl)-phthalate induces oxidative stress in human endometrial stromal cells in vitro Yeon Jean Cho, Seung Bin Park, Myoungseok Han * Department of Obstetrics and Gynecology, Dong-A University Medical Center, College of Medicine, Dong-A University, Busan, Republic of Korea

A R T I C L E

I N F O

Article history: Received 2 October 2014 Received in revised form 3 March 2015 Accepted 3 March 2015 Available online 9 March 2015 Keywords: Di-(2-ethylhexyl)-phthalate Oxidative stress Endometrial stromal cells Estrogen receptor-α

A B S T R A C T

Di-(2-ethylhexyl)-phthalate (DEHP) accumulates in the environment, and its exposure is possibly associated with endocrine-related disease in women of reproductive age. The effects of DEHP on human endometrial cells are unknown. We treated human endometrial stromal cells with 10, 100, and 1000 pmol of DEHP and measured reactive oxygen species (ROS) generation, expression levels of antioxidant enzymes, alteration of MAPK/NF-κB signaling and hormonal receptors. DEHP increased reactive oxygen species (ROS) generation and decreased expression of superoxide dismutase (SOD), glutathione peroxidase (GPX), heme oxygenase (HO), and catalase (CAT). By DEHP exposure, p-ERK/p-p38 and NF-κB mediated transcription was increased. Additionally, DEHP induced estrogen receptor-α (ER-α) expression in a dose-dependent manner. This study shows the need for future mechanistic studies of oxidative stress, MAPK/NF-κB signaling, and ER-α as molecular mediators of DEHP-associated endometrial stromal cell alterations, which may be associated with the development of endocrine-related disease such as endometriosis. © 2015 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Environmental factors such as exposure to reproductive toxins may deleterious effects on human reproduction. Di-(2-ethylhexyl)phthalate (DEHP), one of the most commonly used phthalate diesters, is widely used as a plasticizer and solvent in polyvinyl chloride (PVC) products, cosmetics, children’s toys, shampoos, medical tubing, and other products. Due to its widespread use, humans are exposed to DEHP via ingestion, inhalation, and dermal exposure, and maximum daily exposure to DEHP is about 2 mg/day (Heudorf et al., 2007; Latini, 2005). Although DEHP is rapidly hydrolyzed in gut into mono (2-ethylhexly) phthalate (MEHP), which is the major metabolite in vivo, phthalates have additive effects on female reproductive health outcomes (Kay et al., 2013). DEHP is known as an endocrine disrupting chemicals (EDC), which has toxic effects on reproduction and development of humans and animals and it may be associated with endocrine-related disease in reproductive women (Lyche et al., 2009). One of the most common endocrine-related diseases involving the endometrium is endometriosis, which is a disease that causes infertility and a major reproductive worldwide health problem with a large economic burden (Simoens et al., 2007). Endometriosis is known to be related to environmental factors (Crain et al., 2008).

* Corresponding author. Department of Obstetrics and Gynecology, Dong-A University, College of Medicine, Busan 602-715, South Korea. Tel.: +82 51 240 5090; fax: +82 52 244 9553. E-mail address: [email protected] (M. Han). http://dx.doi.org/10.1016/j.mce.2015.03.003 0303-7207/© 2015 Elsevier Ireland Ltd. All rights reserved.

In a study of Korean women, DEHP plasma concentrations were found to be significantly higher in subjects with advanced-stage endometriosis (Kim et al., 2011), and earlier studies have also shown elevated DEHP plasma concentrations in patients with endometriosis in other countries (Cobellis et al., 2003; Reddy et al., 2006). Although there is evidence of persistent environmental DEHP exposure and its relationship to endometriosis, reports on the molecular mechanisms of DEHP on the pathogenesis of endometriosis are limited. Only 2 studies have shown the effect of in vitro treatment with DEHP on endometrial cells (Kim et al., 2010; Wang et al., 2010). DHEP is known to induce oxidative stress in other human cells, such as human umbilical vein cells and human placental cells (Ban et al., 2014; Tetz et al., 2013). Oxidative stress is defined as an imbalance between the production of reactive oxygen species (ROS) and antioxidant defenses that results in a series of events including damage to cellular lipids, proteins, or DNA. Antioxidant enzymes such as superoxide dismutase (SOD), glutathione peroxidase (GPx), heme oxygenase (HO) and catalase (CAT) exist. Although increased oxidative stress is observed in endocrine-related diseases involving the endometrium such as endometriosis (Carvalho et al., 2012), and oxidative stress has been shown to have associations with mitogen activated protein kinase (MAPK) and nuclear factor kappalight-chain-enhancer of activated B cells (NF-κB) activation (Ghosh et al., 2010; Li and Verma, 2002), the effect of DEHP on the response to oxidative stress response with antioxidant defenses in endometrial cells has not been explored. DEHP, through its metabolite MEHP, acts through a receptormediated signaling pathway to suppress estradiol production in the ovary. In vitro activation of peroxisome proliferator-activated

