Mol. Nutr. Food Res. 2014, 58, 1069–1078
1069
DOI 10.1002/mnfr.201300617
RESEARCH ARTICLE
Diallyl sulfide as a potential dietary agent to reduce TNF-␣- and histamine-induced proinflammatory responses in A7r5 cells Cheng-Ying Ho1 , Chia-Jui Weng3 , Jhih-Jia Jhang1 , Yu-Ting Cheng1 , Shang-Ming Huang1 and Gow-Chin Yen1,2 1
Department of Food Science and Biotechnology, National Chung Hsing University, Taichung, Taiwan Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan 3 Graduate Institute of Applied Living Science, Tainan University of Technology, Yongkang Distric, Tainan City, Taiwan 2
Scope: Oxidative stress-aggravated chronic inflammatory diseases of the airway are well documented; hence, treatment with antioxidants to ameliorate oxidative stress might be an effective strategy to reduce airway complications. The aim of this study was to investigate the effect and molecular mechanism of diallyl sulfide (DAS), which is a natural organosulfuric compound found in garlic, on the inhibition of tumor necrosis factor-alpha (TNF-␣)- or histamine-induced inflammation in rat aortic smooth muscle A7r5 cells. Methods and results: A7r5 cells were coincubated with DAS before exposure to TNF-␣ or histamine. DAS significantly blocked the accumulation of the nuclear p65 protein in TNF-␣induced A7r5 cells by attenuating the TNF-␣ receptor complex through the dissociation of the TNF receptor-associated death domain and TNF receptor-associated factor 2. Moreover, DAS inhibited histamine-induced inflammation by decreasing reactive oxygen species (ROS) levels by enhancing the nuclear factor-erythroid 2-related factor 2-related antioxidative enzyme. DAS also inhibited inflammation by suppressing interleukin-1 and TNF-␣ through the inhibition of ROS-induced PI3K/Akt and the downstream NF-B and activator protein-1. Conclusion: Our results demonstrate that DAS is a potential phytochemical to inhibit TNF-␣and histamine-induced inflammation, suggesting that DAS might be an effective dietary agent for the prevention of oxidative stress-induced inflammation of the airway.
Received: August 22, 2013 Revised: November 20, 2013 Accepted: November 24, 2013
Keywords: Diallyl sulfide / Histamine / Inflammation / Nrf2 / TNF-␣
1
Introduction
Asthma is a complex chronic inflammatory disease of the airways that involves the activation of many inflammatory and structural cells, which release inflammatory mediators Correspondence: Professor Gow-Chin Yen, Department of Food Science and Biotechnology, National Chung Hsing University, 250 Kuokuang Road, Taichung 40227, Taiwan E-mail: [email protected] Fax: +886-4-2285-4378 Abbreviations: AP-1, activator protein-1; DAS, diallyl sulfide; GPx, glutathione peroxidase; GR, glutathione reductase; HO-1, heme oxygenase-1; MTT, 3-(4,5-dimethyl-thiazol-2-yl)-2,5diphenyltetrazolium bromide; NAC, N-acetyl-L-cysteine; NQO1, NAD(P)H quinone oxidoreductase 1; ROS, reactive oxygen species; SOD, superoxide dismutase; TNF-␣, tumor necrosis factor alpha; TRADD, TNF receptor-associated death domain; TRAF2, TNF receptor-associated factor 2 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
to induce the typical pathophysiology of asthma [1]. Reactive oxygen species (ROS) are generated by several inflammatory cells and are overproduced in asthma patients; this observation suggests that ROS might participate in airway inflammation. Tumor necrosis factor-␣ (TNF-␣) is a cytokine that responds to innate immunization, providing immediate defense against foreign organisms before the adaptive immune system is activated [2]. The mRNA and protein levels of TNF-␣ were high in the airways of patients with asthma [3]. High levels of TNF-␣ in the blood or other bodily fluids might cause oxidative damage and impair the physiological ROS and antioxidant defense systems. Hence, it is supposed that TNF-␣ might correlate with the inflammatory response in the asthmatic airway. The development of airway hyperresponsiveness and airway neutrophilia was observed in normal subjects who were administered inhaled recombinant TNF-␣ [4, 5]. Previously, the mechanisms that direct TNF-␣-induced airway hyperresponsiveness were www.mnf-journal.com
1070
C.-Y. Ho et al.
unclear. Several properties of TNF-␣, such as the recruitment of neutrophils, the induction of glucocorticoid resistance, the proliferation of monocytes, and the stimulation of fibroblast growth and maturation into myofibroblasts, are relevant to airway inflammation [6], which suggests that TNF-␣ might play a central role in severe refractory asthma. Histamine is also considered an important proinflammatory mediator in the pathophysiology of bronchial asthma [7, 8]. A variety of symptoms that resemble asthma, such as the contraction of smooth muscle of the airway, vasodilation, plasma exudation, and mucus production, are induced by histamine in an acute allergic reaction [9]. Other acute symptoms in the vascular endothelium and bronchial and smooth muscle cells, such as acute rhinitis, bronchospasm, cramping, diarrhea, or cutaneous wheal-and-flare responses, are also triggered by histamine [10]. Elevated histamine levels have been noted in the skin and plasma of patients with atopic dermatitis [11] and chronic urticaria [12]. Moreover, high levels of histamine are also observed in the plasma and synovial fluid of patients with rheumatoid arthritis and in the plasma of patients with psoriatic arthritis [13]. It can be inferred from these studies that histamine might be able to regulate immune responses and chronic phase inflammatory events. Accordingly, several studies on remedying asthma are aimed at minimizing the undesirable responses of cells or tissue that are induced by TNF-␣ and histamine. Diallyl sulfide (DAS) is a natural organosulfuric compound that is plentiful in garlic and is beneficial to human health [14, 15]. It has been reported that DAS possesses the ability to induce apoptosis in a human colon cancer cell line [16] and to modulate phase-II drug metabolizing enzymes, which include glutathione S-transferase and [NAD(P)H quinone oxidoreductase 1] NQO1; the detoxifying function of DAS has also been demonstrated [17]. We recently demonstrated that DAS enhanced the activity of pulmonary antioxidant enzymes via the activation of Nrf2 in SD rats and in human embryonic MRC-5 lung cells [18]. Because the inflammatory events can be inhibited via a reduction in oxidative stress by antioxidant enzymes, we investigated the inhibitory effect of DAS on TNF-␣- or histamineinduced inflammation in rat aortic smooth muscle A7r5 cells and explored the molecular mechanism underlying this inhibition.
2
Materials and methods
2.1 Chemicals DMEM, fetal bovine serum, trypsin-EDTA (TE), L-glutamine, and penicillin-streptomycin antibiotic solution were obtained from Gibco BRL (Grand Island, NY, USA). DAS was obtained from Alfa Aesar (Ward Hill, MA, USA). AntiHO-1 and anti-Nrf2 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PI3K, anti-phospho-PI3K, anti-Akt, anti-phospho-Akt, anti C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2014, 58, 1069–1078
c-Fos, anti-c-Jun, anti-p65, anti-TNFR1, anti-TRADD, antiTRAF2, anti-lamin B1, and anti--actin antibodies were obtained from Cell Signaling Technology (Beverly, MA, USA). N-acetyl-L-cysteine (NAC) and 3-(4,5-dimethyl-thiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Protein molecular mass markers were obtained from Pharmacia Biotech (Saclay, France). TRIzol and Wortmannin were obtained from Invitrogen (Carlsbad, CA, USA). All fine chemicals were obtained from Showa Chemical (Tokyo, Japan) or Sigma-Aldrich (St. Louis, MO, USA).
2.2 Cell culture The rat smooth muscle thoracic aorta A7r5 cell line (BCRC 60082) was obtained from the Bioresource Collection and Research Center (BCRC, Food Industry Research and Development Institute, Hsinchu, Taiwan). Cells were grown in DMEM supplemented with 10% fetal bovine serum at 37⬚C in a humidified atmosphere of 95% air and 5% CO2 . The culture medium was renewed each day. Cells were subcultured weekly with 0.1% trypsin and 10 mM EDTA in PBS.
2.3 Cell survival assay The toxicities of TNF-␣, histamine, and DAS to A7r5 cells were measured by MTT analysis. Briefly, A7r5 cells (1 × 105 cells/mL) were seeded into 96-well microtiter plates. After the cells were coincubated with TNF-␣, histamine, or DAS, the medium was removed and replaced with fresh medium containing 0.5 mg/mL MTT for 2 h at 37⬚C. The original yellow MTT was converted into violet crystals by living cells and was subsequently dissolved in DMSO. The optical density was measured at 570 nm using a BMG LABTECH FLUOstar fluorescence reader (Jena, Germany). DAS was dissolved in DMSO, and the concentration of DMSO was used less than in 0.1% v/v for the experiments.
2.4 RNA extraction and RT-PCR Treated cells were washed three times with PBS, and TRIzol was used to extract the total RNA. The RevertAid First Strand cDNA synthesis kit (Fermentas, Glen Burnie, MD, USA) was used to translate RNA into cDNA, and Taq DNA polymerase (Fermentas, Glen Burnie, MD, USA) was used to amplify the desired cDNA sequence. The primers used for PCR to amplify the target genes were as follows: TNF-␣, forward: AGCACAGAAAG CATGATCCG, reverse: CTGATGAGAGGGAGGCCATT; interleukin-1 (IL-1), forward: GCGAGACTTCTCAC CAAACA, reverse: GTTACCCCCATGACTCCAGA; catalase, forward: AGAGCGGATTCCTGAGAGAGTG, reverse: CAAACCCAC www.mnf-journal.com
1071
Mol. Nutr. Food Res. 2014, 58, 1069–1078
GAGGGTCACGAAC; superoxide dismutase (SOD), forward: GTTGGAGACCTGGGCAATGTGG, reverse: CCACAAGCCAAGCGGCTTCCAG; glutathione peroxidase (GPx), forward: GTGCGAGGTGAATGGTGAGAAG, reverse: TGCTGTATCTGCGCACTGGAAC; glutathione reductase (GR), forward: ACATCCCTACCGTGGTCTTCAG, reverse: GCCAACCACCTTCTCCTCTTTG; heme oxygenase-1 (HO-1), forward: CCGTGGCAGTGGGAATTTATGC, reverse: TGCCAGGCATCTCCTTCCATTC; NQO1, forward: AGCGGCTCCATGTACTCTCTGC, reverse: TC CTCCCAGACAGTCTCCAGAC; GAPDH, forward: TTG GAGGGCAAGTCTGGTG, reverse: CCGCTCCCAAGATC CAACTA. The PCR products were separated by electrophoresis on a 1.0% agarose gel, and the DNA bands were detected using the SYBR Safe DNA gel stain (Invitrogen, Carlsbad, CA, USA). The gel was then photographed using a BioDoc-It system (UVP, Cambridge, UK). The results were expressed as the ratio of each DNA signal relative to the corresponding GAPDH signal.
