Veterinary Parasitology 205 (2014) 7–13
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay Alex A. Nakamura a , Camila G. Homem b , Adriana M.J. da Silva c , Marcelo V. Meireles b,∗ a b c
Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, FMVZ, USP, São Paulo, Brazil Faculdade de Medicina Veterinária, Univ Estadual Paulista, UNESP, Rua Clóvis Pestana, 793 Arac¸atuba, SP, CEP 16050-680, Brazil Divisão Técnica de Medicina Veterinária e Manejo da Fauna Silvestre (DEPAVE-3), Prefeitura do Município de São Paulo, SP, Brazil
a r t i c l e
i n f o
Article history: Received 30 April 2014 Received in revised form 30 July 2014 Accepted 31 July 2014 Keywords: Duplex real-time PCR Diagnosis Cryptosporidium galli Cryptosporidium avian genotype III Molecular detection
a b s t r a c t Three species and several genotypes of Cryptosporidium can infect the epithelial surface of the bursa of Fabricius, the respiratory tract, the proventriculus, the intestine, and the urinary tract in birds. There is reason to believe that gastric cryptosporidiosis in birds is caused by Cryptosporidium galli and Cryptosporidium avian genotype III, resulting in a chronic illness of the proventriculus that can lead to a debilitating and fatal clinical condition in birds of the orders Passeriformes and Psittaciformes. The objectives of the present study were to develop a duplex real-time polymerase chain reaction (PCR) that targets the 18S rRNA gene to simultaneously detect C. galli and Cryptosporidium avian genotype III DNA and to compare the duplex real-time PCR results to those of nested PCR targeting a partial fragment of the 18S rRNA gene, followed by sequencing of the amplified products (nPCR/S). A total of 1027 fecal samples were collected from birds of the orders Psittaciformes and Passeriformes originating either from captivity or the wild. Duplex real-time PCR results were positive in 580 (56.47%) and 21 (2.04%) samples, respectively, for C. galli and Cryptosporidium avian genotype III, whereas nPCR/S was positive in 28 (2.73%) and three (0.29%) samples, respectively, for C. galli and Cryptosporidium avian genotype III. Novel host birds were identified for both of the above gastric species, and it was also possible to identify Cryptosporidium baileyi and, for the first time in Brazil, Cryptosporidium avian genotype V. The duplex real-time PCR assay developed in the present study represents a sensitive and specific method for the detection of C. galli and Cryptosporidium avian genotype III in bird fecal samples. Moreover, this method may serve as an alternative to nPCR/S as a gold standard for the diagnosis of gastric cryptosporidiosis in birds. © 2014 Elsevier B.V. All rights reserved.
1. Introduction To date, three Cryptosporidium species have been classified in birds: Cryptosporidium meleagridis, Cryptosporidium baileyi and Cryptosporidium galli (Slavin, 1955; Current
∗ Corresponding author. Tel.: +55 1836361425; fax: +55 1836361403. E-mail addresses: [email protected], [email protected] (M.V. Meireles). http://dx.doi.org/10.1016/j.vetpar.2014.07.033 0304-4017/© 2014 Elsevier B.V. All rights reserved.
et al., 1986; Ryan et al., 2003; Ryan, 2010). Furthermore, several Cryptosporidium genotypes have been described in various bird species, including genotype I (Ng et al., 2006; Nakamura et al., 2009), genotype II (Santos et al., 2005; Meireles et al., 2006; Ng et al., 2006; Nakamura et al., 2009, Sevá et al., 2011; Nguyen et al., 2013), genotype III (Ng et al., 2006; Nakamura et al., 2009; Qi et al., 2011), genotype IV (Ng et al., 2006) and genotype V (Abe and Makino, 2010; Qi et al., 2011). Additional genotypes have also been identified in geese (Jellison et al.,
8
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
2004; Xiao et al., 2004; Zhou et al., 2004), black ducks and finches (Morgan et al., 2001). Infections with C. galli and Cryptosporidium avian genotype III occur in the proventriculus epithelium in birds of the orders Psittaciformes and Passeriformes (Pavlásek, 2001; Ryan et al., 2003; Makino et al., 2010). There is no evidence-based association between gastric cryptosporidiosis and the presence of clinical signs in birds. However, there is a reason to believe that gastric cryptosporidiosis in birds, either alone or in conjunction with other pathogens, could lead to morbidity and mortality (Blagburn et al., 1990; Morgan et al., 2001; Pavlásek, 2001; Antunes et al., 2008; Makino et al., 2010; Silva et al., 2010). The real-time polymerase chain reaction (PCR) method has proven to be a valuable tool for the diagnosis of Cryptosporidium (Yang et al., 2009; De Waele et al., 2011). As a result, some studies have developed methods for the detection of several Cryptosporidium species by real-time PCR, including Cryptosporidium spp., Cryptosporidium andersoni, Cryptosporidium hominis, Cryptosporidium parvum and the cluster formed by Cryptosporidium bovis, Cryptosporidium ryanae and Cryptosporidium xiaoi (Jothikumar et al., 2008; Yang et al., 2009; Hadfield et al., 2011; Homem et al., 2012; Burnet et al., 2012). However, no studies have sought to specifically detect gastric Cryptosporidium in birds. The objective of the present study was to develop a duplex real-time PCR assay targeting the 18S rRNA gene for the detection of C. galli and Cryptosporidium avian genotype III DNA in fecal samples using minor groove-binding (MGB) TaqMan® probes and to evaluate the diagnostic attributes of this method in comparison with nested PCR targeting the 18S rRNA gene followed by sequencing of amplified fragments (nPCR/S).
containing 12.5% chelex-100 (Bio-Rad, Hercules, USA), 1% polyvinylpirrolidone-K-90 (PVP) (USB, Cleveland, USA), 10 mM Tris and 10 mM EDTA plus 5 l of 10% sodium dodecyl sulfate. Samples were submitted to five freeze and thaw cycles in liquid nitrogen and a dry bath at 65 ◦ C and were then incubated with proteinase K and suspended in a buffer containing 6 M guanidine isothiocyanate (Invitrogen, Carlsbad, USA). DNA extraction was performed using guanidine isothiocyanate and silica (Sigma, St. Louis, USA). 2.2. Nested PCR and sequencing of the amplified fragments Nested PCR was used for the amplification of a partial fragment of the 18S rRNA gene of Cryptosporidium spp. (Xiao et al., 1999, 2000). The primers P1: 5 -TTC TAG AGC TAA TAC ATG CG-3 , P2: 5 -CCC ATT TCC TTC GAA ACA GGA-3 and P3: 5 -GGA AGG GTT GTA TTT ATT AGA TAAAG-3 , P4: 5 -AAG GAG TAA GGA ACA ACC TCC A-3 were used for the primary (∼1325 bp) and secondary reactions (∼820 bp), respectively. DNA samples visualized by means of 1.5% agarose gel electrophoresis were purified with the QIAquick® Gel Extraction Kit (Qiagen GmbH, Hilden, Germany) and sequenced with the ABI PRISM® Dye Terminator 3.1 Kit in an ABI 3730XL automated sequencer (Applied Biosystems, Foster City, USA). Consensus sequences were analyzed using CodonCode Aligner v. 4.2.7 (CodonCode Corporation, Dedham, USA) and were aligned with reference Cryptosporidium sequences published in GenBank (http://www.ncbi.mln. nih.gov/Genbank/index.html) using Clustal W software (Thompson et al., 1997) and Bioedit Sequence Alignment Editor (Hall, 1999).
2. Materials and methods
2.3. Molecular cloning
2.1. Fecal samples and DNA extraction
Molecular cloning was performed to obtain sufficient amounts of target DNA for standardization of the standard regression curve in the duplex real-time PCR assay. DNA fragments corresponding to partial sequences of the C. galli and Cryptosporidium avian genotype III 18S rRNA gene amplified by nested PCR (Xiao et al., 1999, 2000) were cloned with the TransformAid Bacterial Transformation Kit (Thermo Fisher Scientific, Waltham, USA) and the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Waltham, USA). Plasmid DNA was purified with the GenElute® HP FiveMinute Plasmid Miniprep Kit (Sigma–Aldrich, St. Louis, USA).
