Am J Physiol Regul Integr Comp Physiol 307: R1009–R1017, 2014. First published August 27, 2014; doi:10.1152/ajpregu.00004.2014.

Dietary milk fat globule membrane improves endurance capacity in mice Satoshi Haramizu,* Noriyasu Ota,* Atsuko Otsuka, Kohjiro Hashizume, Satoshi Sugita, Tadashi Hase, Takatoshi Murase, and Akira Shimotoyodome Biological Science Research, Health Science, Kao Corporation, Akabane, Ichikai-machi, Haga-gun, Tochigi Japan Submitted 6 January 2014; accepted in final form 20 August 2014

Haramizu S, Ota N, Otsuka A, Hashizume K, Sugita S, Hase T, Murase T, Shimotoyodome A. Dietary milk fat globule membrane improves endurance capacity in mice. Am J Physiol Regul Integr Comp Physiol 307: R1009 –R1017, 2014. First published August 27, 2014; doi:10.1152/ajpregu.00004.2014.—Milk fat globule membrane (MFGM) comprises carbohydrates, membrane-specific proteins, glycoproteins, phospholipids, and sphingolipids. We evaluated the effects of MFGM consumption over a 12-wk period on endurance capacity and energy metabolism in BALB/c mice. Long-term MFGM intake combined with regular exercise improved endurance capacity, as evidenced by swimming time until fatigue, in a dose-dependent manner. The effect of dietary MFGM plus exercise was accompanied by higher oxygen consumption and lower respiratory quotient, as determined by indirect calorimetry. MFGM intake combined with exercise increased plasma levels of free fatty acids after swimming. After chronic intake of MFGM combined with exercise, the triglyceride content in the gastrocnemius muscle increased significantly. Mice given MFGM combined with exercise had higher mRNA levels of peroxisome proliferator-activated receptor-␥ coactivator 1␣ (Pgc1␣) and CPT-1b in the soleus muscle at rest, suggesting that increased lipid metabolism in skeletal muscle contributes, in part, to improved endurance capacity. MFGM treatment with cyclic equibiaxial stretch consisting of 10% elongation at 0.5 Hz with 1 h on and 5 h off increased the Pgc1␣ mRNA expression of differentiating C2C12 myoblasts in a dose-dependent manner. Supplementation with sphingomyelin increased endurance capacity in mice and Pgc1␣ mRNA expression in the soleus muscle in vivo and in differentiating myoblasts in vitro. These results indicate that dietary MFGM combined with exercise improves endurance performance via increased lipid metabolism and that sphingomyelin may be one of the components responsible for the beneficial effects of dietary MFGM. endurance; milk fat globule membrane; sphingomyelin AS PEOPLE AGE, THEY EXPERIENCE a progressive decline in physical performance accompanied by losses of muscle mass and function, leading to decreased quality of life, including increased risks of morbidity, disability, and mortality (18). Low levels of physical performance are associated with increased risk of dementia in aged adults (48). High-endurance performance is associated with lower blood pressure, visceral adipose fat, plasma insulin, and glucose levels than is lowendurance performance in rats (51). Therefore, improvement or maintenance of physical performance is important not only for athletes but also to support daily active and healthy lifestyles. Both skeletal muscle mass and physiological function are associated with physical performance. Exercise training is generally accepted as a useful strategy to increase the number and function of mitochondria in muscle; these effects are

* S. Haramizu and N. Ota contributed equally to this article. Address for reprint requests and other correspondence: A. Shimotoyodome, Biological Science Research, Health Science, Kao Corporation, 2606 Akabane, Ichikai-machi, Haga-gun, Tochigi 321-3497, Japan (e-mail: [email protected]). http://www.ajpregu.org

accomplished, at least in part, through increases in peroxisome proliferator-activated receptor-␥ coactivator (Pgc1␣) transcription and the ability of muscle to oxidize fat (11, 15). Given the difficulties associated with managing and maintaining a regular exercise program, other strategies, including nutritional approaches, have attracted increased attention. We have developed a method that maintains or improves the endurance capacity of mice through increased muscle fatty-acid oxidation. The method combines physical exercise with long-term consumption of specific food components, including catechins, nootkatone, and resveratrol (29, 30, 31, 32). Milk is the main source of nutrition for newborn mammals and contains carbohydrates, proteins, lipids, electrolytes, and micronutrients. The health benefits of milk are well established and have been reviewed extensively (13, 42). Recent findings have demonstrated that consumption of whole milk by young adults after resistance training can promote muscle protein synthesis and inhibit protein breakdown, leading to improved net muscle protein balance (7, 19, 50). There has been growing interest in the beneficial effects of milk on physical performance, such as during resistance training and endurance sports (42). Milk contains ⬃3% to 5% fat, which is distributed in the form of tiny, spherical droplets or globules, stabilized in the form of an emulsion. The diameter of these fat globule ranges from 0.2 to 15 ␮m, with an average of ⬃4 ␮m. The triglyceride core of the fat globules in milk is surrounded by a thin membrane, called the milk fat globule membrane (MFGM). This membrane, which is 10 to 20 nm in cross section, acts as an emulsifier and protects globules from coalescence and enzymatic degradation. Most (60% to 70%) of the polar lipids in milk, which comprise phospholipids and sphingolipids, are located in the MFGM. The MFGM contains unique polar lipids and membrane-specific proteins, including butyrophilin, lactadoherin, and adidophilin (3, 40). Although some studies have shown the nutritional components and functions of MFGM (43, 47), its nutritional and physiological functions have not been fully investigated. Sphingolipids are highly bioactive molecules present mainly in polar lipids of animal origin (47), and they account for as much as one-third of the MFGM polar lipid fraction. Sphingomyelin is involved in inducing the proliferation of satellite cells and is a key component of muscle regeneration (34). Dietary sphingomyelin contributes to myelination of the central nervous system in developing rats (37). Moreover, administration of sphingosine-L-phosphate or sphingosine, a metabolite of sphingomyelin, improves muscle contractile force in mice (5). Phosphatidylserine, a milk phospholipid, increases exercise capacity in humans (21). More recently, the NAD precursor nicotinamide riboside, which is also found in milk, activates sirtuin activity, enhances mitochondrial gene expression, and protects against diet-induced obesity (2).