2.5 Nuclear/cytosol extract preparation The DAS-treated and -untreated cells were centrifuged at 13 000 × g for 5 min at 4⬚C. The collected cells were lysed using a Nuclear/Cytosol Fractionation Kit (BioVision, Mountain view, CA, USA) and centrifuged at 13 000 × g for 5 min. The supernatant was collected as cytosol extract, and the pellet was mixed with Nuclear Extraction Reagents and vortexed for 15 s. This mixture was then centrifuged at 13 000 × g for 10 min, and the supernatant was collected as nuclear extract. The protein concentrations of the extracts were determined by the bicinchoninic acid assay using a commercial protein reagent kit (Bio-Rad, Hercules, CA, USA).
2.6 Immunoprecipitation After coincubation with DAS or TNF-␣, the A7r5 cells were harvested in radioimmunoprecipitation (RIPA) lysis buffer (Millipore, Billerica, MA). The immunoprecipitation of TNFR1 complexes was performed using the Catch and Release v2.0 reversible immunoprecipitation system (Millipore) according to the manufacturer’s instructions.
according to the manufacturer’s instructions (SAbioscience, Frederick, MD, USA).
2.8 Western blotting The treated cells were lysed in RIPA buffer. The lysate was mixed with 4× protein loading dye (8% SDS, 0.04% Coomassie Blue R-250, 40% glycerol, 200 mM Tris-HCl (pH 6.8), and 10% 2-mercaptoethanol) and boiled at 100⬚C for 10 min to yield the sample solution. The sample solution was then subjected to SDS polyacrylamide gel electrophoresis, and the separated proteins were transferred onto cellulose nitrate membranes (Sartorius Stedim Biotech, Germany). The membranes were incubated with various primary antibodies (TNF-R1, TRADD, TRAF2, Nrf2, p65, phospho-IB␣, IB␣, c-Jun, c-Fos, phospho-PI3K, PI3K, phospho-Akt, Akt, lamin B1, or -actin; 1:1000 dilutions) overnight and then further incubated with horseradish peroxidase-conjugated secondary antibody (1:5000 dilutions). The signal was analyzed using the Chemiluminescent ECL detection system (Millipore), and the signal intensity was quantified using Vision Works LS 6.3.3 (UVP, Cambridge, UK). The protein levels were normalized relative to lamin B1 or -actin.
2.9 Intracellular ROS production assay The generation of intracellular ROS was detected using a fluorescent probe, 5-(and-6)-carboxy-2 ,7 -dichlorodihydrofluoresceindiacetate (DCF-DA, Molecular Probes, Eugene, OR, USA). DCF-DA diffuses readily through the cell membrane and is enzymatically hydrolyzed by intracellular esterases to form nonfluorescent DCFH, which is then rapidly oxidized to form highly fluorescent DCF in the presence of ROS. The fluorescence intensity of DCF is thus proportional to the amount of intracellular ROS. At the end of incubation, 105 cells/mL were collected and resuspended in PBS. An aliquot of the suspension (195 L) was loaded into a 96-well plate, and 5 L of DCF-DA was added (final concentration: 20 M). The DCF fluorescence intensity was detected at different time points using a FLUOstar galaxy fluorescence plate reader (BMG Labtechnologies, Offenburg, Germany) with an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
2.7 Nrf2 siRNA transfection A7r5 cells were seeded into 60-mm cell culture dishes at 1 × 105 cells/dish 18–24 h prior to transfection. Cells were transfected in Opti-MEM (Invitrogen, Carlsbad, CA, USA) with 100 nM of the following Nrf2 siRNA sequences: 5 -GAGUAUGAGCUGGAAAAACtt-3 and 5 -CCUUAUAUCUCGAAGUUUUtt-3 for 24 h. The transfection was performed using SureFECT transfection reagent C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
2.10 Statistical analysis All data are expressed as the mean ± SD. ANOVA was used to evaluate differences between multiple groups. Significant differences were subjected to Duncan’s test to compare the means of two specific groups. A p value < 0.05 was considered significant. www.mnf-journal.com
1072
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 1. The time-dependent effect of TNF-␣ stimulation on the expression of TNF-␣ and IL-1 mRNA in A7r5 cells. Cells were incubated with 10 ng/mL TNF-␣ for 0, 0.5, 1, 2, or 3 h. Total RNA was prepared from each culture for RT-PCR (A). The effect of DAS on the expression of TNF-␣ and IL-1 mRNA in TNF-␣-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) for 1 h and were then exposed to 10 ng/mL TNF-␣ for 2 h. (B). PCR products corresponding to TNF-␣, IL-1, and GAPDH were analyzed by agarose gel (1.0%) electrophoresis. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with TNF-␣-treated cells only.
3
Results
3.1 Effect of DAS on the mRNA expression of inflammatory mediators in TNF-␣-treated A7r5 cells The cytotoxicity of TNF-␣ against A7r5 cells was examined by an MTT assay. A 24-h incubation of A7r5 cells in a medium that contained 1–10 ng/mL TNF-␣ did not significantly decrease the cell viability (data not shown). To explore whether TNF-␣ influenced the expression of inflammatory genes that could induce airway inflammation, A7r5 cells were treated with TNF-␣ at a noncytotoxic dose (10 ng/mL) for 0–3 h, and the expression levels of TNF-␣ and IL-1 were analyzed. The expression of TNF-␣ and IL-1 mRNAs increased significantly (p < 0.05) for the incubations at 0.5, 1, and 2 h compared with the control (Fig. 1A). The maximum expression of these mRNAs with the treatment of TNF-␣ was observed at 2 h; therefore, this incubation time was applied to the subsequent experiments. When A7r5 cells were pretreated with DAS (7.5 or 15 M) for 1 h and then exposed to 10 ng/mL TNF-␣ for 2 h, the TNF-␣-enhanced expression of TNF-␣ and IL-1 mRNAs was significantly (p < 0.05) suppressed by 15 M DAS (Fig. 1B).
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
3.2 Effect of DAS on the protein level of p65 and the assembly of TNF-R1 in TNF-␣-treated A7r5 cells To identify the potential transcription factors that are responsible for the upregulation of TNF-␣-related inflammatory mediator genes, the protein levels of cytosol and nuclear p65 in A7r5 cells with and without TNF-␣ treatment was evaluated. Treatment with 10 ng/mL TNF-␣ resulted in a 2.1-fold increase in nuclear p65 (a NF-B subunit) compared with the control (Fig. 2A). When A7r5 cells were pretreated with 15 M DAS for 1 h and were then exposed to 10 ng/mL TNF-␣ for 2 h, the TNF-␣-elevated levels of the nuclear p65 protein decreased markedly (Fig. 2A). It is known that TNF-␣ signaling is transduced through its binding to TNF-␣ receptor type 1 (TNF-R1), which is expressed in most tissues. Therefore, we proposed that the DAS-downregulation of TNF-␣-induced p65 might also result from the inactivation of the TNF-R1 complex. To evaluate the effect of DAS on the TNF-R1 complex, the protein levels of the TNF receptor-associated death domain (TRADD) and TNF receptor-associated factor 2 (TRAF2) in A7r5 cells were examined by Western blotting under the conditions described above. The results in Fig. 2B showed that the protein levels of TRADD and TRAF2 were elevated by TNF-␣ treatment, and this increase was markedly inhibited by treatment
www.mnf-journal.com
Mol. Nutr. Food Res. 2014, 58, 1069–1078
1073
Figure 2. The effect of DAS on the protein level of p65 (A) and on the regulation of TNF-R1 assembly (B) in TNF-␣-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) for 1 h and then exposed to 10 ng/mL TNF-␣ for 2 h. (A) The protein level was analyzed by Western blotting using each specific antibody. The bands were quantified using a densitometer, and the p65 density value was normalized to the value of the corresponding -actin (cytosolic extract) or lamin B1 (nuclear extract) band. (B) Cell lysates were used for immunoprecipitation. The protein levels of TRADD, TRAF2, and TNF-R1 were analyzed by Western blotting using the corresponding specific antibodies. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments.
with 15 M DAS. Taken together, these results indicate that DAS can inhibit the TNF-␣-induced mRNA expression of TNF-␣ and IL-1 in A7r5 cells by reducing the activation of NF-B via the regulation of TNF-R1 complex assembly.
ment with DAS and NAC (Figs. 3B and C). According to the effective concentration, DAS should be a stronger inhibitor of the histamine-stimulated formation of intracellular ROS and the expression of TNF-␣ and IL-1 mRNA than is NAC.
3.3 Effect of DAS on the formation of intracellular ROS and the expression of TNF-␣ and IL-1 mRNA in histamine-treated A7r5 cells
3.4 Effect of DAS on the PI3K/Akt pathway and the activations of NF-B and AP-1 in histamine-induced A7r5 cells
The cytotoxicity of histamine against A7r5 cells was examined by an MTT assay. The cell viability did not decrease significantly after the cells were incubated in a medium that contained 0.1–5 M histamine for 24 h (data not shown). To investigate the influence of histamine on the expression of TNF-␣ and IL-1 mRNA, A7r5 cells were treated with 0.1, 0.5, 1, or 5 M of histamine for 3 h or with 1 M of histamine for 0.5, 1, 2, or 3 h. The maximum expression of mRNA was shown at a treatment of 1 M histamine for 3 h (data not shown). When DCF-DA staining was used to measure the intracellular accumulation of ROS, the formation of ROS in A7r5 cells exhibited a time-dependent increase during treatment with 1 M histamine (Fig. 3A). To verify that DAS could inhibit the histamine-induced production of ROS and the expression of the inflammatory gene NAC, which induces Nrf2 and scavenges free radicals, was employed as the reference. A7r5 cells were pretreated with DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h, and the cells were then exposed to 1 M histamine for 3 h. As a result, the histamine-stimulated ROS and the expression of TNF-␣ and IL-1 mRNA in A7r5 cells were markedly suppressed by treat-
To determine whether PI3K/Akt signals are responsible for the regulation of ROS formation and inflammatory mediator expression, the levels of phosphorylated PI3K and Akt were examined in histamine-stimulated A7r5 cells with or without DAS and NAC treatment. As shown in Fig. 4A, the protein levels of phosphorylated PI3K and Akt were significantly (p < 0.05) elevated in histamine-treated A7r5 cells compared with the control cells. However, the stimulation of PI3K and Akt expression by histamine was significantly inhibited by DAS and NAC (p < 0.05). NF-B and activator protein-1 (AP-1) are well-known transcription factors that are downstream of the PI3K/Akt pathway, which is involved in the transduction of the stimulation of ROS [19, 20], and AP-1 is highly expressed in vivo at inflammatory sites [21]. We further evaluated the status of c-Fos and c-Jun (AP-1 subunits) and phospho-p65 in histamine-stimulated A7r5 cells with or without DAS and NAC treatment. The immunoblots showed that the nuclear and cytosolic p65 were markedly increased and decreased, respectively, in histamine-treated cells compared with the untreated controls; additionally, DAS and NAC can markedly suppress the translocation of p65 from the cytosol into the
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
1074
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 3. The effect of DAS on the levels of inflammatory mediators in histamine-treated A7r5 cells. (A) The time-dependent effect of histamine on the production of ROS in A7r5 cells. Cells were incubated with 1 M histamine for 0, 0.5, 1, 2, or 3 h, and ROS production was analyzed using a FLUOstar galaxy fluorescence plate reader with the fluorescent probe DCFHDA (20 M), as described in section 2. (B) Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and were then exposed to 1 M histamine for 3 h, and the production of ROS was determined. (C) Total RNA was prepared from each of the cell cultures in (B) to perform RT-PCR to analyze the expression of TNF-␣ and IL-1 mRNA. The intensity of each gene-specific band was normalized to the corresponding internal control (GAPDH). Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
nucleus (Fig. 4B). The nuclear c-Fos and c-Jun were also induced by histamine, and the induced-c-Fos and -c-Jun can be reduced by the treatment with DAS and NAC (Fig. 4C). Moreover, we used Wortmannin (PI3K inhibitor) for demonstrating the relationships between PI3K and NF-B and AP-1. As shown in Fig. 4D, the activations of NF-B and AP-1-induced by histamine were inhibited through Wortmannin (20 M) treatment for 1 h in A7r5 cells. The results were consistent with the phosphorylation of PI3K (Fig. 4A). Taken together, the results of Figs. 3 and 4 suggest that the mechanism of DAS on the inhibition of inflammatory mediators is similar to that of NAC and occurs at least partly through the suppression of the activation of NF-B and AP-1 via the PI3K/Akt pathway.