A total of 1027 fecal samples were collected from birds of the orders Psittaciformes and Passeriformes from the Technical Division of Veterinary Medicine and Wild Fauna Management (Divisão Técnica de Medicina Veterinária e Manejo da Fauna Silvestre – DEPAVE-3) of the São Paulo Municipal Government in Brazil (Supplementary Table S1). The birds originated from either captivity or the wild and were kept in individual cages in three enclosures. It was not possible to accomplish a detailed physical evaluation; however, during routine management, the birds did not present any obvious clinical signs. Supplementary Table S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.vetpar.2014.07.033. Samples were collected in plastic 50-mL Falcon tubes, stored at 4 ◦ C in 5% potassium dichromate and submitted to oocyst purification by means of centrifugal flotation in Sheather’s solution (Current, 1990). The extraction of genomic DNA from Cryptosporidium was performed in accordance with the protocol described by Silva et al. (2010). Briefly, sediment from the purification process was suspended in 300 l of lysis buffer
2.4. Duplex real-time PCR Partial C. galli and Cryptosporidium avian genotype III gene sequences were aligned using sequences belonging to other Cryptosporidium species and genotypes available at GenBank using the Bioedit software to design the primer and MGB probe sequences (Table 1) with Primer Express® Software, version 3.0 (Applied Biosystems, Foster City, USA). The in situ analytical specificity of the primers and probes were then assessed at http://www.ncbi.nlm.nih.gov/tools/primer-blast/.
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
9
Table 1 Primers and probes used for duplex real-time PCR targeting the 18S rRNA gene in Cryptosporidium galli and Cryptosporidium avian genotype III. Species/genotype
Primers/probes
Positiona
Sequence 5 –3
Amplified product (bp)
C. galli
Sense primer Probe Antisense primer
282–305 327–348 396–415
CGTAGTTGGATTTCTGTTGCATCA FAM AATATAATATCAACATCCTCCC MGB GGCAGTTGCCTGCTTTAAGC
134
Cryptosporidium avian genotype III
Sense primer Probe Antisense primer
366–391 413–435 485–504
GCTCGTAGTTGGATTTCTGTTGTATT VIC CATTATAATAACAACATCCTTCC MGB GGCAGTTGCCTGCTTTAAGC
138
a
Annealing position in the 18S rRNA gene of C. galli (AY168847) and Cryptosporidium avian genotype III (AB471641).
The efficiency of duplex real-time PCR was confirmed by means of standardization with a standard regression curve using plasmids corresponding to the 18S rRNA gene of both targets, which were previously digested and linearized with the HindIII restriction enzyme (Thermo Fisher Scientific, Waltham, USA) and purified with the QIAquick® Gel Extraction Kit (Qiagen, Hilden, Germany). Plasmid DNA was quantified using a Nanodrop® ND-1000 spectrophotometer and diluted to concentrations between 107 and 101 DNA molecules to establish the regression curve (Applied Biosystems, n.d.). Each dilution was tested in triplicate. The annealing temperature and ideal MgCl2 , primer, probe and non-acetylated bovine serum albumin (BSA; Sigma–Aldrich, St. Louis, USA) concentrations were determined. The reaction was composed of 12.5 L of JumpStart® Taq ReadyMix® (Sigma–Aldrich, St. Louis, USA), 4.5 mM MgCl2 , 250 nM of each probe, 600 nM of each primer, 0.6 g/L BSA and 5 L target DNA, for a final volume of 25 L. The amplification cycle consisted of 2 min at 94 ◦ C followed by 50 cycles of 30 s at 94 ◦ C and 1 min at 61 ◦ C and was performed using a CFX96 real-time PCR system (Bio-Rad, Hercules, USA). Negative (no template) controls were included in each PCR run. One positive control was included in every run to confirm consistent amplification. 2.5. Evaluation of the duplex real-time PCR specificity Polyacrylamide gel electrophoresis was performed to check the sizes of the amplified fragments. Molecular cloning of the duplex real-time PCR fragments was performed to identify the amplified products by means of plasmid sequencing and to rule out false positive results, as described in Section 2.3. Samples from 23 birds were cloned after selecting samples with threshold cycle (Ct) values between 35 and 40, or samples that were either positive for both targets or positive for one of the targets by duplex real-time PCR but negative by nested PCR. Up to five clones were selected from each sample, thus increasing the probability of confirming the specificity of the duplex real-time PCR results. Consensus sequences analysis was performed as described in Section 2.2. For the evaluation of analytical specificity, genomic DNA samples of C. andersoni, C. baileyi, C. bovis, Cryptosporidium canis, C. galli, C. ryanae, Cryptosporidium serpentis and Cryptosporidium avian genotypes I–III, which were previously identified and stored at the Faculty of Veterinary Medicine at University of São Paulo State (UNESP), Arac¸atuba Campus, were tested in triplicate by duplex real-time PCR.
2.6. Nucleotide sequence accession numbers The nucleotide sequence of Cryptosporidium avian genotype V was submitted to GenBank under the accession no. KJ487974. The sequences of the other Cryptosporidium species and genotypes identified in the present study were 100% genetic matches with sequences from isolates of birds from Brazil, published at GenBank under the accession nos. GQ227476, GQ227480, GQ227481, DQ002931, EU543270, GU816051, and GU816054. 3. Results The standard regression curve obtained after standardization of the duplex real-time PCR exhibited the following values: e = 97.3%, R2 = 0.99 and a slope of −3.38 for C. galli and e = 94.3%, R2 = 0.99 and a slope of −3.46 for Cryptosporidium avian genotype III (Fig. 1). Nested PCR was positive for Cryptosporidium spp. in 108 out of 1027 samples (10.52%; 95% confidence interval [CI]: 8.75–12.51%). The sequencing of the fragments from the amplification by nested PCR was possible in 40 samples and allowed for the identification of C. baileyi (8/1027; 0.78%), C. galli (28/1027; 2.73%), Cryptosporidium avian genotype III (3/1027; 0.29%) and Cryptosporidium avian genotype V (1/1027; 0.08%) (Supplementary Table S1). With respect to duplex real-time PCR, 580 out of 1027 samples (56.47%; 95% CI: 53.4–59.5%) were positive for C. galli, whereas 21 of 1027 samples (2.04%; 95% CI: 1.3–3.1%) were positive for Cryptosporidium avian genotype III. Several diagnostic situations were observed in the analysis of the duplex real-time PCR and nested PCR for the 1027 fecal samples (Table 2, Supplementary Table S1). The average, Table 2 Detection of Cryptosporidium spp. and C. galli/Cryptosporidium avian genotype III DNA in avian fecal samples using nested PCR and duplex real-time PCR, respectively. Nested PCR (Cryptosporidium spp.)
Duplex real-time PCR C. galli
Cryptosporidium avian genotype III
− − + + − + + −
+ − + − + + − −
− + − + + + − −
Total (%)
496 (48.30) 6 (0.58) 70 (6.82) 1 (0.10) 13 (1.27) 1 (0.10) 36 (3.50) 404 (39.34) 1027(100)
10
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
Fig. 1. Standardization of the duplex real-time PCR assay targeting the 18S gene of C. galli and Cryptosporidium avian genotype III. Standard regression curves for C. galli (FAM) and Cryptosporidium avian genotype III (VIC) obtained with the specific TaqMan assays.
standard deviation, and the minimum and maximum Ct values observed in the duplex real-time PCR assay were, respectively, 33.71 (±4.79), 26.65 and 39.91 for C. galli and 37.12 (±3.64), 29.47 and 39.88 for Cryptosporidium avian genotype III. The specificity of the duplex real-time PCR was assessed by polyacrylamide gel electrophoresis and molecular cloning and sequencing of the amplified fragments. The
sizes of the amplified fragments corresponded to those expected for C. galli (134 bp) and avian genotype III (138 bp). Cloning and sequencing samples from 23 birds confirmed the assay specificity for C. galli and Cryptosporidium avian genotype III (Table 3). Among all Cryptosporidium DNA samples tested for the evaluation of analytical specificity of the duplex real-time PCR, C. serpentis DNA also was amplified by primers and
Table 3 Identification of the Cryptosporidium species or genotype in samples that were positive by duplex real-time PCR, using molecular cloning and plasmids sequencing. Comparison with the detection and identification using nested PCR and sequencing of the nested PCR fragments, respectively. Avian species
Duplex real-time PCR (C. galli)
Duplex real-time PCR (Cryptosporidium avian genotype III)
Duplex real-time PCR/plasmids sequencing
Nested PCR (Cryptosporidium spp.)
Nested PCR/sequencing
Amazona aestiva Amazona vinacea Brotogeris tirica Brotogeris tirica Gnorimopsar chopi Nymphicus hollandicus Nymphicus hollandicus Nymphicus hollandicus Nymphicus hollandicus Paroaria coronata Saltator similis Saltator similis Saltator similis Sporophila sp. Sporophila sp. Sporophila sp.