0363-6119/14 Copyright © 2014 the American Physiological Society

R1009

R1010

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

Our aims in this study were to investigate the effect of dietary MFGM on endurance capacity in mice and to clarify the mechanism of its beneficial effects on muscular physiology. The findings from this study will help to clarify the potential usefulness of milk in managing physical performance and muscular functions. MATERIALS AND METHODS

Materials MFGM (BSCP) was purchased from MEGGLE Japan (Tokyo, Japan). The composition of MFGM was 43.8% protein, 10.3% carbohydrate, 13.6% lactose, 16.2% phospholipids, 3.0% sphingomyelin, 4.3% ash, 2.4% minerals, 4.5% water, and 1.9% other. Sphingomyelin was prepared from a milk phospholipid (PC-500; Fonterra Japan, Tokyo, Japan). In brief, a homomixer (TK autohomomixer; Tokusyukika Kogyo, Osaka, Japan) was used to homogenize PC-500 in ice-cold acetone. The homogenate was extracted with chloroform: methanol:water (8:4:3), and the chloroform layer was recovered, concentrated under reduced pressure, and hydrolyzed. The resultant chloroform layer was extracted with acetone; the acetone-insoluble fraction was concentrated under reduced pressure and extracted with hexane:methanol:water:28% aqueous ammonia (8:8:3:1). The hexane layer was collected, washed, and concentrated under reduced pressure to obtain a hexane fraction. The hexane fraction was purified by using column chromatography over silica gel (Silica gel 60; Merck, Damstadt, Germany) to obtain purified sphingomyelin (yield, 8%). The sphingomyelin obtained was ⬎98% pure, as determined by highperformance liquid chromatography. According to gas chromatography-flame ionization, the most common long-chain bases were 18:1 (49.3%), 16:1 (22.5%), and 17:1 (7.4%), whereas the most common fatty acids were 23:0 (39.3%), 24:0 (23.5%), and 22:0 (20.7%). Animals and Diets Experiment 1. Male 6-wk-old BALB/c mice obtained from Charles River (Kanagawa, Japan) were maintained at 23 ⫾ 2°C under a 12:12-h light-dark cycle (lights on, 0700 to 1900). BALB/c mice are the most suitable strain for evaluating swimming endurance capacity (28) because they are resistant to diet-induced obesity (11), thus minimizing the potential confounding effects of body fat accumulation, which increases floating ability in water, on endurance capacity. Initial measurements of endurance capacity for swimming were obtained when the mice were 7 wk old; they subsequently were allocated randomly to four groups with different MFGM supplementation levels [control (0%), 0.2%, 0.5%, and 1.0% wt/wt; n ⫽ 8 per group, 4 mice per cage]. All mice were allowed unlimited access to water and a synthetic sphingolipid-free control diet containing 10% (wt/wt) triacylglycerols [consisting mainly of C18:2 (43.6%), C18:1 (41.6%), C18:3 (5.6%), and C16:0 (4.9%) from a blend of rapeseed oil and sunflower oil], 20% casein, 55.5% potato starch, 8.1% cellulose, 2.2% vitamins, 0.2% methionine, and 4% minerals, or the MFGM diet (the control diet supplemented with MFGM at the above-described levels). The mice were maintained on their respective diets for 12 wk. During this period, all mice were exercised in an adjustable-current water pool twice each week, as described later in this paper. Experiment 2. After determination of the optimal dosage of MFGM (experiment 1), we examined the effects of MFGM alone and MFGM combined with regular exercise. Male 6-wk-old BALB/c mice obtained from Charles River (Kanagawa, Japan) were maintained as in experiment 1. Initial measurements of endurance capacity for swimming were obtained when the mice were 7 wk old; mice then were allocated to four groups [control (untreated), MFGM, exercise (Ex), and MFGMEx; n ⫽ 8 mice per group, 4 mice per cage]. Mice in the control and Ex groups were fed the unsupplemented control diet alone; those in the MFGM and MFGMEx groups were fed the control

diet supplemented with 1.0% MFGM (wt/wt). The animals were maintained on their respective diets for 12 wk. During this period, mice in the Ex and MFGMEx groups were exercised in an adjustablecurrent water pool twice each week, as described previously. Experiment 3. Mice were allocated to two groups [control and sphingomyelin (SPM)], according to their initial endurance capacity, as described in experiment 1. Mice in the control group were fed the untreated control diet, whereas those in the SPM group received the control diet supplemented with 0.2% sphingomyelin (wt/wt). The animals were maintained on their respective diets for 12 wk. During this period, all mice were exercised in an adjustable-current water pool twice each week. All animal experiments were conducted at the Experimental Animal Facility of Kao Tochigi Institute. The study was approved by the Animal Care Committee of Kao Tochigi Institute and strictly followed the guidelines of the committee. Swimming exercise and evaluation of endurance capacity. An adjustable-current water pool was used to determine endurance capacity for swimming (27, 28). In brief, we used an acrylic pool (90 cm long ⫻ 45 cm wide ⫻ 45 cm deep) that was filled with water to a depth of 38 cm. The current in the pool was generated by using a pump (type C-P60H; Hitachi, Tokyo, Japan), and the strength of the current was adjusted by opening or closing a valve. The current speed at the surface was measured with a digital current meter (model SV-101–25S; Sankou, Tokyo, Japan) at the start of every swimming session, and we confirmed that the current was maintained at a constant speed. An electric heater maintained the water temperature at 34°C. In preliminary training sessions, 6-wk-old mice were accustomed to swimming for 30 min, three times each week, at a flow rate of 5 l/min during session 1 and of 6 l/min during sessions 2 and 3. At 7 wk of age, the mice were fasted for 2 h before swimming, after which their maximal swim times at a flow rate of 7 l/min were measured twice each week. To reduce the effect of inherent interanimal variations in swimming capacity, we eliminated from the study mice whose mean maximal swim times were 40% longer or shorter than the average swim time of all mice. We also eliminated mice whose maximal swim times varied greatly between the two weekly measurements. By using these criteria, selected mice were divided into experimental groups with similar swimming times. In experiments 1 and 3, the endurance capacity of mice was measured while they swam at a flow rate of 7 l/min once weekly. In experiment 2, the endurance capacity of the mice in the Ex and MFGMEx groups was measured while they swam at a flow rate of 7 l/min once every 2 wk. The mice were exercised in the pool for 30 min at a flow rate of 6 l/min once weekly in experiments 1 and 3 or twice each week (without endurance measurement) in experiment 2 during the 12-wk experimental period. Food Intake A dome-type cover was used on the feeding dish (Roden Cafe, Oriental Yeast, Tokyo, Japan) to prevent scattering of the powdered diet in the cage. Two food dispensers were used for each cage throughout the study. Food intake (g/cage each day) was determined by subtracting the weight of the food remaining from the initial weight, which was obtained on the previous feeding day. Collection of Blood and Tissues At 11 wk into the experiment, blood samples were collected from the tail vein of mice immediately after exercise (6 l/min for 30 min) by using a heparinized hematocrit capillary tube (Vitrex Medical A/S, Herlev, Denmark). On the final day of the 12-wk experiment, blood was collected from the postcaval vein of the mice at rest and anesthetized with sevoflurane (Sevofran, Maruishi Pharmaceutical, Osaka, Japan). Immediately after blood collection, the gastrocnemius, plantaris, and soleus muscles; the epididymal and perirenal white

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

R1011

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

Indirect Calorimetry

Swimming time (min)

50

*

40

*

30

20

Control

0.2

0.5

1.0

MFGM(%) Fig. 1. Dose-dependent effect of milk fat globule membrane (MFGM) intake on swimming endurance capacity after 12 wk of MFGM consumption. Swimming time was measured at a water flow rate of 7 l/min. Values are expressed as means ⫾ SE of eight mice. *Value significantly (P ⬍ 0.05) different from that of the control (0% MFGM) group, according to Dunnett’s t-test.

