Animal Science Journal (2016) 87, 109–116
doi: 10.1111/asj.12394
ORIGINAL ARTICLE Differences in calpain system, desmin degradation and water holding capacity between commercial Meishan and Duroc × Landrace × Yorkshire crossbred pork Juan WANG,1 Xiang-lin YAN,1 Rui LIU,1 Qing-quan FU,2 Guang-hong ZHOU1 and Wan-gang ZHANG1 1
Key Laboratory of Meat Processing and Quality Control, Ministry of Education China, College of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, Nanjing Agricultural University and 2 School of Biochemical and Environmental Engineering, Nanjing Xiaozhuang University, Nanjing, China
ABSTRACT The objective of this study was to examine the differences in calpain system, desmin degradation, pH values and water holding capacity (WHC) between muscles of commercial Meishan and Duroc × Landrace × Yorkshire crossbred pigs. Meishan pork presented better WHC evidenced by lower purge loss at days 1 and 3 and less centrifugation loss at day 1 post mortem (P < 0.05). pH values at 45 min post mortem in Meishan pork were significantly higher compared to crossbred pork (P < 0.05). Calpain-1 messenger RNA (mRNA) expression was lower in Meishan pork compared to that from crossbred pork (P < 0.05). Additionally, calpain-1 activity, the ratio of calpain-1 to calpastatin activity and desmin degradation were lower in Meishan pork compared to those from crossbred pork samples (P < 0.05). The results indicate that the calpain system including mRNA expression and activity were different between commercial Meishan and crossbred pork resulting in difference in the degree of desmin degradation during post mortem aging. pH values at 45 min and 24 h post mortem rather than calpain activity and desmin degradation could explain the higher water holding capacity in commercial Meishan pork.
Key words: calpain, Meishan, pH values, post mortem proteolysis, water holding capacity.
INTRODUCTION Meishan pigs have the reputation of higher fecundity, greater fat deposition and better meat quality (Lan et al. 1993; Lefaucheur & Ecolan 2005). It has been evaluated as more tender, juicier and tastier than meat from purebred European pigs (Touraille et al. 1989). In recent years, Meishan pork has become more and more popular in the China market with its unique flavor and relatively higher pigment concentration (Lan et al. 1993). Because of their lower growth rate, Meishan pigs are generally slaughtered at the age of 11 months in the China meat industry when consumed as chilled fresh meat. This is older than commercial crossbred pigs which are usually slaughtered at the age of 6 months. Meishan pork is known to have better water holding capacity (WHC) compared to Landrace and Duroc crossbred pork (Suzuki et al. 1991). Previous reports have shown that the proteolysis of key structural proteins, including desmin and integrin, could contribute to the variation of pork WHC during post mortem storage (Melody et al. 2004; Huff-Lonergan & © 2015 Japanese Society of Animal Science
Lonergan 2005; Zhang et al. 2006). The degree of protein degradation is largely determined by the calpain system, including calpain-1 and its endogenous inhibitor calpastatin (Huff-Lonergan et al. 1996; Koohmaraie & Geesink 2006). Many studies have shown that calpain-1 activity plays a major role in beef tenderness and pork WHC through impacting the rate and extent of protein proteolysis (Huff-Lonergan & Lonergan 2005; Huff-Lonergan et al. 2010). Increasing studies are focusing on Meishan pigs, but more attention has been focused on their fecundity, intramuscular fat content and sensory taste (Fernandez et al. 1999). No studies have elaborated the mechanism behind greater WHC of commercial Meishan pork. Thus, the purpose of this study was to compare the messenger RNA (mRNA) expression and
Correspondence: Wan-gang Zhang, College of Food Science and Technology, Nanjing Agricultural University, Nanjing 210095, China. (Email: [email protected]) Received 21 October 2014; accepted for publication 19 December 2014.
110 J. WANG et al.
the activity of the calpain system, protein proteolysis, pH values and WHC between commercial Meishan and Duroc × Landrace × Yorkshire (DLY) crossbred pork during post mortem aging to explore the mechanism behind greater WHC in commercial Meishan pork.
MATERIALS AND METHODS All animal procedures were reviewed and approved by the Animal Care and Use Committee at the Chinese Academy of Agricultural Sciences.
Preparation of samples Six commercial Meishan boars (live weight 80 ± 10 kg, age about 11 months) and six commercial DLY crossbred boars (live weight 100 ± 10 kg, age about 6 months) were slaughtered at a commercial meat processing company (Sushi Meat Co. Ltd, Jiangsu, China). Both breeds were slaughtered at their usual commercial living weight according to the market requirement. pH values at 45 min post mortem were measured. Approximately 50 g samples from Longissimus thoracis (LT) muscles were excised from the left side of the carcass within 45 min and frozen rapidly in liquid nitrogen for the analysis of mRNA expression and activity of calpain. The rest of the LT muscles were placed in plastic storage bags for aging at 4°C for 24 h, at which time pH values were measured. Each LT muscle was randomly divided into three sections and vacuum packaged for analysis of WHC, calpain autolysis and protein degradation during 1, 3 and 7 days of post mortem aging.
Purge loss and centrifugation loss A 2.54-cm thick sample was utilized for the measurement of purge loss using a modified method of Zhang et al. (2006). Before vacuum packaging, muscle samples were towel dried and weighed as the initial weight. After 1, 3 and 7 days of post mortem aging, samples were pulled out, blotted dry with a paper towel, and weighed again as the final weight. Purge loss was expressed as a difference between initial weight and final weight compared to their initial weight. Centrifugation loss was measured following the method of Zhang et al. (2013) with a slight modification. Twelve grams of minced samples were filled in a centrifuge tube and centrifuged for 10 min at 40 000 × g at 4°C. The liquid was drained and the meat sample was weighed. Centrifugation loss was expressed as a percentage of liquid lost.
Table 1
mRNA preparation, cDNA synthesis and PCR amplification The mRNA expression of calpain-1, calpain-2 and calpastatin were analyzed by RT-PCR. Total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The first-strand complementary DNA (cDNA) was synthesized from 5 μg of total RNA in a 20 μL of reaction mixture. The sequences of primer pairs used for PCR of calpain-1 (CAPN1), calpain-2 (CAPN2) and calpastatin (CAST) genes are listed in Table 1. The primer product was sequenced to check for specificity. Quantitative PCR amplifications were performed in a total volume of 20 μL including 2 μL of standard buffer, 14 μL ddH2O, 2.5 mmol/L MgCl2, 250 μmol/L deoxynucleotide triphosphate (dNTP), 0.25 μmol/L of each primer, 1 U Taq polymerase (Invitrogen, Carlsbad, CA, USA) and 100 ng template DNA. Cycling conditions composed of initial denaturation at 95°C for 2 min, 40 cycles of 95°C for 10 s, annealing temperature of 60°C for 30 s and 72°C for 30 s, and followed by a final step of 72°C for 5 min. After PCR reactions, the melting curve was analyzed to guarantee the specificity of the amplification. The calculated average mRNA expression of CAPN1, CAPN2 and CAST genes was normalized by the expression of housekeeping gene actin. The relative quantitative method of 2-ΔCT was used to calculate the difference in mRNA expression between two breeds (Livak & Schmittgen 2001).
Calpain and calpastatin proteins activities The calpain system was extracted from finely minced 30 g LT muscles (45 min post mortem) according to the methods of Delgado et al. (2001) with slight modifications. The calpains and calpastatin were extracted using three volumes (w/v) of ice-cold extraction buffer (100 mmol/L Tris-HCl, 10 mmol/L ethylenediaminetetraacetic acide (EDTA), 0.05% β-mercaptoethanol (MCE), 100 mg/L ovomucoid, 2 mmol/L phenylmethanesulfonyl fluoride and 6 mg/L leupeptin, pH 8.3). Homogenization was conducted at the speed of 13 000 rpm in an ice-box for three periods with 30 s bursts (Ultra Turrax T25 basic, IKA, Königswinter, Germany). Homogenates were centrifuged at 18 000 × g for 1.5 h at 4°C. After filtering the supernatant, proteins were salted out in 45% ammonium sulfate saturation and kept at 4°C for 20 min to maintain precipitation. Protein solution was centrifuged again at 10 000 × g for 10 min at 4°C. The precipitation was dissolved in the extraction buffer and dialyzed in 40 volumes of dialysate (20 mmol/L Tris-HCl, 1 mmol/L EDTA
List of polymerase chain reaction primer sequences
Gene
Fw/Rv
Accession no.