+ + + + + + − − − + − + + + + +
+ − − − − − + + + + + + − − − +
− + − − + + − − + − − + + + + −
− nra − − C. galli C. galli − − nr − − nr C. galli C. galli C. galli −
Sporophila caerulescens Sporophila caerulescens
+ +
− +
+ −
C. galli −
Serinus canarius Serinus canarius
+ +
+ +
− −
− −
Sicalis flaveola Zonotrichia capensis
+ +
− +
+ −
C. galli −
Zonotrichia capensis
+
−
Avian genotype III C. galli C. galli C. galli C. galli C. galli Avian genotype III Avian genotype III Avian genotype III C. galli Avian genotype III C. galli C. galli C. galli C. galli C. galli Avian genotype III C. galli C. galli Avian genotype III Avian genotype III C. galli Avian genotype III C. galli C. galli Avian genotype III C. galli
+
C. galli
a
Samples not sequenced.
Table 4 Alignment of the primers and probes specific for the 18S rRNA gene of Cryptosporidium galli and Cryptosporidium avian genotype IIIa with sequences from species that commonly1 or rarely2 infect birds as well as Cryptosporidium sequences that are genetically more related to both targets3 .
Species or Cryptosporidium genotypes
C. galli Avian genotype III Avian genotype IV2,3 Woodcock genotype2,3 C. serpentis3 C. muris3 C. andersoni3 C. baileyi1 Avian genotype I1 Avian genotype II1 Avian genotype V2 C. meleagridis1 C. parvum3 a
Sequences Alignment
GU734647 DQ650343 DQ650344 AY273769 AF093502 AF093498 EU245042 AJ276096 GQ227479 DQ002931 HM116381 AF180339 AF093490
365 375 384 393 403 412 419 429 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGCTCGTAGTTGGATTTCTGTTG-CATCAT-TATATTATCACTAAGGTAA-TAAT---ATAATATCAACATCCTCCCTGT .......................-T..TT.-....A...T..........-C.T.---......A.........T..CAA .......................-T.....-...........C.......-....---...............CT...A. .......................-T.CTT.--...A..CT..C.......-..T.---.....GA.........T..CAC .......................-T..TT.-....A...T.T........-..T.T--................T...A. .......................-T..A..C....A...T.........TA..T.---...T............T...A. .......................-T..A..T....A...T..C.......T..T.---...T............T...A. ......................AAT.-.T.A....-C.AT..C.C...----.T.TAT....C..T.....AA.T.ACA. ......................AAT.-.T.A....-..AT....C...----.T.TAT....C..T.....AA.T.ACA. ......................AATT-.T.A....-..GT....C...----.T.TAT....C..T.....AA.T.A.A. ......................AATT-.T.A....-..AT....C...----.T.TAT....C..T.....AA.T.A.A. ......................AAT.ATT.A....-..AT.T.T-.A.T.A..T.TAT.......T.....AA.T.A.A. ......................AAT.ATT.A....-A.AT.T.TT.A.G.A..T.TAT.......T.....AA.T.A.A.
GU734647 DQ650343 DQ650344 AY273769 AF093502 AF093498 EU245042 AJ276096 GQ227479 DQ002931 HM116381 AF180339 AF093490
437 443 453 463 473 483 493 503 .....|...|....|....|....|....|....|....|....|....|....|....|....|....|....|.... TA---TATCT---AATATAGAGGGAATTTTACTTTGAGAAAATTAGAGTGCTTAAAGCAGGCAACTGCCTTGAATACTC ..---...T.TTT......TG..A....................................................... ..---...T.---......T...A....................................................... ..---...T.TTT......TG..A....................................................... ..---...T.TT-......T...A....................................................... ..---...T.CTA......T...A..C.................................................... ..---...T-CTA......T...A....................................................... ..CT-...T.AA-.G...GT--.A..C...................................T.T.............. ..CT-...T.TA-.G...GT--.A......................................T.T.............. ..CT-...T.AA-.G....T--.A......................................T.T.............. ..CT-...T.AA-.G....T--.A......................................T.T.............. ..CTAA..T.ATT.G....T--.A.......................................TA.............. ..CTA...A.TTT.G....T--.A.......................................TA..............
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
C. galli Avian genotype III Avian genotype IV2 Woodcock genotype2 C. serpentis3 C. muris3 C. andersoni3 C. baileyi1 Avian genotype I1 Avian genotype II1 Avian genotype V2 C. meleagridis1 C. parvum3
Sequences Identification in GenBank
Sense and anti-sense primers and probe for Cryptosporidium avian genotype III anneal, respectively, at 162–187, 281–300 and 209–230 positions in the DQ650343 sequence.
11
12
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
probe for Cryptosporidium avian genotype III. However, the amplification curve always presented a flattened shape and a Ct near 40. The results of the duplex real-time PCR and nPCR/S allowed for the identification of 59 novel host birds for C. galli and 15 for Cryptosporidium avian genotype III (Supplementary Table S1). 4. Discussion Most samples were obtained from adult birds. In contrast to other avian Cryptosporidium species, age is not a limiting factor for the occurrence of infection by C. galli and possibly by Cryptosporidium avian genotype III. C. galli is associated with chronic infections in adult birds, with prolonged oocyst shedding (Silva et al., 2010). Cryptosporidium avian genotype III exhibits a low occurrence in birds (Ng et al., 2006; Nakamura et al., 2009; Sevá et al., 2011; Qi et al., 2011) but has been cited as a possible cause for chronic gastric illness in birds (Makino et al., 2010). The different rates of positivity for C. galli between nPCR/S and duplex real-time PCR may occur because realtime PCR normally exhibits a higher sensitivity than nested PCR (De Waele et al., 2011; Yang et al., 2009; Homem et al., 2012). A significant portion of the positive samples exhibited Ct values between 35 and 39, most likely due to the small amounts of oocysts in the samples, which is common in infections with C. galli (Antunes et al., 2008; Nakamura et al., 2009). Furthermore, sequencing of 40 out of 108 samples that were positive by nested PCR resulted in the identification of 70% (28/40) as C. galli, suggesting that most nested PCR positive birds would be C. galli positive. Cryptosporidium galli is the most frequently detected species in Passeriformes (Ng et al., 2006; Nakamura et al., 2009; Silva et al., 2010; Sevá et al., 2011; Qi et al., 2011). In this study, fecal samples were collected from birds kept in the same environment, with cages closely disposed side by side. The proximity between birds, coupled with chronic and intermittent C. galli oocyst shedding (Silva et al., 2010), could result in the spread of infection by means of direct contact with feces or human carriage of oocysts during routine management related to cleaning, food and drinking water. As a result, these infections may have been detected, even at low levels, by a highly sensitive diagnostic technique, such as real-time PCR. The analytical specificity for Cryptosporidium avian genotype III revealed the amplification of C. serpentis DNA, with an atypical amplification curve, which was most likely due to a polymorphism in the annealing region of the probe for genomic C. serpentis DNA (Table 4). Similarly, Hadfield et al. (2011) observed the amplification of Cryptosporidium horse genotype using primers and a TaqMan MGB probe specific for C. parvum. In our study, the only way to confirm the specificity of the duplex real-time PCR for C. galli and Cryptosporidium avian genotype III was molecular cloning and sequencing of the amplified fragments, which revealed that the amplified sequences corresponded to the targets in question. The observed positivity of 10.52% of the fecal samples (108/1027) for Cryptosporidium spp. by nested PCR was greater than that observed in previous studies; for
example, studies in Brazil reported rates of 4.86% (47/966) (Nakamura et al., 2009) and 6.6% (16/242) (Sevá et al., 2011), and studies in Australia and China reported rates of 6.3% (27/430) (Ng et al., 2006) and 8.1% (35/434) (Qi et al., 2011), respectively. Furthermore, novel host birds were identified for C. galli and Cryptosporidium avian genotype III in the present study. Cryptosporidium avian genotype V was detected in Amazona aestiva and was previously described in Nymphicus hollandicus in China and Japan (Abe and Makino, 2010; Qi et al., 2011). In conclusion, in this study, a sensitive and specific method was developed for the detection of C. galli and Cryptosporidium avian genotype III in bird fecal samples. Moreover, this method may serve as an alternative to nPCR/S as a gold standard for the diagnosis of gastric cryptosporidiosis in birds. Conflict of interest statement The authors have no conflicts of interest to declare. Acknowledgments We would like to thank theSão Paulo Research Foundation (Fundac¸ão de Amparo à Pesquisa do Estado de São Paulo – FAPESP) for financial support (2009/51595-9) and for a doctoral scholarship to A.A. Nakamura (2009/515965). References Abe, N., Makino, I., 2010. Multilocus genotypic analysis of Cryptosporidium isolates from cockatiels in Japan. Parasitol. Res. 106, 14916–21497. Antunes, R.G., Simões, D.C., Nakamura, A.A., Meireles, M.V., 2008. Natural infection with Cryptosporidium galli in canaries (Serinus canaria), in a cockatiel (Nymphicus hollandicus) and in lesser seed-finches (Oryzoborus angolensis) from Brazil. Avian Dis. 52, 7026–7705. Applied Biosystems, n.d. Creating standard curves with genomic DNA or plasmid DNA templates for use in quantitative PCR. [Online]. Available: http://www6.appliedbiosystems.com/support/ tutorials/pdf/quant pcr.pdf (accessed 17.07.14). Blagburn, B.L., Lindsay, D.S., Hoerr, F.J., Atlas, A.L., Toiviokinnucan, M., 1990. Cryptosporidium sp. infection in the proventriculus of an Australian diamond firetail finch (Staganoplura bella Passeriformes, Estrildidae). Avian Dis. 34, 1027–1030. Burnet, J.B., Ogorzaly, L., Tissier, A., Penny, C., Cauchie, H.M., 2012. Novel quantitative TaqMan real-time PCR assays for detection of Cryptosporidium at the genus level and genotyping of major human and cattle-infecting species. J. Appl. Microbiol. 