After 9 to 10 wk of feeding the supplemented diet, we measured oxygen consumption and respiratory quotient to elucidate the effect of MFGM with or without exercise on energy metabolism. We used an indirect calorimetric system equipped with a 16-chamber airtight metabolic cage (ARCO2000-RAT/ANI 16 Chamber System, ArcoSystem, Chiba, Japan), as described previously (33). Each mouse was placed in a chamber for 2 days and allowed to acclimate to the surroundings before measurements were obtained. Oxygen consumption and carbon dioxide production were measured under feeding conditions for 24 h. Respiratory quotient was calculated by dividing the measured values of carbon dioxide production by the measured values of oxygen consumption. During measurement, locomotor activity was recorded with an automated motion analysis system (Actracer2000; ArcoSystem), which detects the amount of centroid fluctuation by using a weighted transducer. Lipid and carbohydrate oxidation were calculated by using the equations of Peronnet and Massicotte (39), under the assumption of no contribution from protein oxidation. Cell Culture and Mechanical Stretching by Using Cyclic Strain

Biochemical Analysis Blood lactate levels and plasma concentrations of nonesterified fatty acids immediately after exercise were measured by using Lactate Pro (Arkley, Kyoto, Japan) and NEFA-C (WAKO Pure Chemical Industries, Osaka, Japan) assays, respectively. The numbers of erythrocytes, leukocytes, and platelets, the hemoglobin concentration, and the hematocrit of heparinized blood obtained from mice at rest were measured with an automatic hematocytometer (Celltac MEK-5258, Nihon Koden, Tokyo, Japan). Plasma was obtained from the blood obtained during resting conditions by centrifugation at 3,500 g for 15 min. Plasma concentrations of glucose, triglycerides, nonesterified fatty acids, aspartate aminotransferase (AST), alanine aminotransferase (ALT), total cholesterol, high-density lipoprotein (HDL) cholesterol, and low-density lipoprotein (LDL) cholesterol, lactate dehydrogenase (LDH), and ketone bodies were measured by using N-A Glu-UL, N-A L TG-H, NEFA-HA, N-A L GOT, N-A L GPT, N-A L T-CHO-H, N-A L HDL, N-A L LDL, N-A L LDH, and T-KB-H assay kits (Nittobo Medical, Tokyo, Japan), respectively. All assays were performed according to the manufacturer’s instructions. Measurement of Glycogen and Triglycerides in Muscle Glycogen levels in the gastrocnemius muscle were determined by using a standard enzymatic technique, as described previously (11). In brief, frozen muscle samples were digested in 30% KOH at 100°C for 30 min. Saturated sodium sulfate was added to the mixture, and glycogen was precipitated by adding 95% ethanol. The solution was then centrifuged at 1,600 g. The supernatant was decanted, and the remaining alcohol was vaporized. Purified glycogen was hydrolyzed in 0.6 N HCl at 100°C for 2 h. Residual glucose was quantified by using a glucose CII test kit (WAKO Pure Chemical Industries). To analyze triglyceride levels, frozen tissues were homogenized and extracted with chloroform:methanol (2:1 vol/vol), as described previously (11) with minor modifications. In brief, chloroform:methanol was added to the homogenate, samples were shaken overnight, and 4 mM MgCl2 (100 ␮l) was added to the solution. The organic layer was collected after centrifugation at 1,000 g for 60 min. The collected sample was dried and resuspended in 1% Triton X-100 in ethanol; triglycerides in the sample were quantified with a TG-E test (Wako Pure Chemical Industries).

Murine C2C12 myoblasts were obtained from the European Collection of Cell Cultures (catalog no. EC91031101; Dainippon Sumitomo Pharma Biomedical, Osaka, Japan). Cells were plated onto flexible-bottom plates (Bioflex Plates Collagen 1; Flexcell International, Hillsborough, NC) coated with poly-L-lysine (1 mg/ml; SigmaAldrich Japan, Tokyo, Japan) and fibronectin (1:100; Sigma-Aldrich Japan) and maintained in DMEM supplemented with 10% FBS and antibiotic-antimycotic mixture (10 ml/l; Gibco, Grand Island, NY) in an atmosphere of 95% air, 5% CO2 at 37°C. To cause differentiation into myotubes, C2C12 myoblasts were grown to subconfluence, and the culture media were replaced with DMEM containing 2% heatinactivated horse serum (Gibco) alone or supplemented with MFGM. During differentiation, the cells experienced cyclic equibiaxial stretch consisting of 10% elongation at 0.5 Hz with 1 h on and 5 h off (FX-5000 Tension System, Flexcell International), as described previously (54). The culture media were replaced with fresh media once each day. The cells were washed once with ice-cold PBS, homogenized (QIASchredder; Qiagen K.K., Tokyo, Japan), and used for RNA extraction.

60

*

Ex Swimming time (min)

adipose tissue; the liver; and the heart were removed and weighed. Tissues were stored at ⫺80°C until analysis.

50

*

MFGMEx

40 30 20 10 0 0

2

4

6

8

10

12

Time (weeks) Fig. 2. Effect of MFGM intake on swimming endurance capacity. Swimming time was measured at a water flow rate of 7 l/min once every 2 wk throughout the 12-wk experimental period. Values are expressed as means ⫾ SE of eight mice. *Value significantly (P ⬍ 0.05) different from that of the control (0% MFGM) group, according to Dunnett’s t-test.

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

R1012

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

Table 1. Body weight, food intake, and tissue weights Body weight, g Food intake, kcal/day Gastrocnemius, mg Plantaris, mg Soleus, mg Heart, mg Epididymal fat, g Perirenal fat, g Liver, g

Control

MFGM

Ex

MFGMEx

36.18 ⫾ 0.98 54.47 ⫾ 1.63 319.3 ⫾ 8.0 49.1 ⫾ 2.1 27.0 ⫾ 1.0 175.9 ⫾ 3.0 0.85 ⫾ 0.05 0.49 ⫾ 0.05 1.67 ⫾ 0.10

36.51 ⫾ 1.24 53.11 ⫾ 1.82 320.6 ⫾ 7.6 48.5 ⫾ 1.9 27.9 ⫾ 0.9 175.2 ⫾ 2.9 0.76 ⫾ 0.09 0.45 ⫾ 0.07 1.79 ⫾ 0.09

35.86 ⫾ 0.22 53.46 ⫾ 0.60 320.9 ⫾ 5.4 47.3 ⫾ 0.9 28.0 ⫾ 0.6 170.9 ⫾ 2.5 0.77 ⫾ 0.03 0.48 ⫾ 0.02 1.55 ⫾ 0.04

35.34 ⫾ 0.77 52.07 ⫾ 0.95 324.1 ⫾ 7.3 48.5 ⫾ 2.3 25.2 ⫾ 1.2 167.2 ⫾ 3.5 0.70 ⫾ 0.06 0.41 ⫾ 0.03 1.60 ⫾ 0.05

Values are expressed as means ⫾ SE of 8 mice. MFGM, milk fat globule membrane; Ex, exercise; MFGMEx, milk fat globule membrane with exercise.

