REPBIO-99; No. of Pages 7 reproductive biology xxx (2014) xxx–xxx

Available online at www.sciencedirect.com

ScienceDirect journal homepage: http://www.elsevier.com/locate/repbio

Original Research Article

Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy R. Sakumoto *, K-G. Hayashi, T. Takahashi 1 Animal Physiology Research Unit, National Institute of Agrobiological Sciences, Ibaraki 305-0901, Japan

article info

abstract

Article history:

Functional differences between the corpus luteum (CL) of pregnancy and CL of the cycle in

Received 12 June 2013

cows were examined. Messenger RNA and protein levels of prostaglandin (PG) E synthase

Accepted 3 December 2013

(PGES), PGF2a receptor (PGFR), tumor necrosis factor-a (TNF) and Fas were found to be higher in the CL of pregnancy than in CL of the cycle. Oxytocin (OT) mRNA and protein levels were

Keywords:

lower in the CL of pregnancy. Messenger RNA levels of progesterone receptor (PR), luteinizing

Cow

hormone receptor (LHR), PGE2 receptor (PGER), PGF synthase (PGFS), TNF receptor type I (TNFRI) and

Corpus luteum

TNF receptor type II (TNFRII) did not differ between the cycle and pregnancy. PGE2 and PGF2a

Pregnancy

production by cultured bovine endometrial tissues was decreased by a supernatant derived

Oxytocin

from the homogenized CL of pregnancy but not by that of the CL of the cycle, suggesting that

Prostaglandins

specific substances in the CL of pregnancy affect endometrial PG production in cows. Collectively, PGES, PGFR, TNF, Fas or OT may contribute to differences between the CL of pregnancy and CL of the estrous cycle in cows. # 2013 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

1.

Introduction

The corpus luteum (CL) is a transient ovarian organ established by cells of the follicle following ovulation. The primary product of the CL, progesterone (P4), is required for the establishment and maintenance of pregnancy. If pregnancy does not occur, the CL degenerates. On the other hand, when pregnancy is established, the CL lifespan is prolonged and the CL continues to produce P4 during the gestation period [1]. The bovine CL produces not only P4, but also various other

intraluteal factors, including prostaglandins (PG), oxytocin (OT) and cytokines [1]. In particular, PGE2 and PGF2a are well known as potent luteal P4 regulators in cows [2–5]. Intraluteal OT is a key regulator that induces PGF2a production by the endometrium [6], and tumor necrosis factor-a (TNF) and Fas stimulate luteal PG production and induce apoptosis of luteal cells at the time of luteolysis [7]. This indicates that these intraluteal factors play important roles in regulating reproductive activity in an interaction-based manner. Although the CL is required during the early phase of pregnancy in all mammals, in some species (e.g., cows, pigs

* Corresponding author. Tel.: +81 29 838 8633; fax: +81 29 838 8610. E-mail address: [email protected] (R. Sakumoto). 1

Present address: Laboratory of Theriogenology, Faculty of Agriculture, Iwate University, Iwate 020-8550, Japan. 1642-431X/$ – see front matter # 2013 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved. http://dx.doi.org/10.1016/j.repbio.2013.12.003 Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7

2

reproductive biology xxx (2014) xxx–xxx

and dogs) it is required for the entire gestation [8]. In other species (e.g., primates), the CL is not required for the entire gestation, because luteal P4 secretion can be replaced by placental P4 secretion [9]. Many differences have been observed between the CL of the estrous cycle and pregnancy. Corpora lutea of the cycle and pregnancy are morphologically different in cows [10,11], sheep [12,13], and pigs [14]. In pregnant sheep, volume densities of steroidogenic small and large luteal cells gradually increase, peaking between days 60 and 142 of pregnancy [12,13]. The gene expression of PGE and PGF synthases in pigs is higher in the CL of pregnancy than in the CL of the cycle [15]. The expression of PGE and PGG and the activities of copper–zinc superoxide dismutase (Cu, Zn-SOD) are higher in the human CL of pregnancy than in the CL of the midcycle [16]. In the pig, the activity of glutathione peroxidase is higher and the activity of SOD is lower in the CL of pregnancy than in the CL of the cycle [17]. In sheep, the response of small luteal cells to luteinizing hormone (LH) was weaker at days 40– 50 of pregnancy than at day 25 of pregnancy [13,18]. In the cow, the CL of pregnancy produces more PGE2 [19] and less OT [20] than the CL of the cycle. Additionally, the binding sites of PGF2a [21] and TNF [22] have been demonstrated in the CL of pregnancy. However, a systematic approach to investigate the functional differences between the CL of pregnancy and the CL of the cycle has not yet been demonstrated. The objective of the present study was to determine possible differences in gene expression and protein concentration of major intraluteal factors between the CL of pregnancy and CL of the cycle. In addition, we examined whether supernatants derived from the homogenized CL of pregnancy and the CL of the cycle differentially affected PGE2 and PGF2a secretion by bovine endometrial tissues in vitro.