114, 12116–21222. Current, W.L., 1990. Techniques and laboratory maintenance of Cryptosporidium. In: Dubey, J.P., Speer, C.A., Fayer, R. (Eds.), Cryptosporidiosis of Man and Animals. CRC Press, Boca Raton, pp. 59–82. Current, W.L., Upton, S.J., Haynes, T.B., 1986. The life cycle of Cryptosporidium baileyi n. sp. (Apicomplexa, Cryptosporidiidae) in infected chickens. J. Protozool. 33, 2896–3296. De Waele, V., Berzano, M., Berkvens, D., Speybroeck, N., Lowery, C., Mulcahy, G.M., Murphy, T.M., 2011. Age-stratified Bayesian analysis estimating the sensitivity and specificity of four diagnostic tests for the detection of Cryptosporidium oocysts in neonatal calves. J. Clin. Microbiol. 49, 76–89. Hadfield, S.J., Robinson, G., Elwin, K., Chalmers, R.M., 2011. Detection and differentiation of Cryptosporidium spp. in human clinical samples using real-time PCR. J. Clin. Microbiol. 49, 9186–9924. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 956–998. Homem, C.G., Nakamura, A.A., Silva, D.C., Teixeira, W.F., Coelho, W.M., Meireles, M.V., 2012. Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples. Parasitol. Res. 110, 17416–21745.
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13 Jellison, K.L., Distel, D.L., Hemond, H.F., Schauer, D.B., 2004. Phylogenetic analyses of the hypervariable region of the 18s rRNA gene of Cryptosporidium oocysts in the feces of Canada Geese (Branta canadensis): evidence for five novel genotypes. Appl. Environ. Microbiol. 70, 4526–5458. Jothikumar, N., Da Silva, A.J., Moura, I., Qvarnstrom, Y., Hill, V.R., 2008. Detection and differentiation of Cryptosporidium hominis and Cryptosporidium parvum by dual TaqMan assays. J. Med. Microbiol. 57, 10996–11105. Makino, I., Abe, N., Reavill, D.R., 2010. Cryptosporidium avian genotype III as a possible causative agent of chronic vomiting in peach-faced lovebirds (Agapornis roseicollis). Avian Dis. 54, 11026–11107. Meireles, M.V., Soares, R.M., Santos, M.M.A.B., Gennari, S.M., 2006. Biological studies and molecular characterization of a Cryptosporidium isolate from ostrich (Struthio camelus). J. Parasitol. 92, 6236–6626. Morgan, U.M., Monis, P.T., Xiao, L., Limor, J., Sulaiman, I., Raidal, S., O’Donoghue, P., Gasser, R., Murray, A., Fayer, R., Blagburn, B.L., Lal, A.A., Thompson, R.C.A., 2001. Molecular and phylogenetic characterization of Cryptosporidium from birds. Int. J. Parasitol. 31, 2896–3296. Nakamura, A.A., Simões, D.C., Antunes, R.G., Da Silva, D.C., Meireles, M.V., 2009. Molecular characterization of Cryptosporidium spp. from fecal samples of birds kept in captivity in Brazil. Vet. Parasitol. 166, 476–551. Ng, J., Pavlasek, I., Ryan, U., 2006. Identification of novel Cryptosporidium genotypes from avian hosts. Appl. Environ. Microbiol. 72, 75486–77553. Nguyen, S.T., Fukuda, Y., Tada, C., Huynh, V.V., Nguyen, D.T., Nakai, Y., 2013. Prevalence and molecular characterization of Cryptosporidium in ostriches (Struthio camelus) on a farm in central Vietnam. Exp. Parasitol. 133, 8–11. Pavlásek, I., 2001. Findings of Cryptosporidia in the stomach of chickens and of exotic and wild birds. Veterinarstvi 51, 103–108. Qi, M., Wang, R., Ning, C., Li, X., Zhang, L., Jian, F., Sun, Y., Xiao, L., 2011. Cryptosporidium spp. in pet birds: genetic diversity and potential public health significance. Exp. Parasitol. 128, 3366–4340. Ryan, U.M., 2010. Cryptosporidium in birds, fish and amphibians. Exp. Parasitol. 124, 113–120.
13
Ryan, U.M., Xiao, L., Read, C., Sulaiman, M., Monis, P., Lal, A.A., Fayer, R., Pavlasek, I., 2003. A redescription of Cryptosporidium galli Pavlasek, 1999 (Apicomplexa: Cryptosporidiidae) in birds. J. Parasitol. 89, 8096–8813. Santos, M.M.A.B., Peiró, J.R., Meireles, M.V., 2005. Cryptosporidium infection in ostriches (Struthio camelus) in Brazil: clinical, morphological and molecular studies. Braz. J. Poultry Sci. 7, 1136–2117. Sevá, A.P., Funada, M.R., Richtzenhain, L.J., Guimarães, M.B., Souza, S.O., Allegretti, L., Sinhorini, J.A., Duarte, V.V., Soares, R.M., 2011. Genotyping of Cryptosporidium spp. from free-living wild birds in Brazil. Vet. Parasitol. 175, 276–332. Silva, D.C., Homem, C.G., Nakamura, A.A., Teixeira, W.F., Perri, S.H., Meireles, M.V., 2010. Physical, epidemiological, and molecular evaluation of infection by Cryptosporidium galli in Passeriformes. Parasitol. Res. 107, 2716–3277. Slavin, D., 1955. Cryptosporidium meleagridis (sp. nov.). J. Comp. Pathol. 65, 262–266. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality tools. Nucleic Acids Res. 24, 48766–54882. Xiao, L., Escalante, L., Yang, C., Sulaiman, I., Escalante, A.A., Montali, R.J., Fayer, R., Lal, A.A., 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl. Environ. Microbiol. 65, 1578–1583. Xiao, L., Alderisio, K., Limor, J., Royer, M., Lal, A.A., 2000. Identification of species and sources of Cryptosporidium oocysts in storm waters using a small-subunit rRNA-based diagnostic and genotyping tool. Appl. Environ. Microbiol. 66, 54926–55498. Xiao, L., Fayer, R., Ryan, U., Upton, S.J., 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin. Microbiol. Rev. 17, 726–797. Yang, R., Jacobson, C., Gordon, C., Ryan, U., 2009. Prevalence and molecular characterization of Cryptosporidium and Giardia species in preweaned sheep in Australia. Vet. Parasitol. 161, 196–224. Zhou, L., Kassa, H., Tischler, M.L., Xiao, L., 2004. Host-Adapted Cryptosporidium spp. in Canada Geese (Branta canadensis). Appl. Environ. Microbiol. 70, 4211–4215.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay Alex A. Nakamura a , Camila G. Homem b , Adriana M.J. da Silva c , Marcelo V. Meireles b,∗ a b c
Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, FMVZ, USP, São Paulo, Brazil Faculdade de Medicina Veterinária, Univ Estadual Paulista, UNESP, Rua Clóvis Pestana, 793 Arac¸atuba, SP, CEP 16050-680, Brazil Divisão Técnica de Medicina Veterinária e Manejo da Fauna Silvestre (DEPAVE-3), Prefeitura do Município de São Paulo, SP, Brazil
a r t i c l e
i n f o
Article history: Received 30 April 2014 Received in revised form 30 July 2014 Accepted 31 July 2014 Keywords: Duplex real-time PCR Diagnosis Cryptosporidium galli Cryptosporidium avian genotype III Molecular detection
a b s t r a c t Three species and several genotypes of Cryptosporidium can infect the epithelial surface of the bursa of Fabricius, the respiratory tract, the proventriculus, the intestine, and the urinary tract in birds. There is reason to believe that gastric cryptosporidiosis in birds is caused by Cryptosporidium galli and Cryptosporidium avian genotype III, resulting in a chronic illness of the proventriculus that can lead to a debilitating and fatal clinical condition in birds of the orders Passeriformes and Psittaciformes. The objectives of the present study were to develop a duplex real-time polymerase chain reaction (PCR) that targets the 18S rRNA gene to simultaneously detect C. galli and Cryptosporidium avian genotype III DNA and to compare the duplex real-time PCR results to those of nested PCR targeting a partial fragment of the 18S rRNA gene, followed by sequencing of the amplified products (nPCR/S). A total of 1027 fecal samples were collected from birds of the orders Psittaciformes and Passeriformes originating either from captivity or the wild. Duplex real-time PCR results were positive in 580 (56.47%) and 21 (2.04%) samples, respectively, for C. galli and Cryptosporidium avian genotype III, whereas nPCR/S was positive in 28 (2.73%) and three (0.29%) samples, respectively, for C. galli and Cryptosporidium avian genotype III. Novel host birds were identified for both of the above gastric species, and it was also possible to identify Cryptosporidium baileyi and, for the first time in Brazil, Cryptosporidium avian genotype V. The duplex real-time PCR assay developed in the present study represents a sensitive and specific method for the detection of C. galli and Cryptosporidium avian genotype III in bird fecal samples. Moreover, this method may serve as an alternative to nPCR/S as a gold standard for the diagnosis of gastric cryptosporidiosis in birds. © 2014 Elsevier B.V. All rights reserved.