RNA Extraction and Quantitative Real-Time PCR Analysis Total RNA was extracted from frozen soleus muscle by using RNeasy fibrous tissue mini kit (Qiagen K.K.) and from C2C12 cells by using RNeasy mini kit (Qiagen K.K.), according to the manufacturer’s instructions. RNA samples then were used as templates in reverse transcription-PCR for production of cDNA and in real-time PCR with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), as described previously (12). For quantitative precision, the same amount of total RNA was consistently used for each expression analysis, and the expression level of each gene was normalized relative to that of a housekeeping gene— either ribosomal protein, large, P0 (RPLP0/36B4) or GAPDH. The mouse-specific primer sequences used have been described previously (11), except for those for GAPDH, which were forward, TTGTGGAAGGGCTCATGACC; reverse, GATGCAGGGATGATGTTCTGG. Statistical Analysis All values are presented as means ⫾ SE. Statistical analysis was conducted with the StatView software package (SAS Institute, Cary, NC). Swimming times were compared among groups by using Dunnett’s t-test. Two-way ANOVA was used to evaluate the main effects

of diet and exercise and the diet ⫻ exercise interaction. When two-way ANOVA indicated a significant main effect of diet or exercise, comparisons between the control and MFGM groups and between the Ex and MFGMEx groups were made by using unpaired t-tests. A P value of less than 0.05 was considered statistically significant. RESULTS

Effect of MFGM on Swimming Endurance Capacity (Experiments 1 and 2) In experiment 1, swimming time was significantly (P ⬍ 0.05) longer in mice fed the diet supplemented with either 0.5% or 1.0% MFGM than in those fed the control, unsupplemented diet. Swimming endurance increased in a dose-dependent manner. The maximal swimming capacity occurred when the diet was supplemented with 1.0% MFGM (Fig. 1). In experiment 2, swimming time increased throughout the experimental period in mice that exercised regularly, regard-

Table 2. Blood and plasma analysis Control

MFGM

Ex

MFGMEx

88.9 ⫾ 11.9 1011.9 ⫾ 7.7 15.9 ⫾ 0.2 48.9 ⫾ 0.7 80.5 ⫾ 2.5

85.6 ⫾ 10.0 1042.0 ⫾ 24.8 16.0 ⫾ 0.2 50.8 ⫾ 0.8 80.7 ⫾ 2.4

199.9 ⫾ 16.0 253.0 ⫾ 18.0 76.1 ⫾ 12.6 86.3 ⫾ 15.5 151.0 ⫾ 2.7 82.1 ⫾ 1.4† 4.1 ⫾ 0.2 99.4 ⫾ 4.8 86.8 ⫾ 11.3 0.88 ⫾ 0.07 10.2 ⫾ 0.5

192.2 ⫾ 9.9 262.9 ⫾ 40.8 65.7 ⫾ 3.0 81.9 ⫾ 8.3 152.8 ⫾ 3.9 85.0 ⫾ 1.7 4.0 ⫾ 0.2 80.9 ⫾ 9.8 79.6 ⫾ 7.2 0.84 ⫾ 0.06 11.2 ⫾ 0.4#

Blood Components During Resting Condition 2

WBC, 10 /␮l RBC, 104/␮l Hemoglobin, mg/dl Hematocrit, % Platelets, 104/␮l

60.9 ⫾ 6.5 1001.5 ⫾ 20.8 16.0 ⫾ 0.2 49.7 ⫾ 0.9 79.6 ⫾ 1.9

83.0 ⫾ 5.9 1022.1 ⫾ 14.8 15.9 ⫾ 0.2 49.4 ⫾ 0.9 82.7 ⫾ 3.0 Plasma Components During Resting Condition

Glucose, mg/dl LDH, IU/l AST, IU/l ALT, IU/l Total Chol, mg/dl HDL-Chol, mg/dl LDL-Chol, mg/dl Triglyceride, mg/dl Ketone bodies, mg/dl NEFA, mEq/l Adiponectin, pg/ml

213.0 ⫾ 19.2 269.5 ⫾ 33.5 75.1 ⫾ 10.1 101.4 ⫾ 23.2 139.3 ⫾ 5.2 72.7 ⫾ 2.4 4.0 ⫾ 0.2 93.9 ⫾ 12.5 95.2 ⫾ 26.5 0.94 ⫾ 0.14 9.9 ⫾ 0.3

192.2 ⫾ 11.0 266.5 ⫾ 28.2 73.2 ⫾ 7.8 97.9 ⫾ 21.5 143.3 ⫾ 3.9 79.1 ⫾ 2.3 4.2 ⫾ 0.2 90.7 ⫾ 10.4 94.1 ⫾ 17.8 0.89 ⫾ 0.09 9.5 ⫾ 0.4

Plasma Components Immediately After Exercise NEFA, mEq/l Lactate, mmol/l

not tested not tested

not tested not tested

1.59 ⫾ 0.01 4.03 ⫾ 0.05

1.79 ⫾ 0.01* 3.76 ⫾ 0.06

ALT, alanine aminotransferase; AST, aspartate aminotransferases; Chol, cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; NEFA, nonesterified fatty acids; RBCs, red blood cells; WBCs, white blood cells. Values are expressed as means ⫾ SE of 8 mice. Unpaired t-tests identified significant (P ⬍ 0.05) differences between the control and Ex groups (†) and between the MFGM and MFGMEx groups (#) after two-way ANOVA detected a significant exercise-associated effect. An unpaired t-test identified a significant (*P ⬍ 0.05) difference between the Ex and MFGMEx groups. AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

R1013

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

Table 3. Glycogen and triglycerides levels in the gastrocnemius muscle MFGM

Ex

MFGMEx

2.17 ⫾ 0.14

2.77 ⫾ 0.15*

2.64 ⫾ 0.17†

3.14 ⫾ 0.21

4.51 ⫾ 0.39

5.32 ⫾ 0.43

5.26 ⫾ 0.40

6.36 ⫾ 0.29$

Values are expressed as means ⫾ SE of 8 mice. Unpaired t-tests identified significant (P ⬍ 0.05) differences between the control and MFGM groups (*) and between the Ex and MFGMEx groups ($) after two-way ANOVA detected a significant diet-associated effect. An unpaired t-test identified a significant (†P ⬍ 0.05) difference between the control and Ex groups after two-way ANOVA detected a significant exercise-associated effect.

less of MFGM supplementation (Fig. 2). However, from week 10 onward, swimming endurance was significantly (P ⬍ 0.05) greater in mice that received 1.0% MFGM combined with swimming exercise (i.e., the MFGMEx group; week 12 swimming time, 52.3 ⫾ 4.5 min) than in those that exercised but did

A

Regular exercise increased plasma HDL-cholesterol in mice fed the control diet [P ⬍ 0.01 compared with the unexercised control group after detection of a main effect of exercise at P ⬍ 0.05; (Table 2)]. Plasma adiponectin levels were greater in mice that received 1.0% MFGM combined with swimming exercise (P ⬍ 0.05 compared with MFGM group after detection of a main effect of exercise at P ⬍ 0.05). No other blood variables differed between groups under resting conditions. In contrast, plasma NEFA levels immediately after exercise were significantly (P ⬍ 0.05) higher in the MFGMEx group than in the Ex group.