Primer sequences
Calpain-1 Calpain-1 Calpain-2 Calpain-2 Calpastatin Calpastatin Actin Actin
Fw Rv Fw Rv Fw Rv Fw Rv
NM_213972.1 NM_213972.1 NM_001100188.1 NM_001100188.1 NM_214067.1 NM_214067.1 U07786 U07786
TCCAAAACCTATGGCGTCAAG GGTGTCGTTGAGGGTAAGGGA ATTTTGTTCGGTGTTTGGTTCG GTCTTCAGGCAGGTTAGTCATAACTT AAAAAGCCTACCCACGCACTC TCCATCACTGGGGGTCGG GGCAGTAGCATCGCTTTAGTG AAAGGGGATTGTGATGGCTGA
Fw, forward primer; Rv, reverse primer.
© 2015 Japanese Society of Animal Science
Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 111
Figure 1 Representative of elution profile of a DEAE-Sepharose fast flow column of the supernatant from Duroc × Landrace × Yorkshire crossbred pork. The supernatant of muscle extract was loaded into a 2.5 × 20-cm DEAE-Sepharose column and was washed with equilibrating buffer (20 mmol/L Tris-HCl, 1 mmol ethylenediaminetetraacetic acid and 0.1% β-mercaptoethanol, pH 7.5) until the A278 reached the baseline. The bound proteins were eluted with a linear 25–400 mmol/L NaCl gradient in equilibrating buffer. Flow rate was 1 mL/min, 5.0 mL fractions were collected.
and 0.1% MCE, pH 7.5) for 20 h. Once dialysis was completed, protein solution was centrifuged at 20 000 × g for 1 h at 4°C and loaded on a DEAE Sepharose fast flow (2.5 × 20 cm, Bio-Rad Laboratories, Hercules, CA, USA). The column was washed with equilibrating buffer (20 mmol/L Tris-HCl, 1 mmol/L EDTA and 0.1% MCE, pH 7.5) until the baseline reached zero and remained stable (Wheeler & Koohmaraie 1991). The calpain system was eluted with a gradient of 25 mmol/L to 400 mmol/L NaCl with a flow rate of 1.0 mL/min and 5 mL fractions were collected. Calpastatin eluted between 140 mmol/L NaCl and 215 mmol/L NaCl, calpain-1 eluted between 215 mmol/L NaCl and 270 mmol/L NaCl, and calpain-2 eluted between 270 mmol/L NaCl and 345 mmol/L NaCl from this column (Fig. 1). Activities of calpain-1, calpain-2 and calpastatin fractions were determined using the method described by Wheeler and Koohmaraie (1991). As for calpain-1 and calpain-2, 1 mL eluted sample with a moderate dilution was mixed with 1 mL casein buffer (100 mmol/L Tris-base, 10 mmol/L MCE and 5 mg/mL casein, pH 7.5 adjusted with acetic acid). Reaction began with the addition of 100 μL of 0.1 mol/L CaCl2 and 100 μL of 0.2 mol/L EDTA replaced as control. For calpastatin activity, calpain-2 ( 0.05).
pH pH values at 45 min and 24 h post mortem are presented in Table 3. The values of pH at 45 min post mortem in commercial Meishan pork were significantly higher than crossbred pork (P < 0.05). Meishan pork tended to have greater pH values at 24 h post mortem compared to DLY crossbred pork (P = 0.06).
mRNA expression of CAPN1, CAPN2 and CAST genes CAPN1 gene was encoded for calpain-1 large subunit which is known to be associated with pork drip loss. The data of mRNA expression of CAPN1, CAPN2 and CAST genes are listed in Table 4. Compared to crossbred pork, Meishan pork presented relatively lower CAPN1 mRNA expression (P < 0.05). No significant differences were found in mRNA expression of CAPN2 and CAST (P > 0.05).
Activities of calpain-1, calpain-2 and calpastatin The calpain system activities from 45 min post mortem muscle samples are presented in Table 5 and Figure 1. No significant differences about the activities of calpain-2 and calpastatin were found in Longissimus dorsi (LD) muscles of Meishan and crossbred pigs Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 113
Table 4 mRNA expression differences in commercial Meishan and crossbred pigs†
Index
MS
DLY
P-value
CAPN1 CAPN2 CAST CAPN1:CAST‡
0.14 ± 0.019 0.42 ± 0.013 0.41 ± 0.048 0.37 ± 0.082
0.23 ± 0.016 0.41 ± 0.055 0.48 ± 0.052 0.51 ± 0.097
0.01 0.84 0.36 0.15
†Values are expressed as means ± SEM, n = 6. CAPN1, calpain-1; CAPN2, calpain-2; CAST, calpastatin. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Ratio of calpain-1 mRNA expression to calpastatin mRNA expression within a sample.
Table 5 Calpain system activities at 45 min post mortem from commercial Meishan and crossbred pork†
Index‡
MS
DLY
P-value
Calpain-1 Calpain-2 Calpastatin Calpain-1 : calpastatin§
1.24 ± 0.043 2.05 ± 0.024 2.09 ± 0.030 0.59 ± 0.018
1.45 ± 0.035 2.01 ± 0.016 2.07 ± 0.016 0.70 ± 0.017
0.02 0.20 0.47 0.01
†Values are expressed as means ± SEM, n = 6. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Expressed as units per g muscle tissue. One unit of calpain-1 or calpain-2 activity is defined as the amount of enzyme required to catalyze an increase of 1.0 absorbance unit at 278 nm in 60 min at 25°C. One unit of calpastatin activity is defined as the amount of calpastatin required to inhibit 1.0 unit of calpain-2 activity. §Ratio of calpain-1 activity to calpastatin activity within a sample.
(P > 0.05). However, the activity of calpain-1 and calpain-1 : calpastatin ratio were greater in muscles of crossbred pigs. To our best knowledge, this is the first time to show the difference of calpain and calpastatin activities between commercial Meishan and crossbred pork.
Rate of calpain-1 autolysis during post mortem storage Calpain-1 is well known to play a major role in regulating proteolysis of several myofibril proteins. Once activated, the large 80 kDa subunit is autolyzed to 76 kDa through a 78 kDa intermediate product. The presence of autolyzed 76 kDa form indicates the activation of calpain-1 (Huff-Lonergan et al. 2010). The relative content of 76 kDa was detected at 3 and 7 days of post mortem storage in the current study (Table 6). Muscles from Meishan pigs showed less calpain-1 autolysis ratio at 7 days of post mortem compared to crossbred pork (P < 0.05) and calpain-1 autolysis ratio tended to be significant at day 3 between the two breeds (P = 0.07). These data were consistent with calpain activity at 45 min post mortem in which commercial Meishan pork presented less calpain-1 activity.
Desmin degradation Proteolysis of muscle proteins during aging could affect WHC of pork (Pearce et al. 2011). Desmin, a key Animal Science Journal (2016) 87, 109–116
cytoskeletal protein, locates in the outer periphery of Z disk of skeletal muscle fibers and maintains the structure of muscles (Robson et al. 1997). The relative intensities of intact desmin during post mortem storage are presented in Table 6 and Figure 2. No significant difference was found toward the ratio of desmin degradation at day 3 between muscles of commercial Meishan pork and crossbred pork (P > 0.05). However, crossbred pork presented a greater ratio of desmin degradation at day 7 (P < 0.05).