1. Introduction To date, three Cryptosporidium species have been classified in birds: Cryptosporidium meleagridis, Cryptosporidium baileyi and Cryptosporidium galli (Slavin, 1955; Current
∗ Corresponding author. Tel.: +55 1836361425; fax: +55 1836361403. E-mail addresses: [email protected], [email protected] (M.V. Meireles). http://dx.doi.org/10.1016/j.vetpar.2014.07.033 0304-4017/© 2014 Elsevier B.V. All rights reserved.
et al., 1986; Ryan et al., 2003; Ryan, 2010). Furthermore, several Cryptosporidium genotypes have been described in various bird species, including genotype I (Ng et al., 2006; Nakamura et al., 2009), genotype II (Santos et al., 2005; Meireles et al., 2006; Ng et al., 2006; Nakamura et al., 2009, Sevá et al., 2011; Nguyen et al., 2013), genotype III (Ng et al., 2006; Nakamura et al., 2009; Qi et al., 2011), genotype IV (Ng et al., 2006) and genotype V (Abe and Makino, 2010; Qi et al., 2011). Additional genotypes have also been identified in geese (Jellison et al.,
8
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
2004; Xiao et al., 2004; Zhou et al., 2004), black ducks and finches (Morgan et al., 2001). Infections with C. galli and Cryptosporidium avian genotype III occur in the proventriculus epithelium in birds of the orders Psittaciformes and Passeriformes (Pavlásek, 2001; Ryan et al., 2003; Makino et al., 2010). There is no evidence-based association between gastric cryptosporidiosis and the presence of clinical signs in birds. However, there is a reason to believe that gastric cryptosporidiosis in birds, either alone or in conjunction with other pathogens, could lead to morbidity and mortality (Blagburn et al., 1990; Morgan et al., 2001; Pavlásek, 2001; Antunes et al., 2008; Makino et al., 2010; Silva et al., 2010). The real-time polymerase chain reaction (PCR) method has proven to be a valuable tool for the diagnosis of Cryptosporidium (Yang et al., 2009; De Waele et al., 2011). As a result, some studies have developed methods for the detection of several Cryptosporidium species by real-time PCR, including Cryptosporidium spp., Cryptosporidium andersoni, Cryptosporidium hominis, Cryptosporidium parvum and the cluster formed by Cryptosporidium bovis, Cryptosporidium ryanae and Cryptosporidium xiaoi (Jothikumar et al., 2008; Yang et al., 2009; Hadfield et al., 2011; Homem et al., 2012; Burnet et al., 2012). However, no studies have sought to specifically detect gastric Cryptosporidium in birds. The objective of the present study was to develop a duplex real-time PCR assay targeting the 18S rRNA gene for the detection of C. galli and Cryptosporidium avian genotype III DNA in fecal samples using minor groove-binding (MGB) TaqMan® probes and to evaluate the diagnostic attributes of this method in comparison with nested PCR targeting the 18S rRNA gene followed by sequencing of amplified fragments (nPCR/S).
containing 12.5% chelex-100 (Bio-Rad, Hercules, USA), 1% polyvinylpirrolidone-K-90 (PVP) (USB, Cleveland, USA), 10 mM Tris and 10 mM EDTA plus 5 l of 10% sodium dodecyl sulfate. Samples were submitted to five freeze and thaw cycles in liquid nitrogen and a dry bath at 65 ◦ C and were then incubated with proteinase K and suspended in a buffer containing 6 M guanidine isothiocyanate (Invitrogen, Carlsbad, USA). DNA extraction was performed using guanidine isothiocyanate and silica (Sigma, St. Louis, USA). 2.2. Nested PCR and sequencing of the amplified fragments Nested PCR was used for the amplification of a partial fragment of the 18S rRNA gene of Cryptosporidium spp. (Xiao et al., 1999, 2000). The primers P1: 5 -TTC TAG AGC TAA TAC ATG CG-3 , P2: 5 -CCC ATT TCC TTC GAA ACA GGA-3 and P3: 5 -GGA AGG GTT GTA TTT ATT AGA TAAAG-3 , P4: 5 -AAG GAG TAA GGA ACA ACC TCC A-3 were used for the primary (∼1325 bp) and secondary reactions (∼820 bp), respectively. DNA samples visualized by means of 1.5% agarose gel electrophoresis were purified with the QIAquick® Gel Extraction Kit (Qiagen GmbH, Hilden, Germany) and sequenced with the ABI PRISM® Dye Terminator 3.1 Kit in an ABI 3730XL automated sequencer (Applied Biosystems, Foster City, USA). Consensus sequences were analyzed using CodonCode Aligner v. 4.2.7 (CodonCode Corporation, Dedham, USA) and were aligned with reference Cryptosporidium sequences published in GenBank (http://www.ncbi.mln. nih.gov/Genbank/index.html) using Clustal W software (Thompson et al., 1997) and Bioedit Sequence Alignment Editor (Hall, 1999).
2. Materials and methods
2.3. Molecular cloning
2.1. Fecal samples and DNA extraction
Molecular cloning was performed to obtain sufficient amounts of target DNA for standardization of the standard regression curve in the duplex real-time PCR assay. DNA fragments corresponding to partial sequences of the C. galli and Cryptosporidium avian genotype III 18S rRNA gene amplified by nested PCR (Xiao et al., 1999, 2000) were cloned with the TransformAid Bacterial Transformation Kit (Thermo Fisher Scientific, Waltham, USA) and the CloneJET PCR Cloning Kit (Thermo Fisher Scientific, Waltham, USA). Plasmid DNA was purified with the GenElute® HP FiveMinute Plasmid Miniprep Kit (Sigma–Aldrich, St. Louis, USA).