DAS/NAC. Moreover, for confirming the role of Nrf2 under histamine condition, we checked the levels of NF-B and AP-1 through silencing Nrf2 in A7r5 cells. We found that the expressions of NF-B and AP-1 as well as the ROS production in histamine and siNrf2 treatments were higher than in histamine treatment alone (Fig. 5C and D). These data strongly suggest that DAS inhibited the activations of inflammatoryrelated transcription factors (NF-B and AP-1) and inflammatory mediators (ROS, TNF-␣, and IL-1) through directly enhancement of Nrf2-related antioxidant enzymes. Taken together, the results of Sections 3.3–3.5 indicate that DAS might inhibit the histamine-induced inflammatory mediators by enhancing Nrf2-related antioxidant enzymes that scavenge ROS and therefore suppress the activation of NF-B and AP-1.
3.5 Effect of DAS on the translocation of Nrf2 and the Nrf2-related mechanisms in histamine-treated A7r5 cells
4
When A7r5 cells were treated with 1 M histamine for 3 h, the protein expression of DJ-1 and the translocation of Nrf2 from the cytosol into the nucleus were attenuated, whereas the histamine-reduced level of DJ-1 and the translocation of Nrf2 were elevated by treatment with DAS or NAC (Fig. 5A). Because the translocation of Nrf2 is affected by histamine and DAS/NAC, the impacts of histamine and DAS/NAC on several Nrf2-related antioxidant enzymes were investigated further. As shown in Fig. 5B, the mRNA expression levels of catalase, SOD, GPx, GR, HO-1, and NQO1 in A7r5 cells were decreased by histamine but were increased by treatment with C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Discussion
ROS are free radicals that include the superoxide radical anion, hydroxyl radical, singlet oxygen, and hydrogen peroxide. Macrophages/monocytes, innate cytokines, and innate receptors are involved in ROS-induced inflammation and might play a causal role in the early stages of airway inflammation. The release of ROS causes cell and tissue damage that is associated with the occurrence of several chronic lung inflammatory diseases [22,23]. The contributions of cytokines and oxidative stress to airway inflammation were demonstrated in several cellular models that simulate the inflammatory state [1]. TNF-␣ is a critical cytokine for the regulation of cellular physiologies, such as apoptosis, proliferation, and inflammation [24]. In the present study, we used TNF-␣ to www.mnf-journal.com
Mol. Nutr. Food Res. 2014, 58, 1069–1078
1075
Figure 4. The effect of DAS on the transcription factors NF-B and AP-1 in histamine-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and then exposed to 1 M histamine for 3 h. The cytosolic and nuclear proteins were extracted and used for Western blot analyses with the indicated specific antibodies. The phospho-PI3K, PI3K, phospho-Akt, Akt (A), phospho-IB␣, IB␣, p65 (B), c-Fos, and c-Jun (C) bands were quantified by a densitometer. (D) Cells were pretreated with or without Wortmannin (20 M) for 1h and then treated present or absent DAS (15 M) for 1 h and the cells were then exposed to 1 M histamine for 3 h. The nuclear proteins were extracted and analyzed by Western blotting with the indicated specific antibodies. The bands were quantified by a densitometer. Each band density value was normalized to the value of the corresponding -actin (cytosolic extract) or lamin B1 (nuclear extract) band. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
induce the expression of TNF-␣ and IL-1 mRNA, which initiates the inflammatory response of A7r5 cells (Fig. 1A). Moreover, in our preliminary study, we observed that DAS treatment led to cytotoxicity at concentrations greater than 25 M (data not shown). Therefore, 15 M of DAS did not induce cytotoxicity in A7r5 cells, and all subsequent experiments in cells were performed using 15 M DAS. In the present study, an increase in nuclear phospho-p65 was also observed in response to the same treatment (Fig. 2A). Moreover, we found that TNF-␣, IL-1, and p65 expression were all markedly reduced by treatment with 15 M DAS (Figs. 1B and 2A). TNF-␣ can trigger the activation of a complex signal transduction pathway, which includes MAPK, nuclear factor-kappa C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
B (NF-B), and apoptotic signaling, by binding to the specific receptor TNFR1 [25]. The TNFR1 signaling complex is composed of many adaptor molecules, e.g. TRADD, RIP, TRAF1, TRAF2, and cIAP-1, in the normal cell membrane. Of these components, the TNFR1-TRADD-TRAF2 complex is a well-known initiator of the inflammatory cascade [24, 26]. The results shown in Fig. 2B demonstrate that treatment with TNF-␣ stimulated the assembly of the signaling complex around TNF-R1 in A7r5 cells. Under normal conditions, TNF-R1 is constitutively expressed on the cell membrane. This observation suggests that in the ordered state of A7r5 cells, TNF-R1 provides a platform through which extracellular-to-intracellular signals are communicated. The information discussed above indicates that TNF-␣ switches www.mnf-journal.com
1076
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 5. The effect of DAS on the transcription factors Nrf2 and the Nrf2-related mechanisms in histamine-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and then exposed to 1 M histamine for 3 h. The cytosolic and nuclear proteins were extracted and used for Western blot analyses with the indicated specific antibodies (A). Total RNA was prepared from each culture for RT-PCR to analyze the expression of the catalase, SOD, GPx, GR, HO-1, and NQO1 mRNAs. The intensity of each gene-specific band was normalized to the corresponding internal control (GAPDH) (B). (C) Cells were exposed to 1 M histamine for 3 h under present or absent siNrf2 condition, and the nuclear proteins were extracted and were analyzed by Western blotting with the indicated specific antibodies. (D) The production of ROS was determined using a fluorescent probe DCFH-DA (20 M). Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
the signal transduction state by changing the adaptor molecules present in the TNFR1 signaling complex [26]. Because the recruitment of TRADD and TRAF2 can elicit NF-B activation [27], the dissociation of the TNF-␣-induced TRADD and TRAF2 from the TNF-R1-signaling complex by treatment with DAS may lead to the downregulation of NF-B and the facilitation of cell inflammation (Fig. 2). It has been reported that ROS act as key intermediates that are directly involved in the histamine-mediated inflammation pathway [28]. In this study, we revealed that a pathological dose of histamine could promote the formation of intracellular ROS and stimulate inflammation-related cytokines in A7r5 cells (Fig. 3). Using the histamine-induced A7r5 cell model, the inhibitory po C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
tential and mechanism of DAS on inflammatory mediators were analyzed. The data indicate that DAS can downregulate the histamine-induced inflammatory mediators (TNF-␣ and IL-1) by decreasing intracellular ROS formation (Figs. 3B and C). The signals of several chemokines, growth factors, and cytokines are transduced via PI3K/Akt pathways to regulate the activities of the downstream NF-B and AP-1 for controlling numerous physiological reactions in cells [29]. Histamine can promote the phosphorylation of IB␣ and therefore facilitate the translocation of p65 (a NF-B subunit) into the nucleus to enhance the expression of inflammatory factors. Hence, the histamine-affected NF-B is considered to play a key role in www.mnf-journal.com
1077
Mol. Nutr. Food Res. 2014, 58, 1069–1078
the regulation of inflammatory genes [30]. Our study demonstrated that the phosphorylation of PI3K, Akt, and IB␣ in A7r5 cells was induced by histamine and that the phosphorylation of all these proteins was suppressed by treatment with DAS, attenuating the translocation of p65 (Fig. 4A and B). Moreover, the expression levels of the nuclear AP-1 subunits (c-Fos and c-Jun) increased and decreased with histamine and DAS treatment, respectively (Fig. 4C). We also evaluated the expressions of NF-B and AP-1 in A7r5 cells treatment with Wortmannin under histamine condition. The results indicated that DAS inhibits inflammatory mediators through the suppression of the activations of NF-B and AP-1 via the PI3K pathway (Fig. 4D). NAC is a well-known potent antioxidant and ROS-scavenging agent [31]. Because DAS and NAC exerted similar effects on the histamine-treated A7r5 cells, we presumed that the functional mechanism of DAS activity might resemble that of NAC. Taken together, these observations confirmed that DAS can inhibit TNF-␣ and IL-1 by inhibiting the PI3K/Akt pathway and inactivating NF-B and AP-1 by blocking the formation of ROS. It has been documented that DAS offers a cytoprotection by activating Nrf2 and that the activation of Nrf2 promotes the expression of genes that encode antioxidant and detoxifying enzymes [32,33]. Previously, we found that DAS enhanced the status of pulmonary antioxidants through the inactivation of Nrf2 in SD rats and in human embryonic MRC-5 cells [18]. Because this antioxidant property of DAS might contribute to the inhibition of histamine-induced inflammation, we further identified the activity of DAS on the activation of Nrf2 and on the expression of the Nrf2-related antioxidant enzymes in histamine-treated A7r5 cells. A notable decrease in the protein expression of DJ-1, which might be due to the overproduction of ROS [34], was observed in histamine-treated cells (Fig. 5A). DJ-1 protects against Parkinson disease, ischemia/reperfusion injury, and stroke-induced damage by attenuating oxidative stress, and the antioxidant potential of DJ-1 is mediated by Nrf2 [35–38]. The disruption of DJ-1 might decrease the stability of the Nrf2 protein, whereas the restoration of DJ-1 could contrarily decrease the ubiquitination of Nrf2 [38]. Antioxidant enzymes that are present in the fluid of the epithelial lining of the lower respiratory tract are the first line of defense against lung damage. However, persistent oxidative challenge to the lungs gradually depletes the antioxidants in lungs [39]. In the present study, we found that the administration of DAS restored approximately 1.7-fold of the expression of the DJ-1 protein compared with the control, which might result from the elevation of the activation of Nrf2 and the increase in catalase, SOD, GPx, GR, HO-1, and NQO1 under histamine-stimulated conditions (Fig. 5B). Moreover, both of the expressions of NF-B and AP-1 and the production of ROS were elevated through treatment with siNrf2 in A7r5 cells induced by histamine (Fig. 5C and D). The treatment with DAS thereby modulated the levels of antioxidant enzymes to alleviate the oxidative stress in the cells. In conclusion, DAS significantly blocked the nuclear accumulation of phospho-p65 in TNF-␣-induced A7r5 cells by C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
attenuating the TNF-␣ receptor complex by inducing the dissociation of TRADD and TRAF2. Moreover, DAS inhibited histamine-induced inflammation by decreasing the level of ROS formation by activating Nrf2 to enhance the expression of the Nrf2-related antioxidant enzymes, as well as by suppressing the expression of IL-1 and TNF-␣ mRNAs by inhibiting the ROS-induced PI3K/Akt pathway and the downstream NF-B and AP-1 proteins. According to our results, DAS is a phytochemical that can potentially inhibit TNF-␣and histamine-induced inflammation and may be considered a dietary agent to prevent oxidative stress-induced airway inflammation. This research work was supported in part by the National Science Council, NSC101-2313-B-005-046-MY3, Taiwan, and by the Ministry of Education, Taiwan under the ATU plan. The authors have declared no conflict of interest.