DISCUSSION Water holding capacity has been considered as an important indicator of meat quality. Water holding capacity not only affects the yield of meat, but also influences the nutritional value of meat (Person et al. 2005). The data of purge loss and centrifugation loss indicate that commercial Meishan pork could have greater WHC compared to commercial crossbred pork during post mortem chilled storage. This was in agreement with the report of Suzuki et al. (1991) who found that Meishan pork had higher WHC. Jiang et al. (2012) observed that Meishan × Landrace crossbred pork showed lower drip loss compared to DLY crossbred pork. Many factors including breed difference, fiber type, intramuscular fat, protein proteolysis, ultimate pH and the rate of pH decline could contribute to the variation of pork WHC (Ryu & Kim 2005; Zhang et al. 2006; Bee et al. 2007; Cesar et al. 2010). Lonergan et al. (2001) reported that selection for lean growth in pigs could compromise some pork traits, including the drip loss of Longissimus, SemitendinosusSemimembranosus, and Biceps femoris muscles. Muscles of Meishan pigs were considered to have higher percentage of intramuscular fat compared to muscles of other lean breeds (Ellis et al. 1995). Breed difference and intramuscular fat may help explain the better WHC of commercial Meishan pork compared to crossbred pork. In addition, pH values at 45 min and 24 h post mortem in Meishan pork were relatively higher compared to crossbred pork, which mirrors the report of Müller et al. (2000) who found that LT muscles of Meishan pigs presented greater pH values at 45 min post mortem compared to Pietrain pork. Similarly, Jiang et al. (2012) showed that Meishan crossbred pork had higher pH values at 45 min and 24 h post mortem compared to DLY crossbred pork. It is well known that a low pH value along with high temperature may result in partial denaturation of muscle proteins to reduce WHC of muscles (Pearce et al. 2011). Thus, the higher pH values in commercial Meishan pork may be in correlation with their greater WHC in the current study. Ultimate pH (24 h post mortem) values in LD muscles were reported to have negative correlation with 1 and 4 days drip loss (Bee et al. 2007). Similarly, Barbut et al. (2008) pointed out that © 2015 Japanese Society of Animal Science
114 J. WANG et al.
Table 6
Analysis of calpain-1 autolysis and desmin degradation at 3 and 7 days of post mortem aging†
Index
Post mortem (days)
MS
DLY
P-value
Ratio of the intensity of 76 kDa calpain-1‡
3 7 3 7
22.34 ± 2.81 28.87 ± 2.35 5.01 ± 0.75 14.14 ± 1.86
29.24 ± 1.97 38.08 ± 2.45 4.77 ± 0.61 23.55 ± 1.07
0.07 0.02 0.81 0.01
Ratio of the intensity of intact desmin§
†Values are expressed as means ± SEM, n = 6. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Values are expressed as a ratio of the intensity of the 76 kDa compared to the intensity of corresponding day 1 band, which is expressed as: ((the relative76 kDa intensity of day 3 or 7 – the relative 76 kDa intensity of day 1) × 100)/the relative 76 kDa intensity of day 1.§Values are expressed as a ratio of the intensity of the intact band compared to the intensity of corresponding day 1 band, which is expressed as: ((the relative intact desmin intensity of day 1 – the relative intact desmin intensity of day 3 or 7)) ×100/the relative intact desmin intensity of day 1.
Figure 2 Degradation of desmin at 1, 3 and 7 days post mortem aging time. All lanes were loaded with 40 μg of myofibrillar proteins. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs.
higher ultimate pH values have a positive effect on WHC within an upper threshold. Therefore, the relatively higher pH in commercial Meishan pork may partially explain the greater WHC compared to crossbred pork. CAPN1/CAST has been reported to be useful as an indicator for protein degradation that affects fresh meat quality during post mortem aging (Muroya et al. 2012). However, no significant difference was found in CAPN1/CAST mRNA expression between two breeds in the current study (P > 0.05). Additionally, Muroya et al. (2012) suggested that LT muscle, Psoas major and Semimembranosus represented different CAPN1 and CAST expressions, indicating that the genes expressed could be regulated by muscle fiber type. Gandolfi et al. (2011a) showed that higher CAPN1 mRNA expression was slightly related to higher drip loss which was in agreement with our results that crossbred pork was found to exert higher CAPN1 mRNA expression and lower WHC. Similarly, CAPN1 and CAST expression were reported to have relationships with calpain activity and shear force (Gandolfi et al. 2011b). Higher CAPN1 expression could correspond to higher CAPN1 protein expression which is reflected in greater calpain-1 activity in our study. Calpain-1 has been considered a key proteolytic enzyme that regulates the proteolysis of specific muscle structural proteins. Thus, the relatively higher calpain activity in muscles of crossbred pigs could predict that commercial crossbred © 2015 Japanese Society of Animal Science
pork could have greater protein degradation during post mortem aging. Consistent with our results, Zhang et al. (2006) reported that intact desmin intensity at day 7 was negatively correlated with calpain-1 activity at day 1. Melody et al. (2004) also pointed out that earlier autolysis of calpain-1 resulted in earlier degradation of desmin, titin and nebulin. Overall, we found that commercial Meishan pork presented a lower ratio of calpain-1 autolysis and less degree of desmin degradation compared to the muscles of crossbred pigs during post mortem aging. The higher calpain activity and lower pH values in muscles of crossbred pigs in the present study were in agreement with the result of Rowe et al. (2001) who reported that porcine LD muscles with lower 2 h pH presented greater rate of calpain autolysis and earlier degradation of myofibrillar proteins. Wilhelm et al. (2010) reported that lower pH values in muscles were consistent with the release of Ca2+. Excess Ca2+ release would result in enhanced calpain activity. In contrast to our results, previous studies have shown that higher activation of calpain would lead to greater proteolysis of cytoskeletal proteins and higher WHC (Kristensen & Purslow 2001; Pearce et al. 2011). Instead of protein degradation, pH values, intramuscular fat content and muscle fiber type and fiber sectional area could contribute to the higher WHC of commercial Meishan pork during post mortem aging (Ellis et al. 1995; Lengerken et al. 1997; Ryu & Kim 2006). Calpain-1 is known to be involved in the degradation of several myofibrillar and other cytoskeletal proteins in post mortem skeletal muscle (Zhang et al. 2006). However, the degradation of proteins located in different sites could have both positive and negative contributions to WHC. Several studies have shown that a higher level of desmin degradation is correlated with improved WHC during post mortem aging (Barbut et al. 2008). Limited desmin degradation has been proposed to result in the shrinkage of muscle cells to form gaps between muscle cells and muscle bundles which thus translate as a high degree of purge loss and drip loss during post mortem aging. In contrast, the degradation of integrin, which attaches the cytoskeleton to Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 115
extracellular matrix, could contribute to the formation of drip channels in pork (Lawson 2004; Zhang et al. 2006). Earlier degradation of integrin post mortem could lead to increased drip loss and purge loss through drip channels between cell and membrane attachment (Pearce et al. 2011).
Conclusions The current study shows that muscles of commercial Meishan pigs presented less CAPN1 mRNA expression, lower calpain-1 activities and decreased rate of calpain-1 autolysis compared to muscles of DLY crossbred pigs. This is consistent with the lower degree of desmin degradation in commercial Meishan pork during post mortem storage. Since protein degradation including desmin is believed to be associated with improved WHC in pork, the difference in protein degradation and calpain system may not be a key factor to explain the higher WHC in commercial Meishan pork. The pH, intramuscular fat, muscle fiber size and other factors need to be further investigated to explore the better WHC of Meishan pork.
ACKNOWLEDGMENTS This research was funded by the Twelfth Five Issues of Rural Areas of People’s Republic of China (2012BAD28B03) and the National Natural Science Foundation of China (31271899).