2.

Materials and methods

2.1.

Collection of the bovine corpora lutea and uteri

Bovine ovaries containing corpora lutea (CLs) and uteri were obtained from Japanese-Black cows in the institute ranch within 10–30 min of exsanguination. Tissue samples were collected from cows on day 8–12 of the estrous cycle (cyclic), day 20–30 (early I), day 40–50 (early II), and day 150–165 (mid) of gestation (n = 4 animals/stage). The day of artificial insemination was designated as day 1 of gestation. The CLs were immediately separated from the ovaries and then cut into small pieces ( 0.98). To exclude any contaminating genomic DNA, all experiments included controls lacking the reverse transcription enzyme. As a negative control, water was used instead of RNA for the PCR to exclude any contamination from buffers and tubes.

2.3. Collection of supernatants derived from homogenized luteal tissues Luteal tissue (1 g wet wt) was transferred into 10 ml phosphate buffer (pH 7.2; 160-14481; Wako Pure Chemical Industries Ltd, Osaka, Japan) containing a proteinase inhibitor tablet (cOmplete Ultra tablet EDTA-free, Roche Diagnostics K. K., Tokyo, Japan), and was homogenized in an ice bath with a rotor-stator homogenizer (TissueRuptor; Qiagen) using three 20-s bursts at maximal speed with 30-s intervals of cooling between each burst. The homogenate was subsequently centrifuged at 2000  g for 30 min at 4 8C. The supernatant was collected and stored at 80 8C.

2.4.

Endometrial tissue culture

The endometrial tissues from the bovine uterus were separated using a modification of procedures described previously [26]. The uterine lumen was washed three times with 30–50 mL of sterile physiological saline supplemented with 100 IU/mL penicillin and 100 mg/mL streptomycin and containing 0.1% BSA (735078, Roche Diagnostic). The uterine horn was cut transversely with scissors into several segments, which were slit to expose the endometrial surface. Caruncular endometrial strips were dissected from the myometrial layer with a scalpel and washed once in 50 mL of sterile saline containing antibiotics. The endometrial strips were then minced into small pieces (1 mm3). The minced tissue (10 mg) was pre-incubated in Dulbecco's Modified Eagle's medium (DMEM; D1152, Sigma–Aldrich Co., LLC, St. Louis, MO,

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7

3

reproductive biology xxx (2014) xxx–xxx

Table 1 – Primers used in real-time PCR. Gene

Primer

Sequence (50 –30 )