B

60

#$

50

45

40

MFGM

Ex

0.90

MFGM Ex

Control

D

10

*

6

4

2

MFGM

Ex

MFGM Ex

60

N.S.

$ 8

Fat oxidation (mg/ml/kg)

$

0.92

0.86

Control

50

Carbohydrate oxidation (mg/ml/kg)

C

*

0.94

0.88

35

30

0.98

0.96

55

Oxygen consumption (ml/kg/min)

Effect of MFGM on Blood and Plasma Components During Rest and Immediately After Swimming Exercise (Experiment 2)

Respiratory quotient

Glycogen, mg/g wt Triglyceride, mg/g wt

Control

not receive MFGM (the Ex group; 40.1 ⫾ 3.8 min). Neither dietary supplementation with MFGM nor periodic swimming exercise altered food intake, body weight, or tissue weight in any group (Table 1).

40

30

20

10

0

0

Control

MFGM

Ex

MFGM Ex

Control

MFGM

Ex

MFGM Ex

Fig. 3. Effect of MFGM on whole-body energy metabolism. Oxygen consumption (A), respiratory quotient (B), fat oxidation (C), and carbohydrate oxidation (D) during resting conditions were determined by indirect calorimetry. Values are expressed as means ⫾ SE of eight mice. Significant (P ⬍ 0.05) differences between the MFGM and MFGMEx groups (#) were identified by unpaired t-tests after two-way ANOVA revealed a significant exercise-associated effect. Significant (P ⬍ 0.05) differences between the control and MFGM groups (*) and between the Ex and MFGMEx groups ($) were identified by unpaired t-tests after two-way ANOVA revealed a significant diet-associated effect. AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

R1014

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

Pgc1␣ Pgc1␤ Cpt1b Ppar␦

Control

MFGM

Ex

MFGMEx

0.81 ⫾ 0.04 0.94 ⫾ 0.09 0.80 ⫾ 0.08 0.75 ⫾ 0.08

0.99 ⫾ 0.12 1.25 ⫾ 0.11* 1.06 ⫾ 0.06* 0.92 ⫾ 0.07

1.00 ⫾ 0.07† 1.00 ⫾ 0.12 1.00 ⫾ 0.07 1.00 ⫾ 0.09†

1.27 ⫾ 0.08$ 1.36 ⫾ 0.06$ 1.19 ⫾ 0.03$ 1.12 ⫾ 0.05#

Values are means ⫾ SE of 8 mice. Unpaired t-tests identified significant (P ⬍ 0.05) differences between the control and MFGM groups (*) and between the Ex and MFGMEx groups ($) after two-way ANOVA detected a significant diet-associated effect. Unpaired t-tests identified significant (P ⬍ 0.05) differences between the control and Ex groups (†) and between the MFGM and MFGMEx groups (#) after two-way ANOVA detected a significant exerciseassociated effect.

Effect of MFGM on Glycogen and Triglyceride Levels in the Gastrocnemius Muscle Glycogen content in the gastrocnemius muscle was higher in mice given 1.0% MFGM alone (P ⬍ 0.05 between the control and MFGM groups after detection of a main effect of diet at P ⬍ 0.05) and in those with regular exercise alone (P ⬍ 0.05 between the control and Ex groups after detection of a main effect of exercise at P ⬍ 0.05) (Table 3). The muscle triglyceride content in the MFGMEx group was significantly higher than that in the Ex group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05). Effect of MFGM on Whole-Body Energy Metabolism Under Resting Conditions Oxygen consumption during resting conditions was significantly higher in the MFGMEx group than in either the MFGM or the Ex group (P ⬍ 0.05 compared with Ex group after detection of a main effect of diet at P ⬍ 0.05, and P ⬍ 0.05 compared with MFGM group after detection of a main effect of exercise at P ⬍ 0.05) (Fig. 3). Respiratory quotient was significantly lower in the MFGM group than in the control group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05) and in the MFGMEx group than in the Ex group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05). Fat oxidation calculated according to oxygen consumption and respiratory quotient was significantly higher in the MFGM group than in the control group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05) and in the MFGMEx group than in the Ex group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05).

and Ex groups and between the MFGM and MFGMEx groups after detection of a main effect of exercise at P ⬍ 0.05). Effects of MFGM Combined with Mechanical Stretching on mRNA Expression of Pgc1␣ in Differentiating C2C12 Cells Mechanical stretching increased (P ⬍ 0.05) Pgc1␣ mRNA levels in differentiating C2C12 cells compared with those in unstretched control cells. Supplementation of the culture medium with 0.01% MFGM increased (P ⬍ 0.05) Pgc1␣ gene expression in the stretched cells compared with that of unsupplemented mechanically stretched cells (Fig. 4). MFGM supplementation increased Pgc1␣ mRNA levels in a dosedependent manner. In contrast, supplementation with MFGM alone (i.e., in the absence of mechanical stretching) had no effect on Pgc1␣ mRNA expression in differentiating C2C12 cells (data not shown). Effects of Dietary Sphingomyelin on Endurance Capacity and on mRNA Expression of Pgc1␣ Dietary supplementation with sphingomyelin combined with regular exercise for 12 wk significantly increased swimming time and Pgc1␣ mRNA expression in the soleus muscle compared with those in mice that underwent exercise in the absence of MFGM supplementation (Fig. 5, A and B). In addition, sphingomyelin treatment with cyclic equibiaxial stretching significantly increased Pgc1␣ mRNA expression in differentiating C2C12 myoblasts in a dose-dependent manner (Fig. 5C). DISCUSSION

This study yielded three major findings. First, we demonstrated that dietary supplementation with MFGM combined with regular exercise in mice markedly improved endurance capacity in association with increased lipid utilization. We suggest that the increased endurance capacity due to dietary 3

Pgc1α mRNA

Table 4. Relative expression levels in the soleus muscle of genes involved in energy metabolism

1

*

Effect of MFGM on Gene Expression Levels of Fatty Acid Oxidation-Related Molecules in the Soleus Muscle Exercise significantly increased Pgc1␣ mRNA expression in the soleus muscles of mice fed the unsupplemented control diet (P ⬍ 0.05, Table 4). In addition, the MFGMEx group had significantly higher Pgc1␣ mRNA expression than did the Ex group (P ⬍ 0.05 after detection of a main effect of diet at P ⬍ 0.05). mRNA expression levels of Pgc1␤ and Cpt1b were increased by the intake of MFGM, regardless of exercise status (P ⬍ 0.05 between the control and MFGM groups and between the Ex and MFGMEx groups after detection of a main effect of diet at P ⬍ 0.05). Ppar␦ mRNA expression increased with the provision of regular exercise (P ⬍ 0.05 between the control

*

2

0

No Stretch

Control

0.001

0.01

MFGM(%) Stretch Fig. 4. Combined effect of MFGM treatment and cyclic equibiaxial stretching on Pgc1␣ mRNA expression levels in differentiating C2C12 myoblasts. C2C12 cells were incubated for 3 days in differentiation media alone or supplemented with MFGM. The control and MFGM groups underwent cyclic equibiaxial stretching. *Value significantly (P ⬍ 0.05) different from that of the control (0% MFGM) group according to Dunnett’s t-test.