10

Y.J. Cho et al./Molecular and Cellular Endocrinology 407 (2015) 9–17

receptors (PPAR) by MEHP in granulose cells is involved (Lovekamp-Swan and Davis, 2003). A close cause-and-effect relationship between DEHP exposure and adverse effects on human endometrium has not been established. As estrogen receptor (ER)-α is the primary mediator of estrogenic action in the human endometrium (Hewitt et al., 2005), we aimed to investigate the alteration of hormonal receptors on DEHP treatment. In this study, the major goal was to evaluate if DEHP induces oxidative stress in human endometrial cells, which could underlie the pathogenesis of endocrine-related diseases involving the endometrium. At molecular level, we examined the effect of DEHP on estrogen receptor and the crosstalk of ERK/MAPK and NF-κB signaling pathway in human endometrium. 2. Materials and methods 2.1. Patients and sample collection For endometrial stromal cell (ESC) cultures, endometrial samples (n = 5) were obtained from premenopausal women who underwent hysterectomy for carcinoma in situ, who had no evidence of endometrial abnormalities, intramural myomas, adenomyosis, or pelvic endometriosis, and did not receive any hormonal medications in the preceding 3 months. All patients were of reproductive age with normal menstrual cycles. All of endometrial samples were confirmed histologically as disease free and in the early proliferative phase. Written informed consent was obtained from each patient using consent forms and protocols approved by the Review Board for Human Research of Dong-A Medical Center. 2.2. Chemicals and reagents Estradiol, dimethyl sulfoxide (DMSO), di-(2-ethylhexyl)-phthalate, and [(3-(4,5-cimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)] (MTT) were purchased form Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). The primary antibodies against Akt, Erk, and P38 and their respective phosphorylated forms, as well as anti-rabbit HRPlinked antibodies, were purchased from Cell Signaling Technology (Danvers, MA, USA). Primary antibodies against estrogen receptor-α (ER-α), ER-β, progesterone receptor (PR), endothelial nitric oxide synthase (eNOS), NF-κB, IκB, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Enhanced chemiluminescence (ECL) solution was obtained from ELPIs Biotechnology (Daejon, Korea). SYBR green was purchased from Agilent Technologies (Santa Clara, CA, USA), and Trizol reagent was purchased from Invitrogen (Carlsbad, CA, USA). Dulbecco’s modified Eagle’s medium F12, fetal bovine serum (FBS), antibiotic–antimycotics, and trypsin– EDTA were purchased from Invitrogen (Carlsbad, CA, USA). Hank’s balanced salt solution (HBSS), collagenase, and DNase were purchased from Invitrogen, and HEPES (4-(2-hydroxyethyl)-1piperazineethanesulfonic acid) was purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). 2.3. Isolation and culture of human endometrial stromal cells Endometrial stromal cells were separated from fresh endometrial tissues (Arici et al., 1993). The tissue was finely minced and cells were dispersed by incubation in HBSS containing 25 mM HEPES, 1× antibiotics, 2 mg/mL collagenase, and 0.2 mg/mL DNase for 20 min at 37 °C with agitation. The dispersed endometrial cells were separated by filtration through a sieve (70 μm). The endometrial glandular epithelium was retained by the sieve, whereas dispersed stromal cells passed through the sieve into the filtrate. Stromal cells were pelleted by centrifugation at 500 × g for 5 min and suspended in Ham’s F-12/Dulbecco’s minimal essential medium containing antibiotics–antimycotics (1%, v/v) and fetal bovine serum (FBS,