PR

Forward Reverse

TCGAGCTCACAGCGTTTCTA CCCGGGACTGGATAAATGT

XM_583951

106

LHR

Forward Reverse

GATAGAAGCTAATGCCTTTGACAAC CCAGAATGAAATTAAATTCAGAGGAG

AF491303

198

PGER

Forward Reverse

CCCTGGGTGTACATCTTGCT CCTCCCAAGTGCTCTTGTTT

XM_584035

121

PGFR

Forward Reverse

ATGATGTTGAGTGGGGTGTGCTTT TAGAAGAATATACACCCAAGG

D17395

464

PGES

Forward Reverse

AGGACGCTCAGAGACATGGA TTCGGTCCGAGGAAAGAGTA

NM_174443

142

PGFS

Forward Reverse

GATCAAAGCGATTGCAGACA CAATGCGTTCAGGTGTCACT

S54973

113

TNF

Forward Reverse

CATCCTGTCTGCCATCAAGA GGCGATGATCCCAAAGTAGA

BC134755

193

TNF-RI

Forward Reverse

GTGGAGATTTCGCCTTGTGT TTGGCGCCTTTAAGAAAGAA

BC113278

200

TNF-RII

Forward Reverse

CAGGCTGTGTTTACCCCCTA TGTCCAAGGTCATGTTGCAT

BC105222

142

Fas

Forward Reverse

TCCAGATCTCACGCAAACAG CAGTTGCCTCCCTTCATCAT

NM_174662

150

OT

Forward Reverse

GACCTCCGCCTGCTACATTC TAGTTCTCCTCTTGGCAGCG

NM_176855

192

USA) supplemented with 0.1% BSA. After pre-incubating for 4 h, the endometrial tissues were placed in culture medium (DMEM/Ham's F-12; 1:1 (v/v); D8900, Sigma–Aldrich) supplemented with 10% (v/v) calf serum (C6278, Sigma–Aldrich), 20 IU/mL penicillin, 20 mg/mL streptomycin, and 0.05 mg/mL amphotericin B (516104, EMD Millipore Corp. Billerica, MA, USA) and cultured at 37.5 8C in a humidified atmosphere of 5% CO2 in air. Cultured endometrial tissues were further incubated in the medium with a supernatant derived from homogenized luteal tissues of cyclic, early I, early II and mid-stages (1:100, v/v each stage), 100 ng/mL OT (O4375, Sigma–Aldrich), or 50 ng/mL recombinant bovine TNF (2279-BT, R&D Systems Minneapolis, MN, USA). Control endometrial tissues were treated with phosphate buffer containing a proteinase inhibitor tablet (homogenization buffer). After 18 h of incubation, the culture media were collected and stored at 30 8C until use.

2.5.

ELISA/EIA

The PGES, PGFR, TNF, Fas and OT concentrations in the luteal tissues were determined using commercial ELISA kits (PGES; CSB-EL018976BO, PGFR; CSB-EL018979BO, TNF; CSB-E12020B, Fas; CSB-EL008433BO, Cusabio Biotech Co., Ltd., Wuhan, China, OT; EK-051-01, Phoenix Pharmaceuticals, Inc., Karlsruhe, Germany). The samples for the PGES, PGFR, TNF and Fas assay were diluted 5-fold with assay buffer, and those for OT assay were used directly. The PGE2 and PGF2a concentrations were determined using commercial EIA kits (PGE2; 500141, PGF2a; 516011, Cayman Chemical Company, Ann Arbor, MI, USA). The samples for the PGE2 and PGF2a assay were diluted 21-fold with assay buffer.

GenBank accession no.

2.6.

Product size (bp)

Statistical analysis

Experimental data for real-time PCR and ELISA are presented as mean  SEM. All data were analyzed for normality and homogeneity of variance by the Bartlett's test. The normal distribution among numerical variables was evaluated by the Shapiro–Wilk test. The statistical significance of differences in the abundance of mRNA expression and in protein concentrations was assessed by one-way ANOVA with the KaleidaGraph 3.6 (Synergy Software, Reading, PA) software package. When ANOVA showed a significant effect of stage or treated group, the stages or groups were compared by the Bonferroni post hoc multiple comparison test. A p-value < 0.05 was considered statistically significant.

3.

Results

Specific transcripts for all tested substances were detected in the bovine CL of the estrous cycle and each stage of pregnancy. PR, LHR, PGER and PGFS mRNA expression did not differ between cycle and pregnancy (Fig. 1A–C and F). Transcripts of PGFR and PGES were more abundant ( p < 0.05) in the mid-stage (PGFR) and early I stage (PGES) of the CL of pregnancy than in the CL of the cycle (Fig. 1D and E). The expression of TNF mRNA was higher in the CL of pregnancy from the early I and mid-stage than in the CL of the cycle (Fig. 2A). The expression of both TNFRI and TNFRII mRNA was constant in the CL of the cycle and pregnancy (Fig. 2B and C). Fas mRNA expression was higher in the CL of midpregnancy than in the CL of the cycle ( p < 0.05; Fig. 2D), whereas the expression of OT mRNA was significantly lower in each stage

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7

4

reproductive biology xxx (2014) xxx–xxx

Fig. 1 – Changes in relative amounts of (A) progesterone receptor (PR), (B) luteinizing hormone receptor (LHR), (C) prostaglandin E2 receptor (PGER), (D) prostaglandin F2a receptor (PGFR), (E) prostaglandin E synthase (PGES) and (F) prostaglandin F synthase (PGFS) mRNA expression in the bovine corpus luteum (CL) of the estrous cycle and pregnancy. The CL stages are expressed as cyclic (day 8–12 of the estrous cycle), early I (day 20–30 of pregnancy), early II (day 40–50 of pregnancy) and mid (day 150–165 of pregnancy). Data are the means W SEM for four cows per stage, and are expressed as relative ratios of these mRNA to 18S ribosomal RNA (RN18S1). a,b Bars without common letters differ ( p < 0.05).