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

A

70

Swimming time (min)

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

60

B

2.0

*

* 1.5

Pgc1α mRNA

50 40 30 20

1.0

0.5

10 0

C

Control

0

SPM

Control

SPM

2.0

† 1.5

Pgc1α mRNA

R1015

1.0

†

Fig. 5. Effect of sphingomyelin on swimming endurance capacity and on Pgc1␣ mRNA expression levels in the soleus muscle and in differentiating C2C12 myoblasts with mechanical stretching. Swimming time (A) after the 12-wk feeding period was measured at a water flow rate of 7 l/min. The soleus muscle was dissected from mice (n ⫽ 8) on the final day of the experiment 3. The Pgc1␣ mRNA expression level in soleus muscle (B) is expressed as a ratio relative to the value in the control group, which was defined as 1.0 (n ⫽ 8). The Pgc1␣ expression level in differentiating myoblasts (C) is expressed as a ratio relative to the value of nonstretched control cells (no-stretch group; n ⫽ 3). Values are expressed as means ⫾ SE. *Value significantly (P ⬍ 0.05, unpaired t-test) different from that of the control group. †Value significantly (P ⬍ 0.05, Dunnett’s t-test) different from that of the no-stretch group.

0.5

0

No Stretch

Control

0.0005

0.001

0.005

SPM(%) Stretch

MFGM is mediated, at least in part, by upregulated fatty acid oxidation in skeletal muscle during exercise. Muscle uses fat and carbohydrate as primary energy sources during prolonged exercise (4, 41). Enhanced fatty acid oxidation during exercise reduces the rate of carbohydrate consumption as an energy source, leading to improved endurance capacity (11, 15). Dietary supplementation of mice with MFGM combined with regular exercise markedly increased lipid consumption for energy metabolism, which resulted in preferential utilization of fatty acids over carbohydrate, which may contribute to increased endurance capacity after ingestion of MFGM. Mice that received MFGM and regular exercise had increased plasma NEFA and muscle triglyceride levels. These results suggest that increased supplies of fatty acids in the circulation and skeletal muscles may also contribute to increased lipid oxidation. In contrast, glycogen content significantly increased after MFGM intake alone but not after MFGM plus exercise. Although several reports have demonstrated that manipulating carbohydrate metabolism influences endurance in humans and mice (9, 26), the beneficial effects of increased muscle glycogen content on endurance capacity remain unconfirmed (14). Endurance capacity remains unchanged in mice that either overexpress glycogen synthase (24) or lack muscle glycogen synthase (38). We speculate that the increased endurance capacity after MFGM intake plus exercise reflects

increased lipid metabolism rather than a glycogen-sparing effect. Second, we found that dietary intake of MFGM combined with regular exercise substantially increased the expression of genes associated with energy metabolism, such as Pgc1␣ and Pgc␤, Cpt1␤ and Ppar␦, in mouse skeletal muscle, perhaps leading to upregulation of energy expenditure and fat catabolism. More importantly, MFGM treatment markedly stimulated Pgc1␣ expression in differentiating myocytes cultured during mechanical stretching, suggesting that absorbed components of MFGM may stimulate the expression of Pgc1␣, a possible mechanism for the enhancement of lipid metabolism by dietary MFGM plus exercise. Pgc1␣ is a transcriptional coactivator that is expressed at high levels in oxidative muscles like the soleus (23); in addition, Pgc1␣ plays key roles in promoting mitochondrial biogenesis (53), peak oxygen uptake (1), lipid oxidation and energy refueling (45, 46), and lipid synthesis (8). Most importantly, muscle-specific Pgc1␣ transgenic mice exhibit improved endurance capacity, whereas muscle-specific Pgc1␣ knockout mice show exercise intolerance (1, 10). Therefore, we consider that the increased expression of Pgc1␣ activates fatty acid oxidation, subsequently improving endurance capacity. Dietary MFGM plus regular exercise increased plasma adiponectin levels in this study. Adiponectin signaling has mul-

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

R1016

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE

tiple fundamental functions in metabolic regulation at the whole body level, such as stimulating energy metabolism and ameliorating insulin resistance (20). Adiponectin upregulates Pgc1␣ gene expression via its specific receptor (AdipoR1) in myocytes (17). Taken together, these studies suggest that dietary MFGM plus exercise increases Pgc1␣ expression by increasing adiponectin production in, or secretion from, adipose tissues. Recent studies found that Ppar␥ activation by agonists promotes adiponectin transcription through a Ppar␥responsive element in the adiponectin promotor (52) and that sphingosine activates Ppar␥ transcriptional activity in macrophages (25). The increased adiponectin level associated with MFGM combined with exercise may be due in part to the activation of Ppar␥ by sphingosine. However, additional studies are needed to elucidate the relationship between adiponectin signaling and the improved energy metabolism and endurance capacity obtained with dietary MFGM or its components (including metabolites) plus exercise. Finally, dietary supplementation with sphingomyelin, a constituent of MFGM, when combined with regular exercise, markedly increased endurance capacity and muscle Pgc1␣ mRNA expression in mice. Similarly, differentiating myoblasts undergoing mechanical stretching also demonstrated upregulation of Pgc1␣ mRNA expression. These results suggest that sphingomyelin is an active component of MFGM for improved endurance capacity and lipid metabolism. Dietary sphingomyelin is hydrolyzed to sphingosine and free fatty acids in the gastrointestinal tract, which are well absorbed and converted into chylomicrons in mucosal cells (36). A small portion of sphingoid bases are reincorporated into mucosal ceramide and sphingomyelin (35). Sphingomyelin accounts for ⬃20% of the phospholipids in human plasma lipoproteins. Recent evidence shows that many of the signaling components involved in sphingomyelin metabolism are present in skeletal muscle (44) and that sphingomyelinase activity and sphingosine levels in muscle increase, and the ceramide level decreases, during prolonged exercise (6), suggesting that sphingomyelin metabolism is activated in exercised muscle. In addition, sphingosine 1-phosphate and sphingosine, which are sphingomyelin metabolites, are reported to have protective effects against muscle fatigue (5). Although sphingosine 1-phosphate and sphingosine may contribute to the enduranceimproving effect of sphingomyelin intake combined with regular exercise, additional study is warranted. One limitation of our study is that we did not examine the effect of the amount of sphingomyelin equivalent to that in the diet containing 1.0% MFGM. Doing so would have clarified whether sphingomyelin is directly responsible for the increased endurance capacity associated with 1.0% MFGM. In addition, treatment with 0.003% sphingomyelin did not increase Pgc1␣ mRNA expression, whereas 0.01% MFGM, which contains a similar amount of sphingomyelin, significantly increased expression. These results suggest that some components present in MFGM have an effect similar to that of sphingomyelin or strengthen the effect of sphingomyelin. Additional studies are needed to clarify this point. In conclusion, our results provide new evidence regarding the beneficial effect of dietary supplementation with MFGM, in the context of regular exercise, on endurance performance and muscular metabolism in mice. Although acute ingestion of whole milk failed to enhance prolonged exercise capacity in