5
References
[1] Ho, W. E., Cheng, C., Peh, H. Y., Xu, F. et al., Anti-malarial drug artesunate ameliorates oxidative lung damage in experimental allergic asthma. Free Radic. Biol. Med. 2012, 53, 498–507. [2] Medzhitov, R., Janeway, C. J., Innate immune recognition: mechanisms and pathways. Immunol. Rev. 2000, 173, 89–97. [3] Russo, C., Polosa, R., TNF-alpha as a promising therapeutic target in chronic asthma: a lesson from rheumatoid arthritis. Clin. Sci. 2005, 109, 135–142. [4] Thomas, P. S., Yates, D. H., Barnes, P. J., Tumor necrosis factor-alpha increases airway responsiveness and sputum neutrophilia in normal human subjects. Am. J. Respir. Crit. Care Med. 1995, 152, 76–80. [5] Thomas, P. S., Heywood, G., Effects of inhaled tumour necrosis factor alpha in subjects with mild asthma. Thorax. 2002, 57, 774–778. [6] Brightling, C., Berry, M., Amrani, Y., Targeting TNF-alpha: a novel therapeutic approach for asthma. J. Allergy Clin. Immunol. 2008, 121, 5–10. [7] O’Mahony, L., Akdis, M., Akdis, C. A., Regulation of the immune response and inflammation by histamine and histamine receptors. J. Allergy Clin. Immunol. 2011, 128, 1153–1162. [8] Hirota, N., Risse, P.A., Novali, M., McGovern, T. et al., Histamine may induce airway remodeling through release of epidermal growth factor receptor ligands from bronchial epithelial cells. FASEB J. 2012, 26, 1704–1716. [9] Hamid, Q., Tulic, M., Immunobiology of asthma. Annu. Rev. Physiol. 2009, 71, 489–507. [10] Akdis, C. A., Jutel, M., Akdis, M., Regulatory effects of histamine and histamine receptor expression in human allergic immune responses. Chem. Immunol. Allergy 2008, 94, 67–82. [11] Seike, M., Takata, T., Ikeda, M., Kodama, H. et al., Histamine helps development of eczematous lesions in experimental www.mnf-journal.com
1078
C.-Y. Ho et al.
contact dermatitis in mice. Arch. Dermatol. Res. 2005, 297, 68–74. [12] Tedeschi, A., Asero, R., Marzano, A. V., Lorini, M. et al., Plasma levels and skin-eosinophil-expression of vascular endothelial growth factor in patients with chronic urticaria. Allergy 2009, 64, 1616–1622. [13] Rovensky, J., Imrich, R., Radikova, Z., Simorova, E. et al., Peptide hormones and histamine in plasma and synovial fluid of patients with rheumatoid arthritis and osteoarthrosis. Endocr. Regul. 2005, 39, 1–6. [14] Kalayarasan, S., Sriram, N., Sudhandiran, G., Diallyl sulfide attenuates bleomycin-induced pulmonary fibrosis: critical role of iNOS, NF-B, TNF-␣ and IL-1. Life Sci. 2008, 82, 1142–1153. ´ [15] Castro, C., Lorenzo, A. G., Gonzalez, A., Cruzado, M., Garlic components inhibit angiotensin II-induced cell-cycle progression and migration: Involvement of cell-cycle inhibitor p27Kip1 and mitogen-activated protein kinase. Mol. Nutr. Food Res. 2010, 54, 781–787. [16] Sriram, N., Kalayarasan, S., Ashokkumar, P., Sureshkumar, A. et al., Diallyl sulfide induces apoptosis in Colo 320 DM human colon cancer cells: involvement of Caspase-3, NF-B and ERK-2. Mol. Cell Biochem. 2008, 311, 157–165. [17] Shaik, I. H., George, J. M., Thekkumkara, T. J., Mehvar, R., Protective effects of diallyl sulfide, a garlic constituent, on the warm hepatic ischemia-reperfusion injury in a rat model. Pharm. Res. 2008, 25, 2231–2242. [18] Ho, C. Y., Cheng, Y. T., Chau, C. F., Yen, G. C., Effect of diallyl sulfide on in vitro and in vivo Nrf2-mediated pulmonic antioxidant enzyme expression via activation ERK/p38 signaling pathway. J. Agric. Food Chem. 2012, 60, 100–107. [19] Qi, S., Xin, Y., Guo, Y., Diao, Y. et al., Ampelopsin reduces endotoxic inflammation via repressing ROS-mediated activation of PI3K/Akt/NF-B signaling pathways. Int. Immunopharmacol. 2012, 12, 278–287. [20] Mata, M., Pallardo, F., Morcillo, E. J., Cortijo, J., Piclamilast inhibits the pro-apoptotic and anti-proliferative responses of A549 cells exposed to H2 O2 via mechanisms involving AP-1 activation. Free Radic. Res. 2012, 46, 690–699. [21] Reddy, N. M., Vegiraju, S., Irving, A., Paun, B. C. et al., Targeted deletion of Jun/AP-1 in alveolar epithelial cells causes progressive emphysema and worsens cigarette smoke-induced lung inflammation. Am. J. Pathol. 2012, 180, 562–574. [22] Sugiura, H., Ichinose, M., Oxidative and nitrative stress in bronchial asthma. Antioxid. Redox. Signal. 2008, 104, 785–797. [23] Comhair, S. A., Erzurum, S. C., Redox control of asthma: molecular mechanisms and therapeutic opportunities. Antioxid. Redox. Signal. 2010, 12, 93–124. [24] Wajant, H., Death receptors. Essays Biochem. 2003, 39, 53– 71. [25] Liu, Z. G., Molecular mechanism of TNF signaling and beyond. Cell Res. 2005, 15, 24–27. [26] Hsu, H., Huang, J., Shu, H. B., Baichwal, V. et al., TNFdependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 1996, 4, 387–396. C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2014, 58, 1069–1078
[27] Devin, A., Cook, A., Lin, Y., Rodriguez, Y. et al., The distinct roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits IKK to TNF-R1 while RIP mediates IKK activation. Immunity 2000, 12, 419–429. [28] Graziano, A. C., Cardile, V., Crasc`ı, L., Caggia, S. et al., Protective effects of an extract from Citrus bergamia against inflammatory injury in interferon-gamma and histamine exposed human keratinocytes. Life Sci. 2012, 90, 968–974. [29] Granado-Serrano, A. B., Mart´ın, M. A., Haegeman, G., Goya, L. et al., Epicatechin induces NF-kappaB, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2 p45-related factor-2 (Nrf2) via phosphatidylinositol3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) signalling in HepG2 cells. Br. J. Nutr. 2010, 103, 168–179. [30] Holden, N. S., Gong, W., King, E. M., Kaur, M. et al., Potentiation of NF-kappaB-dependent transcription and inflammatory mediator release by histamine in human airway epithelial cells. Br. J. Pharmacol. 2007, 152, 891–902. [31] Shimamoto, K., Hayashi, H., Taniai, E., Morita, R. et al., Antioxidant N-acetyl-L-cysteine (NAC) supplementation reduces reactive oxygen species (ROS)-mediated hepatocellular tumor promotion of indole-3-carbinol (I3C) in rats. J. Toxicol. Sci. 2011, 36, 775–786. [32] Shih, A. Y., Imbeault, S., Barakauskas, V., Erb, H. et al., Induction of the Nrf2-driven antioxidant response confers neuroprotection during mitochondrial stress in vivo. J. Biol. Chem. 2005, 17, 22925–22936. [33] Kalayarasan, S., Prabhu, P. N., Sriram, N., Manikandan, R. et al., Diallyl sulfide enhances antioxidants and inhibits inflammation through the activation of Nrf2 against gentamicin-induced nephrotoxicity in Wistar rats. Eur. J. Pharmacol. 2009, 15, 162–171. [34] Giaime, E., Yamaguchi, H., Gautier, C. A., Kitada, T. et al., Loss of DJ-1 does not affect mitochondrial respiration but increases ROS production and mitochondrial permeability transition pore opening. PLoS One 2012, 7, e40501. [35] Inden, M., Taira, T., Kitamura, Y., Yanagida, T. et al., PARK7 DJ-1 protects against degeneration of nigral dopaminergic neurons in Parkinson’s disease rat model. Neurobiol. Dis. 2006, 24, 144–158. [36] Yanagisawa, D., Kitamura, Y., Inden, M., Takata, K. et al., DJ-1 protects against neurodegeneration caused by focal cerebral ischemia and reperfusion in rats. J. Cereb. Blood Flow Metab. 2008, 28, 563–578. [37] Aleyasin, H., Rousseaux, M. W., Phillips, M., Kim, R. H. et al., The Parkinson’s disease gene DJ-1 is also a key regulator of stroke-induced damage. Proc. Natl. Acad. Sci. USA 2007, 20, 18748–18753. [38] Clements, C. M., McNally, R. S., Conti, B. J., Mak, T. W. et al., DJ-1, a cancer- and Parkinson’s disease-associated protein, stabilizes the antioxidant transcriptional master regulator Nrf2. Proc. Natl. Acad. Sci. USA 2006, 10, 15091–15096. [39] Sriram, N., Kalayarasan, S., Sudhandiran, G., Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2-Keap1 signaling. Pulm. Pharmacol. Ther. 2009, 223, 221–236. www.mnf-journal.com
1069
DOI 10.1002/mnfr.201300617
RESEARCH ARTICLE
Diallyl sulfide as a potential dietary agent to reduce TNF-␣- and histamine-induced proinflammatory responses in A7r5 cells Cheng-Ying Ho1 , Chia-Jui Weng3 , Jhih-Jia Jhang1 , Yu-Ting Cheng1 , Shang-Ming Huang1 and Gow-Chin Yen1,2 1
Department of Food Science and Biotechnology, National Chung Hsing University, Taichung, Taiwan Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan 3 Graduate Institute of Applied Living Science, Tainan University of Technology, Yongkang Distric, Tainan City, Taiwan 2
Scope: Oxidative stress-aggravated chronic inflammatory diseases of the airway are well documented; hence, treatment with antioxidants to ameliorate oxidative stress might be an effective strategy to reduce airway complications. The aim of this study was to investigate the effect and molecular mechanism of diallyl sulfide (DAS), which is a natural organosulfuric compound found in garlic, on the inhibition of tumor necrosis factor-alpha (TNF-␣)- or histamine-induced inflammation in rat aortic smooth muscle A7r5 cells. Methods and results: A7r5 cells were coincubated with DAS before exposure to TNF-␣ or histamine. DAS significantly blocked the accumulation of the nuclear p65 protein in TNF-␣induced A7r5 cells by attenuating the TNF-␣ receptor complex through the dissociation of the TNF receptor-associated death domain and TNF receptor-associated factor 2. Moreover, DAS inhibited histamine-induced inflammation by decreasing reactive oxygen species (ROS) levels by enhancing the nuclear factor-erythroid 2-related factor 2-related antioxidative enzyme. DAS also inhibited inflammation by suppressing interleukin-1 and TNF-␣ through the inhibition of ROS-induced PI3K/Akt and the downstream NF-B and activator protein-1. Conclusion: Our results demonstrate that DAS is a potential phytochemical to inhibit TNF-␣and histamine-induced inflammation, suggesting that DAS might be an effective dietary agent for the prevention of oxidative stress-induced inflammation of the airway.