of the CL of pregnancy than in the CL of the cycle ( p < 0.01 or lower; Fig. 2E). The luteal PGFR and PGES concentrations were higher in the CL of pregnancy from the early I and mid-stage than in the CL of the cycle ( p < 0.05; Fig. 3A and B). The concentrations of TNF and Fas were higher in the CL of midpregnancy than in the CL of the cycle ( p < 0.05; Fig. 3C and D), whereas OT concentration was significantly lower in each stage of the CL of pregnancy ( p < 0.01 or lower; Fig. 3E). The addition of the supernatant derived from homogenized CL of the cycle did not affect PGE2 or PGF2a production by cultured endometrial tissues (Fig. 4A and B, first and second bars). On the other hand, the supernatant derived from homogenized CL of midpregnancy significantly inhibited both PGE2 and PGF2a secretion by the endometrial tissues ( p < 0.05). TNF (50 ng/mL) and OT (100 ng/mL), which were

Fig. 2 – Changes in relative amounts of (A) tumor necrosis factor-a (TNF), (B) TNF receptor type I (TNFRI), (C) TNF receptor type II (TNFRII), (D) Fas and (E) oxytocin (OT) mRNA expression in the bovine corpus luteum (CL) of the cycle and pregnancy. The CL stages are expressed as cyclic (day 8–12 of the estrous cycle), early I (day 20–30 of pregnancy), early II (day 40–50 of pregnancy) and mid (day 150–165 of pregnancy). Data are the means W SEM for four cows per stage, and are expressed as relative ratios of these mRNA to 18S ribosomal RNA (RN18S1). a,b Bars without common letters differ ( p < 0.05).

used as positive controls, significantly ( p < 0.01) increased the secretion of PGE2 and PGF2a by endometrial tissues.

4.

Discussion

The results of the current study demonstrated that in cows the gene expression and protein concentration of intraluteal factors in the CL of pregnancy differ from those in the CL of the cycle. Similarly, the effects of the supernatant derived from homogenized CL on PG production by endometrial tissues varied dependent on the CL origin (cycle or pregnancy). This suggests that in cows the CL of pregnancy has different properties than the CL of the cycle. As expected, luteal gene expression of PR and LHR did not differ significantly between the estrous cycle and the selected stages of pregnancy. Similar results of PR [27] and LH [28]

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7 reproductive biology xxx (2014) xxx–xxx

(A)

c

6

bc 4 2

ab a

30 PGES (ng/g tissue)

PGFR (ng/g tissue)

8

0

(C)

b

50 40

a

a

a

30 20 10

20 b

15 10

ab a

5

1000

(D)

b

800 600 400

ab a

a

200 Cyclic Early I Early II Mid Stages of pregnancy

(E) OT (ng/g tissue)

c

25

0

0 10

(B)

0

Fas (ng/g tissue)

TNF (ng/g tissue)

60

5

a

8 6 4 2 0

b bc c Cyclic Early I Early II Mid Stages of pregnancy

Fig. 3 – Concentrations of (A) prostaglandin E2 receptor (PGER), (B) prostaglandin E synthase (PGES), (C) tumor necrosis factor-a (TNF), (D) Fas and (E) oxytocin (OT) in the bovine corpus luteum (CL) of the cycle and pregnancy. The CL stages are expressed as cyclic (day 8–12 of the estrous cycle), early I (day 20–30 of pregnancy), early II (day 40–50 of pregnancy) and mid (day 150–165 of pregnancy). Data are the means W SEM for four cows per stage. a,b,c Bars without common letters differ ( p < 0.05).

proteins have been observed in previous studies. P4 and LH levels in the peripheral blood of pregnant cows are comparable to those of non-pregnant cows (mid-stage of the estrous cycle) [29,30]. Since the levels of both ligands (P4 and LH) and their receptors (PR and LHR) in cows do not differ between in the estrous cycle and pregnancy, the actions of P4 and LH in the CL of pregnancy may be similar to those in the CL of estrous cycle. In the present study, the PGES mRNA and protein levels in the CL of early pregnancy were higher than those in the CL of the cycle. PGE2, which is synthesized by PGES, supports luteal P4 production in many species including cows [2]. A possible role of PGES in the CL of pregnancy is to produce PGE2. At the time of maternal recognition of pregnancy in cows, luteal PGE2 synthesis is activated by interferon (IFN)-t [31]. Moreover, IFNt upregulates PGES, but not PGFS, expression in the bovine CL, which leads to an increase in the PGES/PGFS ratio [31]. The PGES/PGFS mRNA ratio is also high in the porcine CL of pregnancy [32]. Although in the present study the mRNA expression of PGES in the CL of mid-pregnancy was not