10%, v/v). Briefly, after being digested with trypsin and cultured, the medium was replaced every 48 h with fresh medium. When the cells reached confluence 80% on Petri-dish, cell passage was carried out. Stromal cells were passaged at 1:10 dilution – 1 × 105 cells/mL in a 10 cm2 dish, maintained at 37 °C in a humidified atmosphere (5% CO2 in air). Cells were used in experiments between passages 3 and 9. 2.4. Cell proliferation assay The effects of DEHP on stromal cells were assessed by the MTT assay. Cells (5 × 103 cells/mL) were incubated in a 96-well plate. Cells were incubated with 0–1000 pmol DEPH and cultured at 37 °C under a humidified atmosphere with 5% CO2 for 1–3 days. Subsequently, 20 μL MTT solution (5 mg/mL in PBS) was added to each well, and the plates were allowed to sit at room temperature for 4 h. The absorbance was measured on an ELISA Reader (BioTek Instruments, Inc., Winooski, VT, USA) at a wavelength of 495 nm. Data were expressed in optical density units. 2.5. ROS assay ROS generation was monitored by flow cytometry using the peroxide-sensitive fluorescent probe 2,7-dichlorofluorescein diacetate (DCF-DA). DCF-DA is converted by intracellular esterases into DCFH, which is oxidized into the highly fluorescent dichlorofluorescein (DCF) in the presence of a proper oxidant (Eruslanov and Kusmartsev, 2010). Cells were seeded in 6-well plates and the media were replaced with serum-free media after 18 h. Cells were harvested and a single cell suspension was ensured by fully detaching adherent cells, which were stained in PBS with 10 μM DCFDA for 30 min at 37 °C. After staining, cells were treated with 1 M H2O2 and 1000 pmol DEHP in culture media for 30 min at 37 °C. Total free radical abundance was assessed by spectrofluorometry using flow cytometry (Beckman Coulter Inc., Brea, CA, USA) with excitation/emission wavelengths of 488/535 nm. The levels of free radicals were calculated. For Hoechst staining, cells were stained with DCF-DA for 30 min at 37 °C, washed 3 times with PBS, and exposed to H2O2 and DEHP for 30 min as described earlier. To estimate the number of attached cells, cells were washed with PBS and then stained with 4 μg/mL Hoechst 33342 stain for 5 min. Stained cells were observed under a flexible confocal microscope (Zeiss, Oberkochen, Germany). 2.6. NO assay NO was measured using the colorimetric reaction of the Griess reagent. The amount of stable nitrite was determined with a colorimetric assay after 24 h of DEHP treatment, Briefly, 50 μL of culture supernatant was mixed with an equal volume of Griess reagent (1% sulfanilamide, 0.1% naphthylethylendediamine dihydrochloride, and 2.5% H3PO4) and incubated at room temperature for 10 min, after which the absorbance was read at 540 nm using an ELISA reader (BioTek Instruments, Inc., Winooski, VT, USA). Nitrite concentrations were determined by extrapolation from a sodium nitrite standard curve. 2.7. Reverse transcription-polymerase chain reaction (RT-PCR) and quantitative PCR (q-PCR) Stromal cells were treated with 10, 100, or 1000 pmol DEHP for 48 h, and total RNA was isolated using Trizol reagent. cDNA was generated from 0.2 μg of total RNA using the RevertAid First-strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany). The primers used for amplification of each gene are shown in Table 1. Real-time PCR was performed on an Applied Biosystems 7000 Real-time PCR System (Life Technologies, Carlsbad, CA, USA) with SYBR green premix. The

Y.J. Cho et al./Molecular and Cellular Endocrinology 407 (2015) 9–17

Table 1 Primers for gene expression. Gene

Accession number

Primers

Estrogen receptor-α (Tokunaga et al., 1987) Estrogen receptor-β (Lim et al., 2011) Progesterone receptor (Ishizuka et al., 2004) Cu/Zn SOD (Liu et al., 2005) Catalase

NM 000125

HO-1

NM 002133

GPx

NM 000581

GAPDH (Tokunaga et al., 1987)