Received: August 22, 2013 Revised: November 20, 2013 Accepted: November 24, 2013
Keywords: Diallyl sulfide / Histamine / Inflammation / Nrf2 / TNF-␣
1
Introduction
Asthma is a complex chronic inflammatory disease of the airways that involves the activation of many inflammatory and structural cells, which release inflammatory mediators Correspondence: Professor Gow-Chin Yen, Department of Food Science and Biotechnology, National Chung Hsing University, 250 Kuokuang Road, Taichung 40227, Taiwan E-mail: [email protected] Fax: +886-4-2285-4378 Abbreviations: AP-1, activator protein-1; DAS, diallyl sulfide; GPx, glutathione peroxidase; GR, glutathione reductase; HO-1, heme oxygenase-1; MTT, 3-(4,5-dimethyl-thiazol-2-yl)-2,5diphenyltetrazolium bromide; NAC, N-acetyl-L-cysteine; NQO1, NAD(P)H quinone oxidoreductase 1; ROS, reactive oxygen species; SOD, superoxide dismutase; TNF-␣, tumor necrosis factor alpha; TRADD, TNF receptor-associated death domain; TRAF2, TNF receptor-associated factor 2 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
to induce the typical pathophysiology of asthma [1]. Reactive oxygen species (ROS) are generated by several inflammatory cells and are overproduced in asthma patients; this observation suggests that ROS might participate in airway inflammation. Tumor necrosis factor-␣ (TNF-␣) is a cytokine that responds to innate immunization, providing immediate defense against foreign organisms before the adaptive immune system is activated [2]. The mRNA and protein levels of TNF-␣ were high in the airways of patients with asthma [3]. High levels of TNF-␣ in the blood or other bodily fluids might cause oxidative damage and impair the physiological ROS and antioxidant defense systems. Hence, it is supposed that TNF-␣ might correlate with the inflammatory response in the asthmatic airway. The development of airway hyperresponsiveness and airway neutrophilia was observed in normal subjects who were administered inhaled recombinant TNF-␣ [4, 5]. Previously, the mechanisms that direct TNF-␣-induced airway hyperresponsiveness were www.mnf-journal.com
1070
C.-Y. Ho et al.
unclear. Several properties of TNF-␣, such as the recruitment of neutrophils, the induction of glucocorticoid resistance, the proliferation of monocytes, and the stimulation of fibroblast growth and maturation into myofibroblasts, are relevant to airway inflammation [6], which suggests that TNF-␣ might play a central role in severe refractory asthma. Histamine is also considered an important proinflammatory mediator in the pathophysiology of bronchial asthma [7, 8]. A variety of symptoms that resemble asthma, such as the contraction of smooth muscle of the airway, vasodilation, plasma exudation, and mucus production, are induced by histamine in an acute allergic reaction [9]. Other acute symptoms in the vascular endothelium and bronchial and smooth muscle cells, such as acute rhinitis, bronchospasm, cramping, diarrhea, or cutaneous wheal-and-flare responses, are also triggered by histamine [10]. Elevated histamine levels have been noted in the skin and plasma of patients with atopic dermatitis [11] and chronic urticaria [12]. Moreover, high levels of histamine are also observed in the plasma and synovial fluid of patients with rheumatoid arthritis and in the plasma of patients with psoriatic arthritis [13]. It can be inferred from these studies that histamine might be able to regulate immune responses and chronic phase inflammatory events. Accordingly, several studies on remedying asthma are aimed at minimizing the undesirable responses of cells or tissue that are induced by TNF-␣ and histamine. Diallyl sulfide (DAS) is a natural organosulfuric compound that is plentiful in garlic and is beneficial to human health [14, 15]. It has been reported that DAS possesses the ability to induce apoptosis in a human colon cancer cell line [16] and to modulate phase-II drug metabolizing enzymes, which include glutathione S-transferase and [NAD(P)H quinone oxidoreductase 1] NQO1; the detoxifying function of DAS has also been demonstrated [17]. We recently demonstrated that DAS enhanced the activity of pulmonary antioxidant enzymes via the activation of Nrf2 in SD rats and in human embryonic MRC-5 lung cells [18]. Because the inflammatory events can be inhibited via a reduction in oxidative stress by antioxidant enzymes, we investigated the inhibitory effect of DAS on TNF-␣- or histamineinduced inflammation in rat aortic smooth muscle A7r5 cells and explored the molecular mechanism underlying this inhibition.
2
Materials and methods
2.1 Chemicals DMEM, fetal bovine serum, trypsin-EDTA (TE), L-glutamine, and penicillin-streptomycin antibiotic solution were obtained from Gibco BRL (Grand Island, NY, USA). DAS was obtained from Alfa Aesar (Ward Hill, MA, USA). AntiHO-1 and anti-Nrf2 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-PI3K, anti-phospho-PI3K, anti-Akt, anti-phospho-Akt, anti C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2014, 58, 1069–1078
c-Fos, anti-c-Jun, anti-p65, anti-TNFR1, anti-TRADD, antiTRAF2, anti-lamin B1, and anti--actin antibodies were obtained from Cell Signaling Technology (Beverly, MA, USA). N-acetyl-L-cysteine (NAC) and 3-(4,5-dimethyl-thiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Protein molecular mass markers were obtained from Pharmacia Biotech (Saclay, France). TRIzol and Wortmannin were obtained from Invitrogen (Carlsbad, CA, USA). All fine chemicals were obtained from Showa Chemical (Tokyo, Japan) or Sigma-Aldrich (St. Louis, MO, USA).
2.2 Cell culture The rat smooth muscle thoracic aorta A7r5 cell line (BCRC 60082) was obtained from the Bioresource Collection and Research Center (BCRC, Food Industry Research and Development Institute, Hsinchu, Taiwan). Cells were grown in DMEM supplemented with 10% fetal bovine serum at 37⬚C in a humidified atmosphere of 95% air and 5% CO2 . The culture medium was renewed each day. Cells were subcultured weekly with 0.1% trypsin and 10 mM EDTA in PBS.
2.3 Cell survival assay The toxicities of TNF-␣, histamine, and DAS to A7r5 cells were measured by MTT analysis. Briefly, A7r5 cells (1 × 105 cells/mL) were seeded into 96-well microtiter plates. After the cells were coincubated with TNF-␣, histamine, or DAS, the medium was removed and replaced with fresh medium containing 0.5 mg/mL MTT for 2 h at 37⬚C. The original yellow MTT was converted into violet crystals by living cells and was subsequently dissolved in DMSO. The optical density was measured at 570 nm using a BMG LABTECH FLUOstar fluorescence reader (Jena, Germany). DAS was dissolved in DMSO, and the concentration of DMSO was used less than in 0.1% v/v for the experiments.
2.4 RNA extraction and RT-PCR Treated cells were washed three times with PBS, and TRIzol was used to extract the total RNA. The RevertAid First Strand cDNA synthesis kit (Fermentas, Glen Burnie, MD, USA) was used to translate RNA into cDNA, and Taq DNA polymerase (Fermentas, Glen Burnie, MD, USA) was used to amplify the desired cDNA sequence. The primers used for PCR to amplify the target genes were as follows: TNF-␣, forward: AGCACAGAAAG CATGATCCG, reverse: CTGATGAGAGGGAGGCCATT; interleukin-1 (IL-1), forward: GCGAGACTTCTCAC CAAACA, reverse: GTTACCCCCATGACTCCAGA; catalase, forward: AGAGCGGATTCCTGAGAGAGTG, reverse: CAAACCCAC www.mnf-journal.com
1071
Mol. Nutr. Food Res. 2014, 58, 1069–1078
GAGGGTCACGAAC; superoxide dismutase (SOD), forward: GTTGGAGACCTGGGCAATGTGG, reverse: CCACAAGCCAAGCGGCTTCCAG; glutathione peroxidase (GPx), forward: GTGCGAGGTGAATGGTGAGAAG, reverse: TGCTGTATCTGCGCACTGGAAC; glutathione reductase (GR), forward: ACATCCCTACCGTGGTCTTCAG, reverse: GCCAACCACCTTCTCCTCTTTG; heme oxygenase-1 (HO-1), forward: CCGTGGCAGTGGGAATTTATGC, reverse: TGCCAGGCATCTCCTTCCATTC; NQO1, forward: AGCGGCTCCATGTACTCTCTGC, reverse: TC CTCCCAGACAGTCTCCAGAC; GAPDH, forward: TTG GAGGGCAAGTCTGGTG, reverse: CCGCTCCCAAGATC CAACTA. The PCR products were separated by electrophoresis on a 1.0% agarose gel, and the DNA bands were detected using the SYBR Safe DNA gel stain (Invitrogen, Carlsbad, CA, USA). The gel was then photographed using a BioDoc-It system (UVP, Cambridge, UK). The results were expressed as the ratio of each DNA signal relative to the corresponding GAPDH signal.
2.5 Nuclear/cytosol extract preparation The DAS-treated and -untreated cells were centrifuged at 13 000 × g for 5 min at 4⬚C. The collected cells were lysed using a Nuclear/Cytosol Fractionation Kit (BioVision, Mountain view, CA, USA) and centrifuged at 13 000 × g for 5 min. The supernatant was collected as cytosol extract, and the pellet was mixed with Nuclear Extraction Reagents and vortexed for 15 s. This mixture was then centrifuged at 13 000 × g for 10 min, and the supernatant was collected as nuclear extract. The protein concentrations of the extracts were determined by the bicinchoninic acid assay using a commercial protein reagent kit (Bio-Rad, Hercules, CA, USA).