REFERENCES Barbut S, Sosnicki A, Lonergan S, Knapp T, Ciobanu D, Gatcliffe L, et al. 2008. Progress in reducing the pale, soft and exudative (PSE) problem in pork and poultry meat. Meat Science 79, 46–63. Bee G, Anderson AL, Lonergan SM, Huff-Lonergan E. 2007. Rate and extent of pH decline affect proteolysis of cytoskeletal proteins and water-holding capacity in pork. Meat Science 76, 359–365. Cesar ASM, Silveira ACP, Freitas PFA, Guimaraes EC, Batista DFA, Torido LC, et al. 2010. Influence of Chinese breeds on pork quality of commercial pig lines. Genetics and Molecular Research 9, 727–733. Delgado E, Geesink G, Marchello J, Goll D, Koohmaraie M. 2001. The calpain system in three muscles of normal and callipyge sheep. Journal of Animal Science 79, 398–412. Ellis M, Lympany C, Haley C, Brown I, Warkup C. 1995. The eating quality of pork from Meishan and Large White pigs and their reciprocal crosses. Animal Science 60, 125–131. Etlinger J, Zak R, Fischman D. 1976. Compositional studies of myofibrils from rabbit striated muscle. The Journal of Cell Biology 68, 123–141. Fernandez X, Monin G, Talmant A, Mourot J, Lebret B. 1999. Influence of intramuscular fat content on the quality of pig meat – 1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Science 53, 59–65. Gandolfi G, Cinar M, Ponsuksili S, Wimmers K, Tesfaye D, Looft C, et al. 2011b. Association of PPARGC1A and
Animal Science Journal (2016) 87, 109–116
CAPNS1 gene polymorphisms and expression with meat quality traits in pigs. Meat Science 89, 478–485. Gandolfi G, Pomponio L, Ertbjerg P, Karlsson AH, Nanni Costa L, Lametsch R, et al. 2011a. Investigation on CAST, CAPN1 and CAPN3 porcine gene polymorphisms and expression in relation to post-mortem calpain activity in muscle and meat quality. Meat Science 88, 694–700. Huff-Lonergan E, Lonergan SM. 2005. Mechanisms of waterholding capacity of meat: the role of post mortem biochemical and structural changes. Meat Science 71, 194–204. Huff-Lonergan E, Mitsuhashi T, Beekman DD, Parrish F, Olson DG, Robson RM. 1996. Proteolysis of specific muscle structural proteins by mu-calpain at low pH and temperature is similar to degradation in post mortem bovine muscle. Journal of Animal Science 74, 993–1008. Huff-Lonergan E, Zhang WG, Lonergan SM. 2010. Biochemistry of post mortem muscle – Lessons on mechanisms of meat tenderization. Meat Science 86, 184–195. Jiang Y, Zhu L, Tang G, Li M, Jiang A, Cen W, et al. 2012. Carcass and meat quality traits of four commercial pig crossbreeds in China. Genetics and Molecular Research 11, 4447–4455. Koohmaraie M. 1990. Quantification of Ca2 (+)-dependent protease activities by hydrophobic and ion-exchange chromatography. Journal of Animal Science 68, 659–665. Koohmaraie M, Geesink G. 2006. Contribution of post mortem muscle biochemistry to the delivery of consistent meat quality with particular focus on the calpain system. Meat Science 74, 34–43. Kristensen L, Purslow PP. 2001. The effect of ageing on the water-holding capacity of pork: role of cytoskeletal proteins. Meat Science 58, 17–23. Lan Y, McKeith F, Novakofski J, Carr T. 1993. Carcass and muscle characteristics of Yorkshire, Meishan, Yorkshire x Meishan, Meishan x Yorkshire, Fengjing x Yorkshire, and Minzhu x Yorkshire pigs. Journal of Animal Science 71, 3344–3349. Lawson MA. 2004. The role of integrin degradation in postmortem drip loss in pork. Meat Science 68, 559–566. Lefaucheur L, Ecolan P. 2005. Pattern of muscle fiber formation in Large White and Meishan pigs. Archiv Tierzucht Dummerstorf 48, 117–122. Lengerken GV, Wicke M, Maak S. 1997. Stress susceptibility and meat quality-situation and prospects in animal breeding and research. ArchivAnimal Breed 40, 163–171. Livak KJ, Schmittgen TD. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2− ΔΔCT Method. Methods 25, 402–408. Lonergan S, Huff-Lonergan E, Rowe L, Kuhlers D, Jungst S. 2001. Selection for lean growth efficiency in Duroc pigs influences pork quality. Journal of Animal Science 79, 2075–2085. Melody J, Lonergan S, Rowe L, Huiatt T, Mayes M, Huff-Lonergan E. 2004. Early post mortem biochemical factors influence tenderness and water-holding capacity of three porcine muscles. Journal of Animal Science 82, 1195–1205. Müller E, Moser G, Bartenschilager H, Geldermann H. 2000. Trait values of growth, carcass and meat quality in Wild Boar, Meishan and Pietrain pigs as well as their crossbred generations. Journal of Animal Breeding and Genetics 117, 189–202. Muroya S, Neath KE, Nakajima I, Oe M, Shibata M, Ojima K, Chikuni K. 2012. Differences in mRNA expression of calpains, calpastatin isoforms and calpain/calpastatin
© 2015 Japanese Society of Animal Science
116 J. WANG et al.
ratios among bovine skeletal muscles. Animal Science Journal 83, 252–259. Pearce KL, Rosenvold K, Andersen HJ, Hopkins DL. 2011. Water distribution and mobility in meat during the conversion of muscle to meat and ageing and the impacts on fresh meat quality attributes – A review. Meat Science 89, 111–124. Person R, McKenna D, Griffin D, McKeith F, Scanga J, Belk K, et al. 2005. Benchmarking value in the pork supply chain: processing characteristics and consumer evaluations of pork bellies of different thicknesses when manufactured into bacon. Meat Science 70, 121–131. Robson R, Huff-Lonergan E, Parrish Jr FC, Ho C, Stromer M, Huiatt T, et al. 1997. Post mortem changes in the myofibrillar and other cytoskeletal proteins in muscle. Reciprocal Meat Conference Proceeding 50, 43–52. Rowe L, Lonergan S, Rothschild M, Huff-Lonergan E. 2001. Relationship between porcine longissimus dorsi pH decline and μ-calpain activity/autolysis and protein degradation. Journal of Animal Science 79, 20. (Abstr.). Ryu Y, Kim BC. 2006. Comparison of histochemical characteristics in various pork groups categorized by post mortem metabolic rate and pork quality. Journal of Animal Science 84, 894–901. Ryu YC, Kim BC. 2005. The relationship between muscle fiber characteristics, post mortem metabolic rate, and
© 2015 Japanese Society of Animal Science
meat quality of pig longissimus dorsi muscle. Meat Science 71, 351–357. Suzuki A, Kojima N, Ikeuchi Y, Ikarashi S, Moriyama N, Ishizuka T, Tokushige H. 1991. Carcass composition and meat quality of Chinese purebred and European× Chinese crossbred pigs. Meat science 29, 31–41. Touraille C, Monin G, Legault C. 1989. Eating quality of meat from European× Chinese crossbred pigs. Meat Science 25, 177–186. Wheeler T, Koohmaraie M. 1991. A modified procedure for simultaneous extraction and subsequent assay of calcium-dependent and lysosomal protease systems from a skeletal muscle biopsy. Journal of Animal Science 69, 1559–1565. Wilhelm AE, Maganhini MB, Hernández-Blazquez FJ, Ida EI, Shimokomaki M. 2010. Protease activity and the ultrastructure of broiler chicken PSE (pale, soft, exudative) meat. Food Chemistry 119, 1201–1204. Zhang WG, Lonergan SM, Gardner MA, Huff-Lonergan E. 2006. Contribution of post mortem changes of integrin, desmin and μ-calpain to variation in water holding capacity of pork. Meat Science 74, 578–585. Zhang WG, Marwan AH, Samaraweera H, Lee EJ, Ahn DU. 2013. Breast meat quality of broiler chickens can be affected by managing the level of nitric oxide. Poultry Science 92, 3044–3049.