A total of 1027 fecal samples were collected from birds of the orders Psittaciformes and Passeriformes from the Technical Division of Veterinary Medicine and Wild Fauna Management (Divisão Técnica de Medicina Veterinária e Manejo da Fauna Silvestre – DEPAVE-3) of the São Paulo Municipal Government in Brazil (Supplementary Table S1). The birds originated from either captivity or the wild and were kept in individual cages in three enclosures. It was not possible to accomplish a detailed physical evaluation; however, during routine management, the birds did not present any obvious clinical signs. Supplementary Table S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.vetpar.2014.07.033. Samples were collected in plastic 50-mL Falcon tubes, stored at 4 ◦ C in 5% potassium dichromate and submitted to oocyst purification by means of centrifugal flotation in Sheather’s solution (Current, 1990). The extraction of genomic DNA from Cryptosporidium was performed in accordance with the protocol described by Silva et al. (2010). Briefly, sediment from the purification process was suspended in 300 l of lysis buffer
2.4. Duplex real-time PCR Partial C. galli and Cryptosporidium avian genotype III gene sequences were aligned using sequences belonging to other Cryptosporidium species and genotypes available at GenBank using the Bioedit software to design the primer and MGB probe sequences (Table 1) with Primer Express® Software, version 3.0 (Applied Biosystems, Foster City, USA). The in situ analytical specificity of the primers and probes were then assessed at http://www.ncbi.nlm.nih.gov/tools/primer-blast/.
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
9
Table 1 Primers and probes used for duplex real-time PCR targeting the 18S rRNA gene in Cryptosporidium galli and Cryptosporidium avian genotype III. Species/genotype
Primers/probes
Positiona
Sequence 5 –3
Amplified product (bp)
C. galli
Sense primer Probe Antisense primer
282–305 327–348 396–415
CGTAGTTGGATTTCTGTTGCATCA FAM AATATAATATCAACATCCTCCC MGB GGCAGTTGCCTGCTTTAAGC
134
Cryptosporidium avian genotype III
Sense primer Probe Antisense primer
366–391 413–435 485–504
GCTCGTAGTTGGATTTCTGTTGTATT VIC CATTATAATAACAACATCCTTCC MGB GGCAGTTGCCTGCTTTAAGC
138
a
Annealing position in the 18S rRNA gene of C. galli (AY168847) and Cryptosporidium avian genotype III (AB471641).
The efficiency of duplex real-time PCR was confirmed by means of standardization with a standard regression curve using plasmids corresponding to the 18S rRNA gene of both targets, which were previously digested and linearized with the HindIII restriction enzyme (Thermo Fisher Scientific, Waltham, USA) and purified with the QIAquick® Gel Extraction Kit (Qiagen, Hilden, Germany). Plasmid DNA was quantified using a Nanodrop® ND-1000 spectrophotometer and diluted to concentrations between 107 and 101 DNA molecules to establish the regression curve (Applied Biosystems, n.d.). Each dilution was tested in triplicate. The annealing temperature and ideal MgCl2 , primer, probe and non-acetylated bovine serum albumin (BSA; Sigma–Aldrich, St. Louis, USA) concentrations were determined. The reaction was composed of 12.5 L of JumpStart® Taq ReadyMix® (Sigma–Aldrich, St. Louis, USA), 4.5 mM MgCl2 , 250 nM of each probe, 600 nM of each primer, 0.6 g/L BSA and 5 L target DNA, for a final volume of 25 L. The amplification cycle consisted of 2 min at 94 ◦ C followed by 50 cycles of 30 s at 94 ◦ C and 1 min at 61 ◦ C and was performed using a CFX96 real-time PCR system (Bio-Rad, Hercules, USA). Negative (no template) controls were included in each PCR run. One positive control was included in every run to confirm consistent amplification. 2.5. Evaluation of the duplex real-time PCR specificity Polyacrylamide gel electrophoresis was performed to check the sizes of the amplified fragments. Molecular cloning of the duplex real-time PCR fragments was performed to identify the amplified products by means of plasmid sequencing and to rule out false positive results, as described in Section 2.3. Samples from 23 birds were cloned after selecting samples with threshold cycle (Ct) values between 35 and 40, or samples that were either positive for both targets or positive for one of the targets by duplex real-time PCR but negative by nested PCR. Up to five clones were selected from each sample, thus increasing the probability of confirming the specificity of the duplex real-time PCR results. Consensus sequences analysis was performed as described in Section 2.2. For the evaluation of analytical specificity, genomic DNA samples of C. andersoni, C. baileyi, C. bovis, Cryptosporidium canis, C. galli, C. ryanae, Cryptosporidium serpentis and Cryptosporidium avian genotypes I–III, which were previously identified and stored at the Faculty of Veterinary Medicine at University of São Paulo State (UNESP), Arac¸atuba Campus, were tested in triplicate by duplex real-time PCR.
2.6. Nucleotide sequence accession numbers The nucleotide sequence of Cryptosporidium avian genotype V was submitted to GenBank under the accession no. KJ487974. The sequences of the other Cryptosporidium species and genotypes identified in the present study were 100% genetic matches with sequences from isolates of birds from Brazil, published at GenBank under the accession nos. GQ227476, GQ227480, GQ227481, DQ002931, EU543270, GU816051, and GU816054. 3. Results The standard regression curve obtained after standardization of the duplex real-time PCR exhibited the following values: e = 97.3%, R2 = 0.99 and a slope of −3.38 for C. galli and e = 94.3%, R2 = 0.99 and a slope of −3.46 for Cryptosporidium avian genotype III (Fig. 1). Nested PCR was positive for Cryptosporidium spp. in 108 out of 1027 samples (10.52%; 95% confidence interval [CI]: 8.75–12.51%). The sequencing of the fragments from the amplification by nested PCR was possible in 40 samples and allowed for the identification of C. baileyi (8/1027; 0.78%), C. galli (28/1027; 2.73%), Cryptosporidium avian genotype III (3/1027; 0.29%) and Cryptosporidium avian genotype V (1/1027; 0.08%) (Supplementary Table S1). With respect to duplex real-time PCR, 580 out of 1027 samples (56.47%; 95% CI: 53.4–59.5%) were positive for C. galli, whereas 21 of 1027 samples (2.04%; 95% CI: 1.3–3.1%) were positive for Cryptosporidium avian genotype III. Several diagnostic situations were observed in the analysis of the duplex real-time PCR and nested PCR for the 1027 fecal samples (Table 2, Supplementary Table S1). The average, Table 2 Detection of Cryptosporidium spp. and C. galli/Cryptosporidium avian genotype III DNA in avian fecal samples using nested PCR and duplex real-time PCR, respectively. Nested PCR (Cryptosporidium spp.)
Duplex real-time PCR C. galli
Cryptosporidium avian genotype III
− − + + − + + −
+ − + − + + − −
− + − + + + − −
Total (%)
496 (48.30) 6 (0.58) 70 (6.82) 1 (0.10) 13 (1.27) 1 (0.10) 36 (3.50) 404 (39.34) 1027(100)
10
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
Fig. 1. Standardization of the duplex real-time PCR assay targeting the 18S gene of C. galli and Cryptosporidium avian genotype III. Standard regression curves for C. galli (FAM) and Cryptosporidium avian genotype III (VIC) obtained with the specific TaqMan assays.
standard deviation, and the minimum and maximum Ct values observed in the duplex real-time PCR assay were, respectively, 33.71 (±4.79), 26.65 and 39.91 for C. galli and 37.12 (±3.64), 29.47 and 39.88 for Cryptosporidium avian genotype III. The specificity of the duplex real-time PCR was assessed by polyacrylamide gel electrophoresis and molecular cloning and sequencing of the amplified fragments. The
sizes of the amplified fragments corresponded to those expected for C. galli (134 bp) and avian genotype III (138 bp). Cloning and sequencing samples from 23 birds confirmed the assay specificity for C. galli and Cryptosporidium avian genotype III (Table 3). Among all Cryptosporidium DNA samples tested for the evaluation of analytical specificity of the duplex real-time PCR, C. serpentis DNA also was amplified by primers and
Table 3 Identification of the Cryptosporidium species or genotype in samples that were positive by duplex real-time PCR, using molecular cloning and plasmids sequencing. Comparison with the detection and identification using nested PCR and sequencing of the nested PCR fragments, respectively. Avian species
Duplex real-time PCR (C. galli)
Duplex real-time PCR (Cryptosporidium avian genotype III)
Duplex real-time PCR/plasmids sequencing
Nested PCR (Cryptosporidium spp.)
Nested PCR/sequencing
Amazona aestiva Amazona vinacea Brotogeris tirica Brotogeris tirica Gnorimopsar chopi Nymphicus hollandicus Nymphicus hollandicus Nymphicus hollandicus Nymphicus hollandicus Paroaria coronata Saltator similis Saltator similis Saltator similis Sporophila sp. Sporophila sp. Sporophila sp.