2.6 Immunoprecipitation After coincubation with DAS or TNF-␣, the A7r5 cells were harvested in radioimmunoprecipitation (RIPA) lysis buffer (Millipore, Billerica, MA). The immunoprecipitation of TNFR1 complexes was performed using the Catch and Release v2.0 reversible immunoprecipitation system (Millipore) according to the manufacturer’s instructions.
according to the manufacturer’s instructions (SAbioscience, Frederick, MD, USA).
2.8 Western blotting The treated cells were lysed in RIPA buffer. The lysate was mixed with 4× protein loading dye (8% SDS, 0.04% Coomassie Blue R-250, 40% glycerol, 200 mM Tris-HCl (pH 6.8), and 10% 2-mercaptoethanol) and boiled at 100⬚C for 10 min to yield the sample solution. The sample solution was then subjected to SDS polyacrylamide gel electrophoresis, and the separated proteins were transferred onto cellulose nitrate membranes (Sartorius Stedim Biotech, Germany). The membranes were incubated with various primary antibodies (TNF-R1, TRADD, TRAF2, Nrf2, p65, phospho-IB␣, IB␣, c-Jun, c-Fos, phospho-PI3K, PI3K, phospho-Akt, Akt, lamin B1, or -actin; 1:1000 dilutions) overnight and then further incubated with horseradish peroxidase-conjugated secondary antibody (1:5000 dilutions). The signal was analyzed using the Chemiluminescent ECL detection system (Millipore), and the signal intensity was quantified using Vision Works LS 6.3.3 (UVP, Cambridge, UK). The protein levels were normalized relative to lamin B1 or -actin.
2.9 Intracellular ROS production assay The generation of intracellular ROS was detected using a fluorescent probe, 5-(and-6)-carboxy-2 ,7 -dichlorodihydrofluoresceindiacetate (DCF-DA, Molecular Probes, Eugene, OR, USA). DCF-DA diffuses readily through the cell membrane and is enzymatically hydrolyzed by intracellular esterases to form nonfluorescent DCFH, which is then rapidly oxidized to form highly fluorescent DCF in the presence of ROS. The fluorescence intensity of DCF is thus proportional to the amount of intracellular ROS. At the end of incubation, 105 cells/mL were collected and resuspended in PBS. An aliquot of the suspension (195 L) was loaded into a 96-well plate, and 5 L of DCF-DA was added (final concentration: 20 M). The DCF fluorescence intensity was detected at different time points using a FLUOstar galaxy fluorescence plate reader (BMG Labtechnologies, Offenburg, Germany) with an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
2.7 Nrf2 siRNA transfection A7r5 cells were seeded into 60-mm cell culture dishes at 1 × 105 cells/dish 18–24 h prior to transfection. Cells were transfected in Opti-MEM (Invitrogen, Carlsbad, CA, USA) with 100 nM of the following Nrf2 siRNA sequences: 5 -GAGUAUGAGCUGGAAAAACtt-3 and 5 -CCUUAUAUCUCGAAGUUUUtt-3 for 24 h. The transfection was performed using SureFECT transfection reagent C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
2.10 Statistical analysis All data are expressed as the mean ± SD. ANOVA was used to evaluate differences between multiple groups. Significant differences were subjected to Duncan’s test to compare the means of two specific groups. A p value < 0.05 was considered significant. www.mnf-journal.com
1072
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 1. The time-dependent effect of TNF-␣ stimulation on the expression of TNF-␣ and IL-1 mRNA in A7r5 cells. Cells were incubated with 10 ng/mL TNF-␣ for 0, 0.5, 1, 2, or 3 h. Total RNA was prepared from each culture for RT-PCR (A). The effect of DAS on the expression of TNF-␣ and IL-1 mRNA in TNF-␣-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) for 1 h and were then exposed to 10 ng/mL TNF-␣ for 2 h. (B). PCR products corresponding to TNF-␣, IL-1, and GAPDH were analyzed by agarose gel (1.0%) electrophoresis. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with TNF-␣-treated cells only.
3
Results
3.1 Effect of DAS on the mRNA expression of inflammatory mediators in TNF-␣-treated A7r5 cells The cytotoxicity of TNF-␣ against A7r5 cells was examined by an MTT assay. A 24-h incubation of A7r5 cells in a medium that contained 1–10 ng/mL TNF-␣ did not significantly decrease the cell viability (data not shown). To explore whether TNF-␣ influenced the expression of inflammatory genes that could induce airway inflammation, A7r5 cells were treated with TNF-␣ at a noncytotoxic dose (10 ng/mL) for 0–3 h, and the expression levels of TNF-␣ and IL-1 were analyzed. The expression of TNF-␣ and IL-1 mRNAs increased significantly (p < 0.05) for the incubations at 0.5, 1, and 2 h compared with the control (Fig. 1A). The maximum expression of these mRNAs with the treatment of TNF-␣ was observed at 2 h; therefore, this incubation time was applied to the subsequent experiments. When A7r5 cells were pretreated with DAS (7.5 or 15 M) for 1 h and then exposed to 10 ng/mL TNF-␣ for 2 h, the TNF-␣-enhanced expression of TNF-␣ and IL-1 mRNAs was significantly (p < 0.05) suppressed by 15 M DAS (Fig. 1B).
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
3.2 Effect of DAS on the protein level of p65 and the assembly of TNF-R1 in TNF-␣-treated A7r5 cells To identify the potential transcription factors that are responsible for the upregulation of TNF-␣-related inflammatory mediator genes, the protein levels of cytosol and nuclear p65 in A7r5 cells with and without TNF-␣ treatment was evaluated. Treatment with 10 ng/mL TNF-␣ resulted in a 2.1-fold increase in nuclear p65 (a NF-B subunit) compared with the control (Fig. 2A). When A7r5 cells were pretreated with 15 M DAS for 1 h and were then exposed to 10 ng/mL TNF-␣ for 2 h, the TNF-␣-elevated levels of the nuclear p65 protein decreased markedly (Fig. 2A). It is known that TNF-␣ signaling is transduced through its binding to TNF-␣ receptor type 1 (TNF-R1), which is expressed in most tissues. Therefore, we proposed that the DAS-downregulation of TNF-␣-induced p65 might also result from the inactivation of the TNF-R1 complex. To evaluate the effect of DAS on the TNF-R1 complex, the protein levels of the TNF receptor-associated death domain (TRADD) and TNF receptor-associated factor 2 (TRAF2) in A7r5 cells were examined by Western blotting under the conditions described above. The results in Fig. 2B showed that the protein levels of TRADD and TRAF2 were elevated by TNF-␣ treatment, and this increase was markedly inhibited by treatment
www.mnf-journal.com
Mol. Nutr. Food Res. 2014, 58, 1069–1078
1073
Figure 2. The effect of DAS on the protein level of p65 (A) and on the regulation of TNF-R1 assembly (B) in TNF-␣-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) for 1 h and then exposed to 10 ng/mL TNF-␣ for 2 h. (A) The protein level was analyzed by Western blotting using each specific antibody. The bands were quantified using a densitometer, and the p65 density value was normalized to the value of the corresponding -actin (cytosolic extract) or lamin B1 (nuclear extract) band. (B) Cell lysates were used for immunoprecipitation. The protein levels of TRADD, TRAF2, and TNF-R1 were analyzed by Western blotting using the corresponding specific antibodies. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments.
with 15 M DAS. Taken together, these results indicate that DAS can inhibit the TNF-␣-induced mRNA expression of TNF-␣ and IL-1 in A7r5 cells by reducing the activation of NF-B via the regulation of TNF-R1 complex assembly.
ment with DAS and NAC (Figs. 3B and C). According to the effective concentration, DAS should be a stronger inhibitor of the histamine-stimulated formation of intracellular ROS and the expression of TNF-␣ and IL-1 mRNA than is NAC.
3.3 Effect of DAS on the formation of intracellular ROS and the expression of TNF-␣ and IL-1 mRNA in histamine-treated A7r5 cells
3.4 Effect of DAS on the PI3K/Akt pathway and the activations of NF-B and AP-1 in histamine-induced A7r5 cells
The cytotoxicity of histamine against A7r5 cells was examined by an MTT assay. The cell viability did not decrease significantly after the cells were incubated in a medium that contained 0.1–5 M histamine for 24 h (data not shown). To investigate the influence of histamine on the expression of TNF-␣ and IL-1 mRNA, A7r5 cells were treated with 0.1, 0.5, 1, or 5 M of histamine for 3 h or with 1 M of histamine for 0.5, 1, 2, or 3 h. The maximum expression of mRNA was shown at a treatment of 1 M histamine for 3 h (data not shown). When DCF-DA staining was used to measure the intracellular accumulation of ROS, the formation of ROS in A7r5 cells exhibited a time-dependent increase during treatment with 1 M histamine (Fig. 3A). To verify that DAS could inhibit the histamine-induced production of ROS and the expression of the inflammatory gene NAC, which induces Nrf2 and scavenges free radicals, was employed as the reference. A7r5 cells were pretreated with DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h, and the cells were then exposed to 1 M histamine for 3 h. As a result, the histamine-stimulated ROS and the expression of TNF-␣ and IL-1 mRNA in A7r5 cells were markedly suppressed by treat-
To determine whether PI3K/Akt signals are responsible for the regulation of ROS formation and inflammatory mediator expression, the levels of phosphorylated PI3K and Akt were examined in histamine-stimulated A7r5 cells with or without DAS and NAC treatment. As shown in Fig. 4A, the protein levels of phosphorylated PI3K and Akt were significantly (p < 0.05) elevated in histamine-treated A7r5 cells compared with the control cells. However, the stimulation of PI3K and Akt expression by histamine was significantly inhibited by DAS and NAC (p < 0.05). NF-B and activator protein-1 (AP-1) are well-known transcription factors that are downstream of the PI3K/Akt pathway, which is involved in the transduction of the stimulation of ROS [19, 20], and AP-1 is highly expressed in vivo at inflammatory sites [21]. We further evaluated the status of c-Fos and c-Jun (AP-1 subunits) and phospho-p65 in histamine-stimulated A7r5 cells with or without DAS and NAC treatment. The immunoblots showed that the nuclear and cytosolic p65 were markedly increased and decreased, respectively, in histamine-treated cells compared with the untreated controls; additionally, DAS and NAC can markedly suppress the translocation of p65 from the cytosol into the
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
1074
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 3. The effect of DAS on the levels of inflammatory mediators in histamine-treated A7r5 cells. (A) The time-dependent effect of histamine on the production of ROS in A7r5 cells. Cells were incubated with 1 M histamine for 0, 0.5, 1, 2, or 3 h, and ROS production was analyzed using a FLUOstar galaxy fluorescence plate reader with the fluorescent probe DCFHDA (20 M), as described in section 2. (B) Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and were then exposed to 1 M histamine for 3 h, and the production of ROS was determined. (C) Total RNA was prepared from each of the cell cultures in (B) to perform RT-PCR to analyze the expression of TNF-␣ and IL-1 mRNA. The intensity of each gene-specific band was normalized to the corresponding internal control (GAPDH). Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
nucleus (Fig. 4B). The nuclear c-Fos and c-Jun were also induced by histamine, and the induced-c-Fos and -c-Jun can be reduced by the treatment with DAS and NAC (Fig. 4C). Moreover, we used Wortmannin (PI3K inhibitor) for demonstrating the relationships between PI3K and NF-B and AP-1. As shown in Fig. 4D, the activations of NF-B and AP-1-induced by histamine were inhibited through Wortmannin (20 M) treatment for 1 h in A7r5 cells. The results were consistent with the phosphorylation of PI3K (Fig. 4A). Taken together, the results of Figs. 3 and 4 suggest that the mechanism of DAS on the inhibition of inflammatory mediators is similar to that of NAC and occurs at least partly through the suppression of the activation of NF-B and AP-1 via the PI3K/Akt pathway.