Animal Science Journal (2016) 87, 109–116
doi: 10.1111/asj.12394
ORIGINAL ARTICLE Differences in calpain system, desmin degradation and water holding capacity between commercial Meishan and Duroc × Landrace × Yorkshire crossbred pork Juan WANG,1 Xiang-lin YAN,1 Rui LIU,1 Qing-quan FU,2 Guang-hong ZHOU1 and Wan-gang ZHANG1 1
Key Laboratory of Meat Processing and Quality Control, Ministry of Education China, College of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, Nanjing Agricultural University and 2 School of Biochemical and Environmental Engineering, Nanjing Xiaozhuang University, Nanjing, China
ABSTRACT The objective of this study was to examine the differences in calpain system, desmin degradation, pH values and water holding capacity (WHC) between muscles of commercial Meishan and Duroc × Landrace × Yorkshire crossbred pigs. Meishan pork presented better WHC evidenced by lower purge loss at days 1 and 3 and less centrifugation loss at day 1 post mortem (P < 0.05). pH values at 45 min post mortem in Meishan pork were significantly higher compared to crossbred pork (P < 0.05). Calpain-1 messenger RNA (mRNA) expression was lower in Meishan pork compared to that from crossbred pork (P < 0.05). Additionally, calpain-1 activity, the ratio of calpain-1 to calpastatin activity and desmin degradation were lower in Meishan pork compared to those from crossbred pork samples (P < 0.05). The results indicate that the calpain system including mRNA expression and activity were different between commercial Meishan and crossbred pork resulting in difference in the degree of desmin degradation during post mortem aging. pH values at 45 min and 24 h post mortem rather than calpain activity and desmin degradation could explain the higher water holding capacity in commercial Meishan pork.
Key words: calpain, Meishan, pH values, post mortem proteolysis, water holding capacity.
INTRODUCTION Meishan pigs have the reputation of higher fecundity, greater fat deposition and better meat quality (Lan et al. 1993; Lefaucheur & Ecolan 2005). It has been evaluated as more tender, juicier and tastier than meat from purebred European pigs (Touraille et al. 1989). In recent years, Meishan pork has become more and more popular in the China market with its unique flavor and relatively higher pigment concentration (Lan et al. 1993). Because of their lower growth rate, Meishan pigs are generally slaughtered at the age of 11 months in the China meat industry when consumed as chilled fresh meat. This is older than commercial crossbred pigs which are usually slaughtered at the age of 6 months. Meishan pork is known to have better water holding capacity (WHC) compared to Landrace and Duroc crossbred pork (Suzuki et al. 1991). Previous reports have shown that the proteolysis of key structural proteins, including desmin and integrin, could contribute to the variation of pork WHC during post mortem storage (Melody et al. 2004; Huff-Lonergan & © 2015 Japanese Society of Animal Science
Lonergan 2005; Zhang et al. 2006). The degree of protein degradation is largely determined by the calpain system, including calpain-1 and its endogenous inhibitor calpastatin (Huff-Lonergan et al. 1996; Koohmaraie & Geesink 2006). Many studies have shown that calpain-1 activity plays a major role in beef tenderness and pork WHC through impacting the rate and extent of protein proteolysis (Huff-Lonergan & Lonergan 2005; Huff-Lonergan et al. 2010). Increasing studies are focusing on Meishan pigs, but more attention has been focused on their fecundity, intramuscular fat content and sensory taste (Fernandez et al. 1999). No studies have elaborated the mechanism behind greater WHC of commercial Meishan pork. Thus, the purpose of this study was to compare the messenger RNA (mRNA) expression and
Correspondence: Wan-gang Zhang, College of Food Science and Technology, Nanjing Agricultural University, Nanjing 210095, China. (Email: [email protected]) Received 21 October 2014; accepted for publication 19 December 2014.
110 J. WANG et al.
the activity of the calpain system, protein proteolysis, pH values and WHC between commercial Meishan and Duroc × Landrace × Yorkshire (DLY) crossbred pork during post mortem aging to explore the mechanism behind greater WHC in commercial Meishan pork.
MATERIALS AND METHODS All animal procedures were reviewed and approved by the Animal Care and Use Committee at the Chinese Academy of Agricultural Sciences.
Preparation of samples Six commercial Meishan boars (live weight 80 ± 10 kg, age about 11 months) and six commercial DLY crossbred boars (live weight 100 ± 10 kg, age about 6 months) were slaughtered at a commercial meat processing company (Sushi Meat Co. Ltd, Jiangsu, China). Both breeds were slaughtered at their usual commercial living weight according to the market requirement. pH values at 45 min post mortem were measured. Approximately 50 g samples from Longissimus thoracis (LT) muscles were excised from the left side of the carcass within 45 min and frozen rapidly in liquid nitrogen for the analysis of mRNA expression and activity of calpain. The rest of the LT muscles were placed in plastic storage bags for aging at 4°C for 24 h, at which time pH values were measured. Each LT muscle was randomly divided into three sections and vacuum packaged for analysis of WHC, calpain autolysis and protein degradation during 1, 3 and 7 days of post mortem aging.
Purge loss and centrifugation loss A 2.54-cm thick sample was utilized for the measurement of purge loss using a modified method of Zhang et al. (2006). Before vacuum packaging, muscle samples were towel dried and weighed as the initial weight. After 1, 3 and 7 days of post mortem aging, samples were pulled out, blotted dry with a paper towel, and weighed again as the final weight. Purge loss was expressed as a difference between initial weight and final weight compared to their initial weight. Centrifugation loss was measured following the method of Zhang et al. (2013) with a slight modification. Twelve grams of minced samples were filled in a centrifuge tube and centrifuged for 10 min at 40 000 × g at 4°C. The liquid was drained and the meat sample was weighed. Centrifugation loss was expressed as a percentage of liquid lost.
Table 1
mRNA preparation, cDNA synthesis and PCR amplification The mRNA expression of calpain-1, calpain-2 and calpastatin were analyzed by RT-PCR. Total RNA was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The first-strand complementary DNA (cDNA) was synthesized from 5 μg of total RNA in a 20 μL of reaction mixture. The sequences of primer pairs used for PCR of calpain-1 (CAPN1), calpain-2 (CAPN2) and calpastatin (CAST) genes are listed in Table 1. The primer product was sequenced to check for specificity. Quantitative PCR amplifications were performed in a total volume of 20 μL including 2 μL of standard buffer, 14 μL ddH2O, 2.5 mmol/L MgCl2, 250 μmol/L deoxynucleotide triphosphate (dNTP), 0.25 μmol/L of each primer, 1 U Taq polymerase (Invitrogen, Carlsbad, CA, USA) and 100 ng template DNA. Cycling conditions composed of initial denaturation at 95°C for 2 min, 40 cycles of 95°C for 10 s, annealing temperature of 60°C for 30 s and 72°C for 30 s, and followed by a final step of 72°C for 5 min. After PCR reactions, the melting curve was analyzed to guarantee the specificity of the amplification. The calculated average mRNA expression of CAPN1, CAPN2 and CAST genes was normalized by the expression of housekeeping gene actin. The relative quantitative method of 2-ΔCT was used to calculate the difference in mRNA expression between two breeds (Livak & Schmittgen 2001).
Calpain and calpastatin proteins activities The calpain system was extracted from finely minced 30 g LT muscles (45 min post mortem) according to the methods of Delgado et al. (2001) with slight modifications. The calpains and calpastatin were extracted using three volumes (w/v) of ice-cold extraction buffer (100 mmol/L Tris-HCl, 10 mmol/L ethylenediaminetetraacetic acide (EDTA), 0.05% β-mercaptoethanol (MCE), 100 mg/L ovomucoid, 2 mmol/L phenylmethanesulfonyl fluoride and 6 mg/L leupeptin, pH 8.3). Homogenization was conducted at the speed of 13 000 rpm in an ice-box for three periods with 30 s bursts (Ultra Turrax T25 basic, IKA, Königswinter, Germany). Homogenates were centrifuged at 18 000 × g for 1.5 h at 4°C. After filtering the supernatant, proteins were salted out in 45% ammonium sulfate saturation and kept at 4°C for 20 min to maintain precipitation. Protein solution was centrifuged again at 10 000 × g for 10 min at 4°C. The precipitation was dissolved in the extraction buffer and dialyzed in 40 volumes of dialysate (20 mmol/L Tris-HCl, 1 mmol/L EDTA
List of polymerase chain reaction primer sequences
Gene
Fw/Rv
Accession no.