humans (22, 49), repeated ingestion of whey protein isolates increased Pgc1␣ mRNA in the muscle during recovery from exercise in humans (16), suggesting they might enhance endurance capacity. MFGM, which makes up less than 0.5% of whole milk, could be beneficial for improving physical performance and muscular metabolism through upregulation of Pgc1␣ in a similar fashion to that of whey protein. Several ongoing studies will clarify the beneficial effects of dietary MFGM on physical performance and muscular function in humans. ACKNOWLEDGMENTS We thank Satoko Soga and Yukiko Horigane for their support in performing the experiments. DISCLOSURES The present study was supported financially by Kao Corporation. AUTHOR CONTRIBUTIONS Author contributions: S.H. and N.O. conception and design of research; S.H., N.O., A.O., K.H., and S.S. performed experiments; S.H., N.O., A.O., S.S., T.M., and A.S. analyzed data; S.H. and N.O. interpreted results of experiments; S.H. prepared figures; S.H., T.M., and A.S. drafted manuscript; S.H., N.O., K.H., and A.S. edited and revised manuscript; S.H., N.O., A.O., K.H., S.S., T.H., T.M., and A.S. approved final version of manuscript. REFERENCES 1. Calvo JA, Daniels TG, Wang X, Paul A, Lin J, Spiegelman BM, Stevenson SC, Rangwala SM. Muscle-specific expression of PPAR␥ coactivator-1␣ improves exercise performance and increases peak oxygen uptake. J Appl Physiol 104: 1304 –1312, 2008. 2. Cantó C., Houtkooper RH, Pirinen E, Youn DY, Oosterveer MH, Cen Y, Fernandez-Marcos PJ, Yamamoto H, Andreux PA, Cettour-Rose P, Gademann K, Rinsch C, Schoonjans K, Sauve AA, Auwerx J. The NAD⫹ precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab 15: 838 – 847, 2012. 3. Cebo C. Milk fat globule membrane proteomics: a ‘snapshot’ of mammary epithelial cell biology. Food Technol Biotechnol 50: 306 –314, 2012. 4. Coyle EF. Substrate utilization during exercise in active people. Am J Clin Nutr 61: 968S–979S, 1995. 5. Danieli-Betto D, Germinario E, Esposito A, Megighian A, Midrio M, Ravara B, Damiani E, Libera LD, Sabbadini RA, Betto R. Sphingosine 1-phosphate protects mouse extensor digitorum longus skeletal muscle during fatigue. Am J Physiol Cell Physiol 288: C1367–C1373, 2005. 6. Dobrzyn´ A, Goˇrski J. Effect of acute exercise on the content of free sphinganine and sphingosine in different skeletal muscle types of the rat. Horm Metab Res 34: 523–529, 2002. 7. Elliot TA, Cree MG, Sanford AP, Wolfe RR, Tipton KD. Milk ingestion stimulates net muscle protein synthesis following resistance exercise. Med Sci Sports Exerc 38: 667–674, 2006. 8. Espinoza DO, Boros LG, Crunkhorn S, Gami H, Patti ME. Dual modulation of both lipid oxidation and synthesis by peroxisome proliferator-activated receptor-gamma coactivator-1␣ and -1␤ in cultured myotubes. FASEB J 24: 1003–14, 2010. 9. Fueger PT, Shearer J, Krueger TM, Posey KA, Bracy DP, Heikkinen S, Laakso M, Rottman JN, Wasserman DH. Hexokinase II protein content is a determinant of exercise endurance capacity in the mouse. J Physiol 566: 533–541, 2005. 10. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK, Yan Z, Spiegelman BM. Skeletal muscle fiber-type switching, exercise intolerance, and myopathy in PGC-1␣ muscle-specific knock-out animals. J Biol Chem 282: 30014 –30021, 2007. 11. Haramizu S, Nagasawa A, Ota N, Hase T, Tokimitsu I, Murase T. Different contribution of muscle and liver lipid metabolism to endurance capacity and obesity susceptibility of mice. J Appl Physiol 106: 871–879, 2009. 12. Haramizu S, Ota N, Hase T, Murase T. Catechins attenuate eccentric exercise-induced inflammation and loss of force production in muscle in senescence-accelerated mice. J Appl Physiol 111: 1654 –1663, 2011.

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org

MILK FAT GLOBULE MEMBRANE AND PHYSICAL ENDURANCE 13. Haug A, Høstmark AT, Harstad OM. Bovine milk in human nutrition—a review. Lipids Health Dis 6: 25, 2007. 14. Hawley JA, Schabort EJ, Noakes TD, Dennis SC. Carbohydrate-loading and exercise performance. An update. Sports Med 24: 73–81, 1997. 15. Hawley JA, Brouns F, Jeukendrup A. Strategies to enhance fat utilisation during exercise. Sports Med 25: 241–257, 1998. 16. Hill KM1, Stathis CG, Grinfeld E, Hayes A, McAinch AJ. Co-ingestion of carbohydrate and whey protein isolates enhance PGC-1␣ mRNA expression: a randomised, single blind, cross over study. J Int Soc Sports Nutr 10: 8, 2013. 17. Iwabu M, Yamauchi T, Okada-Iwabu M, Sato K, Nakagawa T, Funata M, Yamaguchi M, Namiki S, Nakayama R, Tabata M, Ogata H, Kubota N, Takamoto I, Hayashi YK, Yamauchi N, Waki H, Fukayama M, Nishino I, Tokuyama K, Ueki K, Oike Y, Ishii S, Hirose K, Shimizu T, Touhara K, Kadowaki T. Adiponectin and AdipoR1 regulate PGC-1␣ and mitochondria by Ca2⫹ and AMPK/SIRT1. Nature 464: 1313–1319, 2010. 18. Janssen I, Shepard DS, Katzmarzyk PT, Roubenoff R. The healthcare costs of sarcopenia in the United States. J Am Geriatr Soc 52: 80 –85, 2004. 19. Josse AR, Tang JE, Tarnopolsky MA, Phillips SM. Body composition and strength changes in women with milk and resistance exercise. Med Sci Sports Exerc 42: 1122–1130, 2010. 20. Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 1: 15–25, 2005. 21. Kingsley MI, Miller M, Kilduff LP, McEneny J, Benton D. Effects of phosphatidylserine on exercise capacity during cycling in active males. Med Sci Sports Exerc 38: 64 –71, 2006. 22. Lee JK, Maughan RJ, Shirreffs SM, Watson P. Effects of milk ingestion on prolonged exercise capacity in young, healthy men. Nutrition 24: 340 –347, 2008. 23. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, Spiegelman BM. Transcriptional co-activator PGC-1␣ drives the formation of slow-twitch muscle fibres. Nature 418: 797–801, 2002. 24. Manchester J, Skurat AV, Roach P, Hauschka SD, Lawrence JC Jr. Increased glycogen accumulation in transgenic mice overexpressing glycogen synthase in skeletal muscle. Proc Natl Acad Sci USA 93: 10707– 10711, 1996. 25. Mazzei JC, Zhou H, Brayfield BP, Hontecillas R, Bassaganya-Riera J, Schmelz EM. Suppression of intestinal inflammation and inflammationdriven colon cancer in mice by dietary sphingomyelin: importance of peroxisome proliferator-activated receptor ␥ expression. J Nutr Biochem 22: 1160 –1171, 2011. 26. McConell G, Snow RJ, Proietto J, Hargreaves M. Muscle metabolism during prolonged exercise in humans: influence of carbohydrate availability. J Appl Physiol 87: 1083–1086, 1999. 27. Minegishi Y, Haramizu S, Hase T, Murase T. Red grape leaf extract improves endurance capacity by facilitating fatty acid utilization in skeletal muscle in mice. Eur J Appl Physiol 111: 1983–1989, 2011. 28. Mizunoya W, Oyaizu S, Ishihara K, Fushiki T. Protocol for measuring the endurance capacity of mice in an adjustable-current swimming pool. Biosci Biotechnol Biochem 66: 1133–1136, 2002. 29. Murase T, Haramizu S, Shimotoyodome A, Tokimitsu I, Hase T. Green tea extract improves running endurance in mice by stimulating lipid utilization during exercise. Am J Physiol Regul Integr Comp Physiol 290: R1550 –R1556, 2006. 30. Murase T, Haramizu S, Ota N, Hase T. Tea catechin ingestion combined with habitual exercise suppresses the aging-associated decline in physical performance in senescence-accelerated mice. Am J Physiol Regul Integr Comp Physiol 295: R281–R289, 2008. 31. Murase T, Haramizu S, Ota N, Hase T. Suppression of the agingassociated decline in physical performance by a combination of resveratrol intake and habitual exercise in senescence-accelerated mice. Biogerontology 10: 423–434, 2009. 32. Murase T, Misawa K, Haramizu S, Minegishi Y, Hase T. Nootkatone, a characteristic constituent of grapefruit, stimulates energy metabolism and prevents diet-induced obesity by activating AMPK. Am J Physiol Endocrinol Metab 299: E266 –E275, 2010. 33. Murase T, Misawa K, Minegishi Y, Aoki M, Ominami H, Suzuki Y, Shibuya Y, Hase T. Coffee polyphenols suppress diet-induced body fat