DAS/NAC. Moreover, for confirming the role of Nrf2 under histamine condition, we checked the levels of NF-B and AP-1 through silencing Nrf2 in A7r5 cells. We found that the expressions of NF-B and AP-1 as well as the ROS production in histamine and siNrf2 treatments were higher than in histamine treatment alone (Fig. 5C and D). These data strongly suggest that DAS inhibited the activations of inflammatoryrelated transcription factors (NF-B and AP-1) and inflammatory mediators (ROS, TNF-␣, and IL-1) through directly enhancement of Nrf2-related antioxidant enzymes. Taken together, the results of Sections 3.3–3.5 indicate that DAS might inhibit the histamine-induced inflammatory mediators by enhancing Nrf2-related antioxidant enzymes that scavenge ROS and therefore suppress the activation of NF-B and AP-1.
3.5 Effect of DAS on the translocation of Nrf2 and the Nrf2-related mechanisms in histamine-treated A7r5 cells
4
When A7r5 cells were treated with 1 M histamine for 3 h, the protein expression of DJ-1 and the translocation of Nrf2 from the cytosol into the nucleus were attenuated, whereas the histamine-reduced level of DJ-1 and the translocation of Nrf2 were elevated by treatment with DAS or NAC (Fig. 5A). Because the translocation of Nrf2 is affected by histamine and DAS/NAC, the impacts of histamine and DAS/NAC on several Nrf2-related antioxidant enzymes were investigated further. As shown in Fig. 5B, the mRNA expression levels of catalase, SOD, GPx, GR, HO-1, and NQO1 in A7r5 cells were decreased by histamine but were increased by treatment with C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Discussion
ROS are free radicals that include the superoxide radical anion, hydroxyl radical, singlet oxygen, and hydrogen peroxide. Macrophages/monocytes, innate cytokines, and innate receptors are involved in ROS-induced inflammation and might play a causal role in the early stages of airway inflammation. The release of ROS causes cell and tissue damage that is associated with the occurrence of several chronic lung inflammatory diseases [22,23]. The contributions of cytokines and oxidative stress to airway inflammation were demonstrated in several cellular models that simulate the inflammatory state [1]. TNF-␣ is a critical cytokine for the regulation of cellular physiologies, such as apoptosis, proliferation, and inflammation [24]. In the present study, we used TNF-␣ to www.mnf-journal.com
Mol. Nutr. Food Res. 2014, 58, 1069–1078
1075
Figure 4. The effect of DAS on the transcription factors NF-B and AP-1 in histamine-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and then exposed to 1 M histamine for 3 h. The cytosolic and nuclear proteins were extracted and used for Western blot analyses with the indicated specific antibodies. The phospho-PI3K, PI3K, phospho-Akt, Akt (A), phospho-IB␣, IB␣, p65 (B), c-Fos, and c-Jun (C) bands were quantified by a densitometer. (D) Cells were pretreated with or without Wortmannin (20 M) for 1h and then treated present or absent DAS (15 M) for 1 h and the cells were then exposed to 1 M histamine for 3 h. The nuclear proteins were extracted and analyzed by Western blotting with the indicated specific antibodies. The bands were quantified by a densitometer. Each band density value was normalized to the value of the corresponding -actin (cytosolic extract) or lamin B1 (nuclear extract) band. Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
induce the expression of TNF-␣ and IL-1 mRNA, which initiates the inflammatory response of A7r5 cells (Fig. 1A). Moreover, in our preliminary study, we observed that DAS treatment led to cytotoxicity at concentrations greater than 25 M (data not shown). Therefore, 15 M of DAS did not induce cytotoxicity in A7r5 cells, and all subsequent experiments in cells were performed using 15 M DAS. In the present study, an increase in nuclear phospho-p65 was also observed in response to the same treatment (Fig. 2A). Moreover, we found that TNF-␣, IL-1, and p65 expression were all markedly reduced by treatment with 15 M DAS (Figs. 1B and 2A). TNF-␣ can trigger the activation of a complex signal transduction pathway, which includes MAPK, nuclear factor-kappa C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
B (NF-B), and apoptotic signaling, by binding to the specific receptor TNFR1 [25]. The TNFR1 signaling complex is composed of many adaptor molecules, e.g. TRADD, RIP, TRAF1, TRAF2, and cIAP-1, in the normal cell membrane. Of these components, the TNFR1-TRADD-TRAF2 complex is a well-known initiator of the inflammatory cascade [24, 26]. The results shown in Fig. 2B demonstrate that treatment with TNF-␣ stimulated the assembly of the signaling complex around TNF-R1 in A7r5 cells. Under normal conditions, TNF-R1 is constitutively expressed on the cell membrane. This observation suggests that in the ordered state of A7r5 cells, TNF-R1 provides a platform through which extracellular-to-intracellular signals are communicated. The information discussed above indicates that TNF-␣ switches www.mnf-journal.com
1076
C.-Y. Ho et al.
Mol. Nutr. Food Res. 2014, 58, 1069–1078
Figure 5. The effect of DAS on the transcription factors Nrf2 and the Nrf2-related mechanisms in histamine-treated A7r5 cells. Cells were pretreated with or without DAS (7.5 or 15 M) or NAC (0.5 or 1 mM) for 1 h and then exposed to 1 M histamine for 3 h. The cytosolic and nuclear proteins were extracted and used for Western blot analyses with the indicated specific antibodies (A). Total RNA was prepared from each culture for RT-PCR to analyze the expression of the catalase, SOD, GPx, GR, HO-1, and NQO1 mRNAs. The intensity of each gene-specific band was normalized to the corresponding internal control (GAPDH) (B). (C) Cells were exposed to 1 M histamine for 3 h under present or absent siNrf2 condition, and the nuclear proteins were extracted and were analyzed by Western blotting with the indicated specific antibodies. (D) The production of ROS was determined using a fluorescent probe DCFH-DA (20 M). Untreated cells were used as a control. The values are recorded as the means ± SD from three independent experiments. # , indicates p < 0.05 compared with the control. *, indicates p < 0.05 compared with histamine-treated cells only.
the signal transduction state by changing the adaptor molecules present in the TNFR1 signaling complex [26]. Because the recruitment of TRADD and TRAF2 can elicit NF-B activation [27], the dissociation of the TNF-␣-induced TRADD and TRAF2 from the TNF-R1-signaling complex by treatment with DAS may lead to the downregulation of NF-B and the facilitation of cell inflammation (Fig. 2). It has been reported that ROS act as key intermediates that are directly involved in the histamine-mediated inflammation pathway [28]. In this study, we revealed that a pathological dose of histamine could promote the formation of intracellular ROS and stimulate inflammation-related cytokines in A7r5 cells (Fig. 3). Using the histamine-induced A7r5 cell model, the inhibitory po C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
tential and mechanism of DAS on inflammatory mediators were analyzed. The data indicate that DAS can downregulate the histamine-induced inflammatory mediators (TNF-␣ and IL-1) by decreasing intracellular ROS formation (Figs. 3B and C). The signals of several chemokines, growth factors, and cytokines are transduced via PI3K/Akt pathways to regulate the activities of the downstream NF-B and AP-1 for controlling numerous physiological reactions in cells [29]. Histamine can promote the phosphorylation of IB␣ and therefore facilitate the translocation of p65 (a NF-B subunit) into the nucleus to enhance the expression of inflammatory factors. Hence, the histamine-affected NF-B is considered to play a key role in www.mnf-journal.com
1077
Mol. Nutr. Food Res. 2014, 58, 1069–1078
the regulation of inflammatory genes [30]. Our study demonstrated that the phosphorylation of PI3K, Akt, and IB␣ in A7r5 cells was induced by histamine and that the phosphorylation of all these proteins was suppressed by treatment with DAS, attenuating the translocation of p65 (Fig. 4A and B). Moreover, the expression levels of the nuclear AP-1 subunits (c-Fos and c-Jun) increased and decreased with histamine and DAS treatment, respectively (Fig. 4C). We also evaluated the expressions of NF-B and AP-1 in A7r5 cells treatment with Wortmannin under histamine condition. The results indicated that DAS inhibits inflammatory mediators through the suppression of the activations of NF-B and AP-1 via the PI3K pathway (Fig. 4D). NAC is a well-known potent antioxidant and ROS-scavenging agent [31]. Because DAS and NAC exerted similar effects on the histamine-treated A7r5 cells, we presumed that the functional mechanism of DAS activity might resemble that of NAC. Taken together, these observations confirmed that DAS can inhibit TNF-␣ and IL-1 by inhibiting the PI3K/Akt pathway and inactivating NF-B and AP-1 by blocking the formation of ROS. It has been documented that DAS offers a cytoprotection by activating Nrf2 and that the activation of Nrf2 promotes the expression of genes that encode antioxidant and detoxifying enzymes [32,33]. Previously, we found that DAS enhanced the status of pulmonary antioxidants through the inactivation of Nrf2 in SD rats and in human embryonic MRC-5 cells [18]. Because this antioxidant property of DAS might contribute to the inhibition of histamine-induced inflammation, we further identified the activity of DAS on the activation of Nrf2 and on the expression of the Nrf2-related antioxidant enzymes in histamine-treated A7r5 cells. A notable decrease in the protein expression of DJ-1, which might be due to the overproduction of ROS [34], was observed in histamine-treated cells (Fig. 5A). DJ-1 protects against Parkinson disease, ischemia/reperfusion injury, and stroke-induced damage by attenuating oxidative stress, and the antioxidant potential of DJ-1 is mediated by Nrf2 [35–38]. The disruption of DJ-1 might decrease the stability of the Nrf2 protein, whereas the restoration of DJ-1 could contrarily decrease the ubiquitination of Nrf2 [38]. Antioxidant enzymes that are present in the fluid of the epithelial lining of the lower respiratory tract are the first line of defense against lung damage. However, persistent oxidative challenge to the lungs gradually depletes the antioxidants in lungs [39]. In the present study, we found that the administration of DAS restored approximately 1.7-fold of the expression of the DJ-1 protein compared with the control, which might result from the elevation of the activation of Nrf2 and the increase in catalase, SOD, GPx, GR, HO-1, and NQO1 under histamine-stimulated conditions (Fig. 5B). Moreover, both of the expressions of NF-B and AP-1 and the production of ROS were elevated through treatment with siNrf2 in A7r5 cells induced by histamine (Fig. 5C and D). The treatment with DAS thereby modulated the levels of antioxidant enzymes to alleviate the oxidative stress in the cells. In conclusion, DAS significantly blocked the nuclear accumulation of phospho-p65 in TNF-␣-induced A7r5 cells by C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
attenuating the TNF-␣ receptor complex by inducing the dissociation of TRADD and TRAF2. Moreover, DAS inhibited histamine-induced inflammation by decreasing the level of ROS formation by activating Nrf2 to enhance the expression of the Nrf2-related antioxidant enzymes, as well as by suppressing the expression of IL-1 and TNF-␣ mRNAs by inhibiting the ROS-induced PI3K/Akt pathway and the downstream NF-B and AP-1 proteins. According to our results, DAS is a phytochemical that can potentially inhibit TNF-␣and histamine-induced inflammation and may be considered a dietary agent to prevent oxidative stress-induced airway inflammation. This research work was supported in part by the National Science Council, NSC101-2313-B-005-046-MY3, Taiwan, and by the Ministry of Education, Taiwan under the ATU plan. The authors have declared no conflict of interest.