Primer sequences
Calpain-1 Calpain-1 Calpain-2 Calpain-2 Calpastatin Calpastatin Actin Actin
Fw Rv Fw Rv Fw Rv Fw Rv
NM_213972.1 NM_213972.1 NM_001100188.1 NM_001100188.1 NM_214067.1 NM_214067.1 U07786 U07786
TCCAAAACCTATGGCGTCAAG GGTGTCGTTGAGGGTAAGGGA ATTTTGTTCGGTGTTTGGTTCG GTCTTCAGGCAGGTTAGTCATAACTT AAAAAGCCTACCCACGCACTC TCCATCACTGGGGGTCGG GGCAGTAGCATCGCTTTAGTG AAAGGGGATTGTGATGGCTGA
Fw, forward primer; Rv, reverse primer.
© 2015 Japanese Society of Animal Science
Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 111
Figure 1 Representative of elution profile of a DEAE-Sepharose fast flow column of the supernatant from Duroc × Landrace × Yorkshire crossbred pork. The supernatant of muscle extract was loaded into a 2.5 × 20-cm DEAE-Sepharose column and was washed with equilibrating buffer (20 mmol/L Tris-HCl, 1 mmol ethylenediaminetetraacetic acid and 0.1% β-mercaptoethanol, pH 7.5) until the A278 reached the baseline. The bound proteins were eluted with a linear 25–400 mmol/L NaCl gradient in equilibrating buffer. Flow rate was 1 mL/min, 5.0 mL fractions were collected.
and 0.1% MCE, pH 7.5) for 20 h. Once dialysis was completed, protein solution was centrifuged at 20 000 × g for 1 h at 4°C and loaded on a DEAE Sepharose fast flow (2.5 × 20 cm, Bio-Rad Laboratories, Hercules, CA, USA). The column was washed with equilibrating buffer (20 mmol/L Tris-HCl, 1 mmol/L EDTA and 0.1% MCE, pH 7.5) until the baseline reached zero and remained stable (Wheeler & Koohmaraie 1991). The calpain system was eluted with a gradient of 25 mmol/L to 400 mmol/L NaCl with a flow rate of 1.0 mL/min and 5 mL fractions were collected. Calpastatin eluted between 140 mmol/L NaCl and 215 mmol/L NaCl, calpain-1 eluted between 215 mmol/L NaCl and 270 mmol/L NaCl, and calpain-2 eluted between 270 mmol/L NaCl and 345 mmol/L NaCl from this column (Fig. 1). Activities of calpain-1, calpain-2 and calpastatin fractions were determined using the method described by Wheeler and Koohmaraie (1991). As for calpain-1 and calpain-2, 1 mL eluted sample with a moderate dilution was mixed with 1 mL casein buffer (100 mmol/L Tris-base, 10 mmol/L MCE and 5 mg/mL casein, pH 7.5 adjusted with acetic acid). Reaction began with the addition of 100 μL of 0.1 mol/L CaCl2 and 100 μL of 0.2 mol/L EDTA replaced as control. For calpastatin activity, calpain-2 ( 0.05).
pH pH values at 45 min and 24 h post mortem are presented in Table 3. The values of pH at 45 min post mortem in commercial Meishan pork were significantly higher than crossbred pork (P < 0.05). Meishan pork tended to have greater pH values at 24 h post mortem compared to DLY crossbred pork (P = 0.06).
mRNA expression of CAPN1, CAPN2 and CAST genes CAPN1 gene was encoded for calpain-1 large subunit which is known to be associated with pork drip loss. The data of mRNA expression of CAPN1, CAPN2 and CAST genes are listed in Table 4. Compared to crossbred pork, Meishan pork presented relatively lower CAPN1 mRNA expression (P < 0.05). No significant differences were found in mRNA expression of CAPN2 and CAST (P > 0.05).
Activities of calpain-1, calpain-2 and calpastatin The calpain system activities from 45 min post mortem muscle samples are presented in Table 5 and Figure 1. No significant differences about the activities of calpain-2 and calpastatin were found in Longissimus dorsi (LD) muscles of Meishan and crossbred pigs Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 113
Table 4 mRNA expression differences in commercial Meishan and crossbred pigs†
Index
MS
DLY
P-value
CAPN1 CAPN2 CAST CAPN1:CAST‡
0.14 ± 0.019 0.42 ± 0.013 0.41 ± 0.048 0.37 ± 0.082
0.23 ± 0.016 0.41 ± 0.055 0.48 ± 0.052 0.51 ± 0.097
0.01 0.84 0.36 0.15
†Values are expressed as means ± SEM, n = 6. CAPN1, calpain-1; CAPN2, calpain-2; CAST, calpastatin. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Ratio of calpain-1 mRNA expression to calpastatin mRNA expression within a sample.
Table 5 Calpain system activities at 45 min post mortem from commercial Meishan and crossbred pork†
Index‡
MS
DLY
P-value
Calpain-1 Calpain-2 Calpastatin Calpain-1 : calpastatin§
1.24 ± 0.043 2.05 ± 0.024 2.09 ± 0.030 0.59 ± 0.018
1.45 ± 0.035 2.01 ± 0.016 2.07 ± 0.016 0.70 ± 0.017
0.02 0.20 0.47 0.01
†Values are expressed as means ± SEM, n = 6. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Expressed as units per g muscle tissue. One unit of calpain-1 or calpain-2 activity is defined as the amount of enzyme required to catalyze an increase of 1.0 absorbance unit at 278 nm in 60 min at 25°C. One unit of calpastatin activity is defined as the amount of calpastatin required to inhibit 1.0 unit of calpain-2 activity. §Ratio of calpain-1 activity to calpastatin activity within a sample.
(P > 0.05). However, the activity of calpain-1 and calpain-1 : calpastatin ratio were greater in muscles of crossbred pigs. To our best knowledge, this is the first time to show the difference of calpain and calpastatin activities between commercial Meishan and crossbred pork.
Rate of calpain-1 autolysis during post mortem storage Calpain-1 is well known to play a major role in regulating proteolysis of several myofibril proteins. Once activated, the large 80 kDa subunit is autolyzed to 76 kDa through a 78 kDa intermediate product. The presence of autolyzed 76 kDa form indicates the activation of calpain-1 (Huff-Lonergan et al. 2010). The relative content of 76 kDa was detected at 3 and 7 days of post mortem storage in the current study (Table 6). Muscles from Meishan pigs showed less calpain-1 autolysis ratio at 7 days of post mortem compared to crossbred pork (P < 0.05) and calpain-1 autolysis ratio tended to be significant at day 3 between the two breeds (P = 0.07). These data were consistent with calpain activity at 45 min post mortem in which commercial Meishan pork presented less calpain-1 activity.
Desmin degradation Proteolysis of muscle proteins during aging could affect WHC of pork (Pearce et al. 2011). Desmin, a key Animal Science Journal (2016) 87, 109–116
cytoskeletal protein, locates in the outer periphery of Z disk of skeletal muscle fibers and maintains the structure of muscles (Robson et al. 1997). The relative intensities of intact desmin during post mortem storage are presented in Table 6 and Figure 2. No significant difference was found toward the ratio of desmin degradation at day 3 between muscles of commercial Meishan pork and crossbred pork (P > 0.05). However, crossbred pork presented a greater ratio of desmin degradation at day 7 (P < 0.05).