+ + + + + + − − − + − + + + + +
+ − − − − − + + + + + + − − − +
− + − − + + − − + − − + + + + −
− nra − − C. galli C. galli − − nr − − nr C. galli C. galli C. galli −
Sporophila caerulescens Sporophila caerulescens
+ +
− +
+ −
C. galli −
Serinus canarius Serinus canarius
+ +
+ +
− −
− −
Sicalis flaveola Zonotrichia capensis
+ +
− +
+ −
C. galli −
Zonotrichia capensis
+
−
Avian genotype III C. galli C. galli C. galli C. galli C. galli Avian genotype III Avian genotype III Avian genotype III C. galli Avian genotype III C. galli C. galli C. galli C. galli C. galli Avian genotype III C. galli C. galli Avian genotype III Avian genotype III C. galli Avian genotype III C. galli C. galli Avian genotype III C. galli
+
C. galli
a
Samples not sequenced.
Table 4 Alignment of the primers and probes specific for the 18S rRNA gene of Cryptosporidium galli and Cryptosporidium avian genotype IIIa with sequences from species that commonly1 or rarely2 infect birds as well as Cryptosporidium sequences that are genetically more related to both targets3 .
Species or Cryptosporidium genotypes
C. galli Avian genotype III Avian genotype IV2,3 Woodcock genotype2,3 C. serpentis3 C. muris3 C. andersoni3 C. baileyi1 Avian genotype I1 Avian genotype II1 Avian genotype V2 C. meleagridis1 C. parvum3 a
Sequences Alignment
GU734647 DQ650343 DQ650344 AY273769 AF093502 AF093498 EU245042 AJ276096 GQ227479 DQ002931 HM116381 AF180339 AF093490
365 375 384 393 403 412 419 429 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AGCTCGTAGTTGGATTTCTGTTG-CATCAT-TATATTATCACTAAGGTAA-TAAT---ATAATATCAACATCCTCCCTGT .......................-T..TT.-....A...T..........-C.T.---......A.........T..CAA .......................-T.....-...........C.......-....---...............CT...A. .......................-T.CTT.--...A..CT..C.......-..T.---.....GA.........T..CAC .......................-T..TT.-....A...T.T........-..T.T--................T...A. .......................-T..A..C....A...T.........TA..T.---...T............T...A. .......................-T..A..T....A...T..C.......T..T.---...T............T...A. ......................AAT.-.T.A....-C.AT..C.C...----.T.TAT....C..T.....AA.T.ACA. ......................AAT.-.T.A....-..AT....C...----.T.TAT....C..T.....AA.T.ACA. ......................AATT-.T.A....-..GT....C...----.T.TAT....C..T.....AA.T.A.A. ......................AATT-.T.A....-..AT....C...----.T.TAT....C..T.....AA.T.A.A. ......................AAT.ATT.A....-..AT.T.T-.A.T.A..T.TAT.......T.....AA.T.A.A. ......................AAT.ATT.A....-A.AT.T.TT.A.G.A..T.TAT.......T.....AA.T.A.A.
GU734647 DQ650343 DQ650344 AY273769 AF093502 AF093498 EU245042 AJ276096 GQ227479 DQ002931 HM116381 AF180339 AF093490
437 443 453 463 473 483 493 503 .....|...|....|....|....|....|....|....|....|....|....|....|....|....|....|.... TA---TATCT---AATATAGAGGGAATTTTACTTTGAGAAAATTAGAGTGCTTAAAGCAGGCAACTGCCTTGAATACTC ..---...T.TTT......TG..A....................................................... ..---...T.---......T...A....................................................... ..---...T.TTT......TG..A....................................................... ..---...T.TT-......T...A....................................................... ..---...T.CTA......T...A..C.................................................... ..---...T-CTA......T...A....................................................... ..CT-...T.AA-.G...GT--.A..C...................................T.T.............. ..CT-...T.TA-.G...GT--.A......................................T.T.............. ..CT-...T.AA-.G....T--.A......................................T.T.............. ..CT-...T.AA-.G....T--.A......................................T.T.............. ..CTAA..T.ATT.G....T--.A.......................................TA.............. ..CTA...A.TTT.G....T--.A.......................................TA..............
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
C. galli Avian genotype III Avian genotype IV2 Woodcock genotype2 C. serpentis3 C. muris3 C. andersoni3 C. baileyi1 Avian genotype I1 Avian genotype II1 Avian genotype V2 C. meleagridis1 C. parvum3
Sequences Identification in GenBank
Sense and anti-sense primers and probe for Cryptosporidium avian genotype III anneal, respectively, at 162–187, 281–300 and 209–230 positions in the DQ650343 sequence.
11
12
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13
probe for Cryptosporidium avian genotype III. However, the amplification curve always presented a flattened shape and a Ct near 40. The results of the duplex real-time PCR and nPCR/S allowed for the identification of 59 novel host birds for C. galli and 15 for Cryptosporidium avian genotype III (Supplementary Table S1). 4. Discussion Most samples were obtained from adult birds. In contrast to other avian Cryptosporidium species, age is not a limiting factor for the occurrence of infection by C. galli and possibly by Cryptosporidium avian genotype III. C. galli is associated with chronic infections in adult birds, with prolonged oocyst shedding (Silva et al., 2010). Cryptosporidium avian genotype III exhibits a low occurrence in birds (Ng et al., 2006; Nakamura et al., 2009; Sevá et al., 2011; Qi et al., 2011) but has been cited as a possible cause for chronic gastric illness in birds (Makino et al., 2010). The different rates of positivity for C. galli between nPCR/S and duplex real-time PCR may occur because realtime PCR normally exhibits a higher sensitivity than nested PCR (De Waele et al., 2011; Yang et al., 2009; Homem et al., 2012). A significant portion of the positive samples exhibited Ct values between 35 and 39, most likely due to the small amounts of oocysts in the samples, which is common in infections with C. galli (Antunes et al., 2008; Nakamura et al., 2009). Furthermore, sequencing of 40 out of 108 samples that were positive by nested PCR resulted in the identification of 70% (28/40) as C. galli, suggesting that most nested PCR positive birds would be C. galli positive. Cryptosporidium galli is the most frequently detected species in Passeriformes (Ng et al., 2006; Nakamura et al., 2009; Silva et al., 2010; Sevá et al., 2011; Qi et al., 2011). In this study, fecal samples were collected from birds kept in the same environment, with cages closely disposed side by side. The proximity between birds, coupled with chronic and intermittent C. galli oocyst shedding (Silva et al., 2010), could result in the spread of infection by means of direct contact with feces or human carriage of oocysts during routine management related to cleaning, food and drinking water. As a result, these infections may have been detected, even at low levels, by a highly sensitive diagnostic technique, such as real-time PCR. The analytical specificity for Cryptosporidium avian genotype III revealed the amplification of C. serpentis DNA, with an atypical amplification curve, which was most likely due to a polymorphism in the annealing region of the probe for genomic C. serpentis DNA (Table 4). Similarly, Hadfield et al. (2011) observed the amplification of Cryptosporidium horse genotype using primers and a TaqMan MGB probe specific for C. parvum. In our study, the only way to confirm the specificity of the duplex real-time PCR for C. galli and Cryptosporidium avian genotype III was molecular cloning and sequencing of the amplified fragments, which revealed that the amplified sequences corresponded to the targets in question. The observed positivity of 10.52% of the fecal samples (108/1027) for Cryptosporidium spp. by nested PCR was greater than that observed in previous studies; for