5
References
[1] Ho, W. E., Cheng, C., Peh, H. Y., Xu, F. et al., Anti-malarial drug artesunate ameliorates oxidative lung damage in experimental allergic asthma. Free Radic. Biol. Med. 2012, 53, 498–507. [2] Medzhitov, R., Janeway, C. J., Innate immune recognition: mechanisms and pathways. Immunol. Rev. 2000, 173, 89–97. [3] Russo, C., Polosa, R., TNF-alpha as a promising therapeutic target in chronic asthma: a lesson from rheumatoid arthritis. Clin. Sci. 2005, 109, 135–142. [4] Thomas, P. S., Yates, D. H., Barnes, P. J., Tumor necrosis factor-alpha increases airway responsiveness and sputum neutrophilia in normal human subjects. Am. J. Respir. Crit. Care Med. 1995, 152, 76–80. [5] Thomas, P. S., Heywood, G., Effects of inhaled tumour necrosis factor alpha in subjects with mild asthma. Thorax. 2002, 57, 774–778. [6] Brightling, C., Berry, M., Amrani, Y., Targeting TNF-alpha: a novel therapeutic approach for asthma. J. Allergy Clin. Immunol. 2008, 121, 5–10. [7] O’Mahony, L., Akdis, M., Akdis, C. A., Regulation of the immune response and inflammation by histamine and histamine receptors. J. Allergy Clin. Immunol. 2011, 128, 1153–1162. [8] Hirota, N., Risse, P.A., Novali, M., McGovern, T. et al., Histamine may induce airway remodeling through release of epidermal growth factor receptor ligands from bronchial epithelial cells. FASEB J. 2012, 26, 1704–1716. [9] Hamid, Q., Tulic, M., Immunobiology of asthma. Annu. Rev. Physiol. 2009, 71, 489–507. [10] Akdis, C. A., Jutel, M., Akdis, M., Regulatory effects of histamine and histamine receptor expression in human allergic immune responses. Chem. Immunol. Allergy 2008, 94, 67–82. [11] Seike, M., Takata, T., Ikeda, M., Kodama, H. et al., Histamine helps development of eczematous lesions in experimental www.mnf-journal.com
1078
C.-Y. Ho et al.
contact dermatitis in mice. Arch. Dermatol. Res. 2005, 297, 68–74. [12] Tedeschi, A., Asero, R., Marzano, A. V., Lorini, M. et al., Plasma levels and skin-eosinophil-expression of vascular endothelial growth factor in patients with chronic urticaria. Allergy 2009, 64, 1616–1622. [13] Rovensky, J., Imrich, R., Radikova, Z., Simorova, E. et al., Peptide hormones and histamine in plasma and synovial fluid of patients with rheumatoid arthritis and osteoarthrosis. Endocr. Regul. 2005, 39, 1–6. [14] Kalayarasan, S., Sriram, N., Sudhandiran, G., Diallyl sulfide attenuates bleomycin-induced pulmonary fibrosis: critical role of iNOS, NF-B, TNF-␣ and IL-1. Life Sci. 2008, 82, 1142–1153. ´ [15] Castro, C., Lorenzo, A. G., Gonzalez, A., Cruzado, M., Garlic components inhibit angiotensin II-induced cell-cycle progression and migration: Involvement of cell-cycle inhibitor p27Kip1 and mitogen-activated protein kinase. Mol. Nutr. Food Res. 2010, 54, 781–787. [16] Sriram, N., Kalayarasan, S., Ashokkumar, P., Sureshkumar, A. et al., Diallyl sulfide induces apoptosis in Colo 320 DM human colon cancer cells: involvement of Caspase-3, NF-B and ERK-2. Mol. Cell Biochem. 2008, 311, 157–165. [17] Shaik, I. H., George, J. M., Thekkumkara, T. J., Mehvar, R., Protective effects of diallyl sulfide, a garlic constituent, on the warm hepatic ischemia-reperfusion injury in a rat model. Pharm. Res. 2008, 25, 2231–2242. [18] Ho, C. Y., Cheng, Y. T., Chau, C. F., Yen, G. C., Effect of diallyl sulfide on in vitro and in vivo Nrf2-mediated pulmonic antioxidant enzyme expression via activation ERK/p38 signaling pathway. J. Agric. Food Chem. 2012, 60, 100–107. [19] Qi, S., Xin, Y., Guo, Y., Diao, Y. et al., Ampelopsin reduces endotoxic inflammation via repressing ROS-mediated activation of PI3K/Akt/NF-B signaling pathways. Int. Immunopharmacol. 2012, 12, 278–287. [20] Mata, M., Pallardo, F., Morcillo, E. J., Cortijo, J., Piclamilast inhibits the pro-apoptotic and anti-proliferative responses of A549 cells exposed to H2 O2 via mechanisms involving AP-1 activation. Free Radic. Res. 2012, 46, 690–699. [21] Reddy, N. M., Vegiraju, S., Irving, A., Paun, B. C. et al., Targeted deletion of Jun/AP-1 in alveolar epithelial cells causes progressive emphysema and worsens cigarette smoke-induced lung inflammation. Am. J. Pathol. 2012, 180, 562–574. [22] Sugiura, H., Ichinose, M., Oxidative and nitrative stress in bronchial asthma. Antioxid. Redox. Signal. 2008, 104, 785–797. [23] Comhair, S. A., Erzurum, S. C., Redox control of asthma: molecular mechanisms and therapeutic opportunities. Antioxid. Redox. Signal. 2010, 12, 93–124. [24] Wajant, H., Death receptors. Essays Biochem. 2003, 39, 53– 71. [25] Liu, Z. G., Molecular mechanism of TNF signaling and beyond. Cell Res. 2005, 15, 24–27. [26] Hsu, H., Huang, J., Shu, H. B., Baichwal, V. et al., TNFdependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex. Immunity 1996, 4, 387–396. C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2014, 58, 1069–1078
[27] Devin, A., Cook, A., Lin, Y., Rodriguez, Y. et al., The distinct roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits IKK to TNF-R1 while RIP mediates IKK activation. Immunity 2000, 12, 419–429. [28] Graziano, A. C., Cardile, V., Crasc`ı, L., Caggia, S. et al., Protective effects of an extract from Citrus bergamia against inflammatory injury in interferon-gamma and histamine exposed human keratinocytes. Life Sci. 2012, 90, 968–974. [29] Granado-Serrano, A. B., Mart´ın, M. A., Haegeman, G., Goya, L. et al., Epicatechin induces NF-kappaB, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2 p45-related factor-2 (Nrf2) via phosphatidylinositol3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) signalling in HepG2 cells. Br. J. Nutr. 2010, 103, 168–179. [30] Holden, N. S., Gong, W., King, E. M., Kaur, M. et al., Potentiation of NF-kappaB-dependent transcription and inflammatory mediator release by histamine in human airway epithelial cells. Br. J. Pharmacol. 2007, 152, 891–902. [31] Shimamoto, K., Hayashi, H., Taniai, E., Morita, R. et al., Antioxidant N-acetyl-L-cysteine (NAC) supplementation reduces reactive oxygen species (ROS)-mediated hepatocellular tumor promotion of indole-3-carbinol (I3C) in rats. J. Toxicol. Sci. 2011, 36, 775–786. [32] Shih, A. Y., Imbeault, S., Barakauskas, V., Erb, H. et al., Induction of the Nrf2-driven antioxidant response confers neuroprotection during mitochondrial stress in vivo. J. Biol. Chem. 2005, 17, 22925–22936. [33] Kalayarasan, S., Prabhu, P. N., Sriram, N., Manikandan, R. et al., Diallyl sulfide enhances antioxidants and inhibits inflammation through the activation of Nrf2 against gentamicin-induced nephrotoxicity in Wistar rats. Eur. J. Pharmacol. 2009, 15, 162–171. [34] Giaime, E., Yamaguchi, H., Gautier, C. A., Kitada, T. et al., Loss of DJ-1 does not affect mitochondrial respiration but increases ROS production and mitochondrial permeability transition pore opening. PLoS One 2012, 7, e40501. [35] Inden, M., Taira, T., Kitamura, Y., Yanagida, T. et al., PARK7 DJ-1 protects against degeneration of nigral dopaminergic neurons in Parkinson’s disease rat model. Neurobiol. Dis. 2006, 24, 144–158. [36] Yanagisawa, D., Kitamura, Y., Inden, M., Takata, K. et al., DJ-1 protects against neurodegeneration caused by focal cerebral ischemia and reperfusion in rats. J. Cereb. Blood Flow Metab. 2008, 28, 563–578. [37] Aleyasin, H., Rousseaux, M. W., Phillips, M., Kim, R. H. et al., The Parkinson’s disease gene DJ-1 is also a key regulator of stroke-induced damage. Proc. Natl. Acad. Sci. USA 2007, 20, 18748–18753. [38] Clements, C. M., McNally, R. S., Conti, B. J., Mak, T. W. et al., DJ-1, a cancer- and Parkinson’s disease-associated protein, stabilizes the antioxidant transcriptional master regulator Nrf2. Proc. Natl. Acad. Sci. USA 2006, 10, 15091–15096. [39] Sriram, N., Kalayarasan, S., Sudhandiran, G., Epigallocatechin-3-gallate augments antioxidant activities and inhibits inflammation during bleomycin-induced experimental pulmonary fibrosis through Nrf2-Keap1 signaling. Pulm. Pharmacol. Ther. 2009, 223, 221–236. www.mnf-journal.com