DISCUSSION Water holding capacity has been considered as an important indicator of meat quality. Water holding capacity not only affects the yield of meat, but also influences the nutritional value of meat (Person et al. 2005). The data of purge loss and centrifugation loss indicate that commercial Meishan pork could have greater WHC compared to commercial crossbred pork during post mortem chilled storage. This was in agreement with the report of Suzuki et al. (1991) who found that Meishan pork had higher WHC. Jiang et al. (2012) observed that Meishan × Landrace crossbred pork showed lower drip loss compared to DLY crossbred pork. Many factors including breed difference, fiber type, intramuscular fat, protein proteolysis, ultimate pH and the rate of pH decline could contribute to the variation of pork WHC (Ryu & Kim 2005; Zhang et al. 2006; Bee et al. 2007; Cesar et al. 2010). Lonergan et al. (2001) reported that selection for lean growth in pigs could compromise some pork traits, including the drip loss of Longissimus, SemitendinosusSemimembranosus, and Biceps femoris muscles. Muscles of Meishan pigs were considered to have higher percentage of intramuscular fat compared to muscles of other lean breeds (Ellis et al. 1995). Breed difference and intramuscular fat may help explain the better WHC of commercial Meishan pork compared to crossbred pork. In addition, pH values at 45 min and 24 h post mortem in Meishan pork were relatively higher compared to crossbred pork, which mirrors the report of Müller et al. (2000) who found that LT muscles of Meishan pigs presented greater pH values at 45 min post mortem compared to Pietrain pork. Similarly, Jiang et al. (2012) showed that Meishan crossbred pork had higher pH values at 45 min and 24 h post mortem compared to DLY crossbred pork. It is well known that a low pH value along with high temperature may result in partial denaturation of muscle proteins to reduce WHC of muscles (Pearce et al. 2011). Thus, the higher pH values in commercial Meishan pork may be in correlation with their greater WHC in the current study. Ultimate pH (24 h post mortem) values in LD muscles were reported to have negative correlation with 1 and 4 days drip loss (Bee et al. 2007). Similarly, Barbut et al. (2008) pointed out that © 2015 Japanese Society of Animal Science
114 J. WANG et al.
Table 6
Analysis of calpain-1 autolysis and desmin degradation at 3 and 7 days of post mortem aging†
Index
Post mortem (days)
MS
DLY
P-value
Ratio of the intensity of 76 kDa calpain-1‡
3 7 3 7
22.34 ± 2.81 28.87 ± 2.35 5.01 ± 0.75 14.14 ± 1.86
29.24 ± 1.97 38.08 ± 2.45 4.77 ± 0.61 23.55 ± 1.07
0.07 0.02 0.81 0.01
Ratio of the intensity of intact desmin§
†Values are expressed as means ± SEM, n = 6. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs. ‡Values are expressed as a ratio of the intensity of the 76 kDa compared to the intensity of corresponding day 1 band, which is expressed as: ((the relative76 kDa intensity of day 3 or 7 – the relative 76 kDa intensity of day 1) × 100)/the relative 76 kDa intensity of day 1.§Values are expressed as a ratio of the intensity of the intact band compared to the intensity of corresponding day 1 band, which is expressed as: ((the relative intact desmin intensity of day 1 – the relative intact desmin intensity of day 3 or 7)) ×100/the relative intact desmin intensity of day 1.
Figure 2 Degradation of desmin at 1, 3 and 7 days post mortem aging time. All lanes were loaded with 40 μg of myofibrillar proteins. DLY, Duroc × Landrace × Yorkshire crossbred pigs; MS, Meishan pigs.
higher ultimate pH values have a positive effect on WHC within an upper threshold. Therefore, the relatively higher pH in commercial Meishan pork may partially explain the greater WHC compared to crossbred pork. CAPN1/CAST has been reported to be useful as an indicator for protein degradation that affects fresh meat quality during post mortem aging (Muroya et al. 2012). However, no significant difference was found in CAPN1/CAST mRNA expression between two breeds in the current study (P > 0.05). Additionally, Muroya et al. (2012) suggested that LT muscle, Psoas major and Semimembranosus represented different CAPN1 and CAST expressions, indicating that the genes expressed could be regulated by muscle fiber type. Gandolfi et al. (2011a) showed that higher CAPN1 mRNA expression was slightly related to higher drip loss which was in agreement with our results that crossbred pork was found to exert higher CAPN1 mRNA expression and lower WHC. Similarly, CAPN1 and CAST expression were reported to have relationships with calpain activity and shear force (Gandolfi et al. 2011b). Higher CAPN1 expression could correspond to higher CAPN1 protein expression which is reflected in greater calpain-1 activity in our study. Calpain-1 has been considered a key proteolytic enzyme that regulates the proteolysis of specific muscle structural proteins. Thus, the relatively higher calpain activity in muscles of crossbred pigs could predict that commercial crossbred © 2015 Japanese Society of Animal Science
pork could have greater protein degradation during post mortem aging. Consistent with our results, Zhang et al. (2006) reported that intact desmin intensity at day 7 was negatively correlated with calpain-1 activity at day 1. Melody et al. (2004) also pointed out that earlier autolysis of calpain-1 resulted in earlier degradation of desmin, titin and nebulin. Overall, we found that commercial Meishan pork presented a lower ratio of calpain-1 autolysis and less degree of desmin degradation compared to the muscles of crossbred pigs during post mortem aging. The higher calpain activity and lower pH values in muscles of crossbred pigs in the present study were in agreement with the result of Rowe et al. (2001) who reported that porcine LD muscles with lower 2 h pH presented greater rate of calpain autolysis and earlier degradation of myofibrillar proteins. Wilhelm et al. (2010) reported that lower pH values in muscles were consistent with the release of Ca2+. Excess Ca2+ release would result in enhanced calpain activity. In contrast to our results, previous studies have shown that higher activation of calpain would lead to greater proteolysis of cytoskeletal proteins and higher WHC (Kristensen & Purslow 2001; Pearce et al. 2011). Instead of protein degradation, pH values, intramuscular fat content and muscle fiber type and fiber sectional area could contribute to the higher WHC of commercial Meishan pork during post mortem aging (Ellis et al. 1995; Lengerken et al. 1997; Ryu & Kim 2006). Calpain-1 is known to be involved in the degradation of several myofibrillar and other cytoskeletal proteins in post mortem skeletal muscle (Zhang et al. 2006). However, the degradation of proteins located in different sites could have both positive and negative contributions to WHC. Several studies have shown that a higher level of desmin degradation is correlated with improved WHC during post mortem aging (Barbut et al. 2008). Limited desmin degradation has been proposed to result in the shrinkage of muscle cells to form gaps between muscle cells and muscle bundles which thus translate as a high degree of purge loss and drip loss during post mortem aging. In contrast, the degradation of integrin, which attaches the cytoskeleton to Animal Science Journal (2016) 87, 109–116
CALPAIN SYSTEM IN MEISHAN PORK 115
extracellular matrix, could contribute to the formation of drip channels in pork (Lawson 2004; Zhang et al. 2006). Earlier degradation of integrin post mortem could lead to increased drip loss and purge loss through drip channels between cell and membrane attachment (Pearce et al. 2011).
Conclusions The current study shows that muscles of commercial Meishan pigs presented less CAPN1 mRNA expression, lower calpain-1 activities and decreased rate of calpain-1 autolysis compared to muscles of DLY crossbred pigs. This is consistent with the lower degree of desmin degradation in commercial Meishan pork during post mortem storage. Since protein degradation including desmin is believed to be associated with improved WHC in pork, the difference in protein degradation and calpain system may not be a key factor to explain the higher WHC in commercial Meishan pork. The pH, intramuscular fat, muscle fiber size and other factors need to be further investigated to explore the better WHC of Meishan pork.
ACKNOWLEDGMENTS This research was funded by the Twelfth Five Issues of Rural Areas of People’s Republic of China (2012BAD28B03) and the National Natural Science Foundation of China (31271899).