NM 002046

S: AAGAGCTGCCAGGCCTGCC AS: TTGGCAGCTCTCATGTCTCC S: GTCAGGCATGCGAGTAACAA AS: GGGAGCCCTCTTTGCTTTTA S: AACACA AAACCTGACACCTC AS: CGTGTTTGTAGGATCTCCAT S: GTGGGGAAGCATTAAAGGACTGAC AS: CAATTACACCACAAGCCAAACGAC S: TCGAGCACGGTAGGGACAGTTCAC AS: TCCGGGATCTTTTTAACGCCATTG S: TTCTTCACCTTCCCCAAC AS: GCATAAAGCCCTACAGCAAC S: GCGGCGGCCCAGTCGGTGTA AS: GAGCTTGGGGCTGGTCATAA S: TGAACGGGA AGCTCACTGG AS: TCCACCACCCTGTTGCTGTA

NM 001437 NM 15716 NM 000454 NM 001752

Ct (threshold cycle) values were calculated from amplification curve. The 2 power of ΔΔCt method was used to determine the relative quantification of mRNAs expression. The expression levels of genes were normalized to that of GAPDH. 2.8. Nuclear protein extraction After treating cell with DEHP for the indicated times, cells were washed in 1 mL of ice-cold PBS, centrifuged at 3000 × g for 5 min, resuspended in 100 μL of ice-cold hypotonic buffer (10 mM HEPES/KOH, 2 mM MgCl2, 0.1 mM EDTA, 10 mM KCl, 1 × protease inhibitor, pH 7.9), left on ice for 10 min, vortexed, and centrifuged at 15,000 × g for 30 s. Pelleted nuclei were washed in 1 × PBS 3 times and gently resuspended in 50 μL of ice-cold saline buffer (50 mM HEPES/KOH, 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 10% glycerol, 1 × protease inhibitor, pH 7.9), left on ice for 2 h, vortexed, sonicated for 30 s, and centrifuged at 15,000 × g for 5 min at 4 °C. Aliquots of the supernatant that contained nuclear proteins were frozen in liquid nitrogen and stored at −70 °C. 2.9. Western blot analyses For immunodetection, cells were harvested and lysed in lysis buffer consisting of 20 mM Tris, 137 mM NaCl, 2 mM EDTA, 10% glycerol, 1% Triton X-100, protease inhibitors (Sigma-Aldrich Chemical Co., St. Louis, MO, USA), and Phosphatase Inhibitor Cocktail III (Millipore, Billerica, MA, USA). The protein lysates were separated by SDS–PAGE and electrophoretically transferred onto nitrocellulose membranes. Blots were blocked with 3% BSA (bovine serum albumin) in TBS and incubated with the appropriate primary antibody. Protein levels of Akt, ERK, JNK, NOS, ER-α, ER-β, and PR were assessed (Cell Signaling Technology, Danvers, MA, USA). After washing, the blots were incubated with anti-goat horseradish peroxidase-conjugated secondary antibodies for 1 h, and washed again. Immunodetection was carried out using an enhanced chemiluminescence peroxidase substrate solution (ELPIs Biotechnology, Daejeon, Korea). Blots were photographed using a LAS-3000 (FUJIFILM, Tokyo, Japan) chemiluminescence detection. The bands were quantified by using Alpha Ease FC (Genetic Technologies, Inc., Miami, FL, USA). Data are presented as ratios of each protein/β-actin intensity.

11

binding was by the addition of PBS containing 10% serum and Triton X-100 for 1 h at room temperature. Cells were exposed to rabbit antiER-α antibody overnight at 4 °C, washed 3 times in PBS-T, and incubated for 45 min at room temperature with a secondary antibody diluted in blocking buffer containing FITC-mouse anti-rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Cells were incubated in DAPI (1 μg/mL) staining solution for 5 min in the dark, washed in PBS-T, and mounted in anti-fade mounting solution (Invitrogen, Carlsbad, CA, USA). Imaging was performed on a flexible confocal microscope (Zeiss, Oberkochen, Germany). 2.11. Statistical analysis Data obtained from determination of ROS (FACS analysis), western blotting (densitometer), NO assay (absorbance), and quantitative PCR (Δ cycle threshold value) were repeated at least three independent experiments, and were expressed as mean ± SD. The statistical significance of the differences in mean values was tested using Student’s t-test. Significance was defined as a P-value