34. 35. 36. 37. 38.

39. 40. 41.

42. 43. 44. 45.

46.

47. 48. 49.

50.

51.

52. 53.

54.

R1017

accumulation by downregulating SREBP-1c and related molecules in C57BL/6J mice. Am J Physiol Endocrinol Metab 300: E122–E133, 2011. Nagata Y, Partridge TA, Matsuda R, Zammit PS. Entry of muscle satellite cells into the cell cycle requires sphingolipid signaling. J Cell Biol 174: 245–253, 2006. Nilsson A. Metabolism of sphingomyelin in the intestinal tract of the rat. Biochim Biophys Acta 164: 575–584, 1968. Nilsson A. The presence of spingomyelin- and ceramide-cleaving enzymes in the small intestinal tract. Biochim Biophys Acta 176: 339 –347, 1969. Oshida K, Shimizu T, Takase M, Tamura Y, Shimizu T, Yamashiro Y. Effects of dietary sphingomyelin on central nervous system myelination in developing rats. Pediatr Res 53: 589 –593, 2003. Pederson BA, Cope CR, Schroeder JM, Smith MW, Irimia JM, Thurberg BL, DePaoli-Roach AA, Roach PJ. Exercise capacity of mice genetically lacking muscle glycogen synthase: in mice, muscle glycogen is not essential for exercise. J Biol Chem 280: 17260 –17265, 2005. Peronnet F, Massicotte D. Table of non-protein respiratory quotient. Can J Sports Sci 16: 23–29, 1991. Reinhardt TA, Lippolis JD. Bovine milk fat globule membrane proteome. J Dairy Res 73: 406 –416, 2006. Romijn JA, Coyle EF, Sidossis LS, Gastaldelli A, Horowitz JF, Endert E, Wolfe RR. Regulation of endogenous fat and carbohydrate metabolism in relation to exercise intensity and duration. Am J Physiol Endocrinol Metab 265: E380 –E391, 1993. Roy BD. Milk: the new sports drink? A review. J Int Soc Sports Nutr 5: 15, 2008. Saadaoui B, Henry C, Khorchani T, Mars M, Martin P, Cebo C. Proteomics of the milk fat globule membrane from Camelus dromedarius. Proteomics 13: 1180 –1184, 2013. Sabbadini RA, Danieli-Betto D, Betto R. The role of sphingolipids in the control of skeletal muscle function: a review. Ital J Neurol Sci 20: 423–430, 1999. Summermatter S, Baum O, Santos G, Hoppeler H, Handschin C. Peroxisome proliferator-activated receptor gamma coactivator 1␣ (PGC1␣) promotes skeletal muscle lipid refueling in vivo by activating de novo lipogenesis and the pentose phosphate pathway. J Biol Chem 285: 32793– 32800, 2010. Summermatter S, Marcelino H, Arsenijevic D, Buchala A, Aprikian O, Assimacopoulos-Jeannet F, Seydoux J, Montani JP, Solinas G, Dulloo AG. Adipose tissue plasticity during catch-up fat driven by thrifty metabolism: relevance for muscle-adipose glucose redistribution during catch-up growth. Diabetes 58: 2228 –2237, 2009. Vesper H, Schmelz EM, Nikolova-Karakashian MN, Dillehay DL, Lynch DV, Merrill AH Jr. Sphingolipids in food and the emerging importance of sphingolipids to nutrition. J Nutr 129: 1239 –1250, 1999. Wang L, Larson EB, Bowen JD, van Belle G. Performance-based physical function and future dementia in older people. Arch Intern Med 166: 1115–1120, 2006. Watson P, Love TD, Maughan RJ, Shirreffs SM. A comparison of the effects of milk and a carbohydrate-electrolyte drink on the restoration of fluid balance and exercise capacity in a hot, humid environment. Eur J Appl Physiol 104: 633–642, 2008. Wilkinson SB, Tarnopolsky MA, MacDonald MJ, MacDonald JR, Armstrong D, Phillips SM. Consumption of fluid skim milk promotes greater muscle protein accretion after resistance exercise than does consumption of an isonitrogenous and isoenergetic soy-protein beverage. Am J Clin Nutr 85: 1031–1040, 2007. Wisløff U, Najjar SM, Ellingsen O, Haram PM, Swoap S, Al-Share Q, Fernström M, Rezaei K, Lee SJ, Koch LG, Britton SL. Cardiovascular risk factors emerge after artificial selection for low aerobic capacity. Science 307: 418 –420, 2005. Wu G, Yi J, Liu L, Wang P, Zhang Z, Li Z. Pseudoginsenoside F11, a novel PPAR␥ agonist, promotes adiponectin oligomerization and secretion in 3T3–L1 adipocytes. PPAR Res 2013: 701017, 2013. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98: 115–124, 1999. Zhang SJ, Truskey GA, Kraus WE. Effect of cyclic stretch on beta1Dintegrin expression and activation of FAK and RhoA. Am J Physiol Cell Physiol 292: C2057–C2069, 2007.

AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00004.2014 • www.ajpregu.org