REFERENCES Barbut S, Sosnicki A, Lonergan S, Knapp T, Ciobanu D, Gatcliffe L, et al. 2008. Progress in reducing the pale, soft and exudative (PSE) problem in pork and poultry meat. Meat Science 79, 46–63. Bee G, Anderson AL, Lonergan SM, Huff-Lonergan E. 2007. Rate and extent of pH decline affect proteolysis of cytoskeletal proteins and water-holding capacity in pork. Meat Science 76, 359–365. Cesar ASM, Silveira ACP, Freitas PFA, Guimaraes EC, Batista DFA, Torido LC, et al. 2010. Influence of Chinese breeds on pork quality of commercial pig lines. Genetics and Molecular Research 9, 727–733. Delgado E, Geesink G, Marchello J, Goll D, Koohmaraie M. 2001. The calpain system in three muscles of normal and callipyge sheep. Journal of Animal Science 79, 398–412. Ellis M, Lympany C, Haley C, Brown I, Warkup C. 1995. The eating quality of pork from Meishan and Large White pigs and their reciprocal crosses. Animal Science 60, 125–131. Etlinger J, Zak R, Fischman D. 1976. Compositional studies of myofibrils from rabbit striated muscle. The Journal of Cell Biology 68, 123–141. Fernandez X, Monin G, Talmant A, Mourot J, Lebret B. 1999. Influence of intramuscular fat content on the quality of pig meat – 1. Composition of the lipid fraction and sensory characteristics of m. longissimus lumborum. Meat Science 53, 59–65. Gandolfi G, Cinar M, Ponsuksili S, Wimmers K, Tesfaye D, Looft C, et al. 2011b. Association of PPARGC1A and
Animal Science Journal (2016) 87, 109–116
CAPNS1 gene polymorphisms and expression with meat quality traits in pigs. Meat Science 89, 478–485. Gandolfi G, Pomponio L, Ertbjerg P, Karlsson AH, Nanni Costa L, Lametsch R, et al. 2011a. Investigation on CAST, CAPN1 and CAPN3 porcine gene polymorphisms and expression in relation to post-mortem calpain activity in muscle and meat quality. Meat Science 88, 694–700. Huff-Lonergan E, Lonergan SM. 2005. Mechanisms of waterholding capacity of meat: the role of post mortem biochemical and structural changes. Meat Science 71, 194–204. Huff-Lonergan E, Mitsuhashi T, Beekman DD, Parrish F, Olson DG, Robson RM. 1996. Proteolysis of specific muscle structural proteins by mu-calpain at low pH and temperature is similar to degradation in post mortem bovine muscle. Journal of Animal Science 74, 993–1008. Huff-Lonergan E, Zhang WG, Lonergan SM. 2010. Biochemistry of post mortem muscle – Lessons on mechanisms of meat tenderization. Meat Science 86, 184–195. Jiang Y, Zhu L, Tang G, Li M, Jiang A, Cen W, et al. 2012. Carcass and meat quality traits of four commercial pig crossbreeds in China. Genetics and Molecular Research 11, 4447–4455. Koohmaraie M. 1990. Quantification of Ca2 (+)-dependent protease activities by hydrophobic and ion-exchange chromatography. Journal of Animal Science 68, 659–665. Koohmaraie M, Geesink G. 2006. Contribution of post mortem muscle biochemistry to the delivery of consistent meat quality with particular focus on the calpain system. Meat Science 74, 34–43. Kristensen L, Purslow PP. 2001. The effect of ageing on the water-holding capacity of pork: role of cytoskeletal proteins. Meat Science 58, 17–23. Lan Y, McKeith F, Novakofski J, Carr T. 1993. Carcass and muscle characteristics of Yorkshire, Meishan, Yorkshire x Meishan, Meishan x Yorkshire, Fengjing x Yorkshire, and Minzhu x Yorkshire pigs. Journal of Animal Science 71, 3344–3349. Lawson MA. 2004. The role of integrin degradation in postmortem drip loss in pork. Meat Science 68, 559–566. Lefaucheur L, Ecolan P. 2005. Pattern of muscle fiber formation in Large White and Meishan pigs. Archiv Tierzucht Dummerstorf 48, 117–122. Lengerken GV, Wicke M, Maak S. 1997. Stress susceptibility and meat quality-situation and prospects in animal breeding and research. ArchivAnimal Breed 40, 163–171. Livak KJ, Schmittgen TD. 2001. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2− ΔΔCT Method. Methods 25, 402–408. Lonergan S, Huff-Lonergan E, Rowe L, Kuhlers D, Jungst S. 2001. Selection for lean growth efficiency in Duroc pigs influences pork quality. Journal of Animal Science 79, 2075–2085. Melody J, Lonergan S, Rowe L, Huiatt T, Mayes M, Huff-Lonergan E. 2004. Early post mortem biochemical factors influence tenderness and water-holding capacity of three porcine muscles. Journal of Animal Science 82, 1195–1205. Müller E, Moser G, Bartenschilager H, Geldermann H. 2000. Trait values of growth, carcass and meat quality in Wild Boar, Meishan and Pietrain pigs as well as their crossbred generations. Journal of Animal Breeding and Genetics 117, 189–202. Muroya S, Neath KE, Nakajima I, Oe M, Shibata M, Ojima K, Chikuni K. 2012. Differences in mRNA expression of calpains, calpastatin isoforms and calpain/calpastatin
© 2015 Japanese Society of Animal Science
116 J. WANG et al.
ratios among bovine skeletal muscles. Animal Science Journal 83, 252–259. Pearce KL, Rosenvold K, Andersen HJ, Hopkins DL. 2011. Water distribution and mobility in meat during the conversion of muscle to meat and ageing and the impacts on fresh meat quality attributes – A review. Meat Science 89, 111–124. Person R, McKenna D, Griffin D, McKeith F, Scanga J, Belk K, et al. 2005. Benchmarking value in the pork supply chain: processing characteristics and consumer evaluations of pork bellies of different thicknesses when manufactured into bacon. Meat Science 70, 121–131. Robson R, Huff-Lonergan E, Parrish Jr FC, Ho C, Stromer M, Huiatt T, et al. 1997. Post mortem changes in the myofibrillar and other cytoskeletal proteins in muscle. Reciprocal Meat Conference Proceeding 50, 43–52. Rowe L, Lonergan S, Rothschild M, Huff-Lonergan E. 2001. Relationship between porcine longissimus dorsi pH decline and μ-calpain activity/autolysis and protein degradation. Journal of Animal Science 79, 20. (Abstr.). Ryu Y, Kim BC. 2006. Comparison of histochemical characteristics in various pork groups categorized by post mortem metabolic rate and pork quality. Journal of Animal Science 84, 894–901. Ryu YC, Kim BC. 2005. The relationship between muscle fiber characteristics, post mortem metabolic rate, and
© 2015 Japanese Society of Animal Science
meat quality of pig longissimus dorsi muscle. Meat Science 71, 351–357. Suzuki A, Kojima N, Ikeuchi Y, Ikarashi S, Moriyama N, Ishizuka T, Tokushige H. 1991. Carcass composition and meat quality of Chinese purebred and European× Chinese crossbred pigs. Meat science 29, 31–41. Touraille C, Monin G, Legault C. 1989. Eating quality of meat from European× Chinese crossbred pigs. Meat Science 25, 177–186. Wheeler T, Koohmaraie M. 1991. A modified procedure for simultaneous extraction and subsequent assay of calcium-dependent and lysosomal protease systems from a skeletal muscle biopsy. Journal of Animal Science 69, 1559–1565. Wilhelm AE, Maganhini MB, Hernández-Blazquez FJ, Ida EI, Shimokomaki M. 2010. Protease activity and the ultrastructure of broiler chicken PSE (pale, soft, exudative) meat. Food Chemistry 119, 1201–1204. Zhang WG, Lonergan SM, Gardner MA, Huff-Lonergan E. 2006. Contribution of post mortem changes of integrin, desmin and μ-calpain to variation in water holding capacity of pork. Meat Science 74, 578–585. Zhang WG, Marwan AH, Samaraweera H, Lee EJ, Ahn DU. 2013. Breast meat quality of broiler chickens can be affected by managing the level of nitric oxide. Poultry Science 92, 3044–3049.
Animal Science Journal (2016) 87, 109–116