example, studies in Brazil reported rates of 4.86% (47/966) (Nakamura et al., 2009) and 6.6% (16/242) (Sevá et al., 2011), and studies in Australia and China reported rates of 6.3% (27/430) (Ng et al., 2006) and 8.1% (35/434) (Qi et al., 2011), respectively. Furthermore, novel host birds were identified for C. galli and Cryptosporidium avian genotype III in the present study. Cryptosporidium avian genotype V was detected in Amazona aestiva and was previously described in Nymphicus hollandicus in China and Japan (Abe and Makino, 2010; Qi et al., 2011). In conclusion, in this study, a sensitive and specific method was developed for the detection of C. galli and Cryptosporidium avian genotype III in bird fecal samples. Moreover, this method may serve as an alternative to nPCR/S as a gold standard for the diagnosis of gastric cryptosporidiosis in birds. Conflict of interest statement The authors have no conflicts of interest to declare. Acknowledgments We would like to thank theSão Paulo Research Foundation (Fundac¸ão de Amparo à Pesquisa do Estado de São Paulo – FAPESP) for financial support (2009/51595-9) and for a doctoral scholarship to A.A. Nakamura (2009/515965). References Abe, N., Makino, I., 2010. Multilocus genotypic analysis of Cryptosporidium isolates from cockatiels in Japan. Parasitol. Res. 106, 14916–21497. Antunes, R.G., Simões, D.C., Nakamura, A.A., Meireles, M.V., 2008. Natural infection with Cryptosporidium galli in canaries (Serinus canaria), in a cockatiel (Nymphicus hollandicus) and in lesser seed-finches (Oryzoborus angolensis) from Brazil. Avian Dis. 52, 7026–7705. Applied Biosystems, n.d. Creating standard curves with genomic DNA or plasmid DNA templates for use in quantitative PCR. [Online]. Available: http://www6.appliedbiosystems.com/support/ tutorials/pdf/quant pcr.pdf (accessed 17.07.14). Blagburn, B.L., Lindsay, D.S., Hoerr, F.J., Atlas, A.L., Toiviokinnucan, M., 1990. Cryptosporidium sp. infection in the proventriculus of an Australian diamond firetail finch (Staganoplura bella Passeriformes, Estrildidae). Avian Dis. 34, 1027–1030. Burnet, J.B., Ogorzaly, L., Tissier, A., Penny, C., Cauchie, H.M., 2012. Novel quantitative TaqMan real-time PCR assays for detection of Cryptosporidium at the genus level and genotyping of major human and cattle-infecting species. J. Appl. Microbiol. 114, 12116–21222. Current, W.L., 1990. Techniques and laboratory maintenance of Cryptosporidium. In: Dubey, J.P., Speer, C.A., Fayer, R. (Eds.), Cryptosporidiosis of Man and Animals. CRC Press, Boca Raton, pp. 59–82. Current, W.L., Upton, S.J., Haynes, T.B., 1986. The life cycle of Cryptosporidium baileyi n. sp. (Apicomplexa, Cryptosporidiidae) in infected chickens. J. Protozool. 33, 2896–3296. De Waele, V., Berzano, M., Berkvens, D., Speybroeck, N., Lowery, C., Mulcahy, G.M., Murphy, T.M., 2011. Age-stratified Bayesian analysis estimating the sensitivity and specificity of four diagnostic tests for the detection of Cryptosporidium oocysts in neonatal calves. J. Clin. Microbiol. 49, 76–89. Hadfield, S.J., Robinson, G., Elwin, K., Chalmers, R.M., 2011. Detection and differentiation of Cryptosporidium spp. in human clinical samples using real-time PCR. J. Clin. Microbiol. 49, 9186–9924. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 956–998. Homem, C.G., Nakamura, A.A., Silva, D.C., Teixeira, W.F., Coelho, W.M., Meireles, M.V., 2012. Real-time PCR assay targeting the actin gene for the detection of Cryptosporidium parvum in calf fecal samples. Parasitol. Res. 110, 17416–21745.
A.A. Nakamura et al. / Veterinary Parasitology 205 (2014) 7–13 Jellison, K.L., Distel, D.L., Hemond, H.F., Schauer, D.B., 2004. Phylogenetic analyses of the hypervariable region of the 18s rRNA gene of Cryptosporidium oocysts in the feces of Canada Geese (Branta canadensis): evidence for five novel genotypes. Appl. Environ. Microbiol. 70, 4526–5458. Jothikumar, N., Da Silva, A.J., Moura, I., Qvarnstrom, Y., Hill, V.R., 2008. Detection and differentiation of Cryptosporidium hominis and Cryptosporidium parvum by dual TaqMan assays. J. Med. Microbiol. 57, 10996–11105. Makino, I., Abe, N., Reavill, D.R., 2010. Cryptosporidium avian genotype III as a possible causative agent of chronic vomiting in peach-faced lovebirds (Agapornis roseicollis). Avian Dis. 54, 11026–11107. Meireles, M.V., Soares, R.M., Santos, M.M.A.B., Gennari, S.M., 2006. Biological studies and molecular characterization of a Cryptosporidium isolate from ostrich (Struthio camelus). J. Parasitol. 92, 6236–6626. Morgan, U.M., Monis, P.T., Xiao, L., Limor, J., Sulaiman, I., Raidal, S., O’Donoghue, P., Gasser, R., Murray, A., Fayer, R., Blagburn, B.L., Lal, A.A., Thompson, R.C.A., 2001. Molecular and phylogenetic characterization of Cryptosporidium from birds. Int. J. Parasitol. 31, 2896–3296. Nakamura, A.A., Simões, D.C., Antunes, R.G., Da Silva, D.C., Meireles, M.V., 2009. Molecular characterization of Cryptosporidium spp. from fecal samples of birds kept in captivity in Brazil. Vet. Parasitol. 166, 476–551. Ng, J., Pavlasek, I., Ryan, U., 2006. Identification of novel Cryptosporidium genotypes from avian hosts. Appl. Environ. Microbiol. 72, 75486–77553. Nguyen, S.T., Fukuda, Y., Tada, C., Huynh, V.V., Nguyen, D.T., Nakai, Y., 2013. Prevalence and molecular characterization of Cryptosporidium in ostriches (Struthio camelus) on a farm in central Vietnam. Exp. Parasitol. 133, 8–11. Pavlásek, I., 2001. Findings of Cryptosporidia in the stomach of chickens and of exotic and wild birds. Veterinarstvi 51, 103–108. Qi, M., Wang, R., Ning, C., Li, X., Zhang, L., Jian, F., Sun, Y., Xiao, L., 2011. Cryptosporidium spp. in pet birds: genetic diversity and potential public health significance. Exp. Parasitol. 128, 3366–4340. Ryan, U.M., 2010. Cryptosporidium in birds, fish and amphibians. Exp. Parasitol. 124, 113–120.
13
Ryan, U.M., Xiao, L., Read, C., Sulaiman, M., Monis, P., Lal, A.A., Fayer, R., Pavlasek, I., 2003. A redescription of Cryptosporidium galli Pavlasek, 1999 (Apicomplexa: Cryptosporidiidae) in birds. J. Parasitol. 89, 8096–8813. Santos, M.M.A.B., Peiró, J.R., Meireles, M.V., 2005. Cryptosporidium infection in ostriches (Struthio camelus) in Brazil: clinical, morphological and molecular studies. Braz. J. Poultry Sci. 7, 1136–2117. Sevá, A.P., Funada, M.R., Richtzenhain, L.J., Guimarães, M.B., Souza, S.O., Allegretti, L., Sinhorini, J.A., Duarte, V.V., Soares, R.M., 2011. Genotyping of Cryptosporidium spp. from free-living wild birds in Brazil. Vet. Parasitol. 175, 276–332. Silva, D.C., Homem, C.G., Nakamura, A.A., Teixeira, W.F., Perri, S.H., Meireles, M.V., 2010. Physical, epidemiological, and molecular evaluation of infection by Cryptosporidium galli in Passeriformes. Parasitol. Res. 107, 2716–3277. Slavin, D., 1955. Cryptosporidium meleagridis (sp. nov.). J. Comp. Pathol. 65, 262–266. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality tools. Nucleic Acids Res. 24, 48766–54882. Xiao, L., Escalante, L., Yang, C., Sulaiman, I., Escalante, A.A., Montali, R.J., Fayer, R., Lal, A.A., 1999. Phylogenetic analysis of Cryptosporidium parasites based on the small-subunit rRNA gene locus. Appl. Environ. Microbiol. 65, 1578–1583. Xiao, L., Alderisio, K., Limor, J., Royer, M., Lal, A.A., 2000. Identification of species and sources of Cryptosporidium oocysts in storm waters using a small-subunit rRNA-based diagnostic and genotyping tool. Appl. Environ. Microbiol. 66, 54926–55498. Xiao, L., Fayer, R., Ryan, U., Upton, S.J., 2004. Cryptosporidium taxonomy: recent advances and implications for public health. Clin. Microbiol. Rev. 17, 726–797. Yang, R., Jacobson, C., Gordon, C., Ryan, U., 2009. Prevalence and molecular characterization of Cryptosporidium and Giardia species in preweaned sheep in Australia. Vet. Parasitol. 161, 196–224. Zhou, L., Kassa, H., Tischler, M.L., Xiao, L., 2004. Host-Adapted Cryptosporidium spp. in Canada Geese (Branta canadensis). Appl. Environ. Microbiol. 70, 4211–4215.