Fig. 4 – Effects of the supernatant derived from homogenized corpus luteum (CL) of the cycle and pregnancy on (A) prostaglandin E2 (PGE2) and (B) prostaglandin F2a (PGF2a) secretion by cultured bovine endometrial tissue. The CL stages are expressed as cyclic (day 8–12 of the estrous cycle), early I (day 20–30 of pregnancy), early II (day 40–50 of pregnancy) and mid (day 150–165 of pregnancy). Homogenization buffer was added at the control group (Cont.), and tumor necrosis factor-a (TNF; 50 ng/mL) and oxytocin (OT; 100 ng/mL) were used as positive controls. Data are the means W SEM for four cows per stage, and are expressed as relative ratios to control (100%). a,b,c Bars without common letters differ ( p < 0.05).

different from those in the other stages, the PGES protein level was significantly higher in the CL of this stage. Bovine CL collected on day 200 of pregnancy secretes more PGE2 in vitro than CL collected on day 14 of the estrous cycle [19]. Furthermore, P4 production by CL derived from day 200 of pregnancy was increased by PGE2 but not by LH [33]. Thus, PGE2 may contribute to P4 production by the CL of pregnancy throughout the gestation in cows. On the other hand, a recent study has demonstrated that PGE1, but not PGE2, increased mRNA expression for luteal and endometrial LH receptors in ewes [34]. Since the PGE2 antibody of the ELISA kit used in this study cross-reacts with PGE1 (18.7%), the PGE2 role in the regulating the CL of pregnancy may be partially ascribed to PGE1.

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7

6

reproductive biology xxx (2014) xxx–xxx

Interestingly, PGFR mRNA and protein levels were higher in the CL of midpregnancy than the CL of the cycle. This was also shown previously by a Northern blot analysis and [3H] PGF2a binding assay [21]. Endometrial PGF2a induces luteolysis in many species, but the intra-luteal PGF2a acts as a luteotropic reagent in bovine CL [3]. The PGFS mRNA expression was higher in the pregnant CL than in the cyclic CL in cows [35] and pigs [15], suggesting that PGF2a plays a role in regulating CL function during pregnancy as well as the estrous cycle. The finding that the mRNA expression and concentration of OT were lower in the CL of pregnancy than in CL of the cycle is in agreement with the results of the previous study [20]. In many species, OT is produced by both the pituitary and CL [36]. Because the primary role of luteal OT is to stimulate uterine PG production at the time of luteolysis [6], reduction of OT in the CL of pregnancy may serve to avoid luteolysis during gestation. Our hypothesis is also consistent with the fact that OT expression in the CL decreases during early stages of pregnancy [37,38]. In the current study, both TNF and Fas levels were higher in the CL of midpregnancy than in the CL of the cycle. Since TNF and Fas regulate PG production and induce apoptosis of luteal cells, especially at the time of luteolysis [7], the results of the present study seem to be unreasonable. To understand the physiological roles of TNF and Fas in regulating luteal function in pregnant cows, further studies are required. Our findings that the supernatant derived from homogenized CL of pregnancy, but not the one from the CL of the cycle, decreased PGE2 and PGF2a secretion by cultured endometrial tissues, is the first demonstration of a functional difference between the CL of pregnancy and the CL of the cycle. This suggests that specific substances present in the bovine CL of pregnancy affect endometrial PG production and that these substances may inhibit PG production by the uterus. Since the CL of midpregnancy contains low level of OT (which stimulates PG production by endometrium [6]), OT is a possible candidate for being one of such substances present in the supernatant derived from homogenized CL of pregnancy. In conclusion, the results of the present study showed that the expression of PGES, PGFR, TNF, Fas and OT in the bovine CL varied over the course of pregnancy. Moreover, PG, TNF, Fas and OT present in the CL of pregnancy may be involved in the regulation of luteal and/or uterine functions, and affect survival of the fetus throughout gestation.

Authors' contributions RS participated in the design of the study, collected the materials, carried out all experiments and drafted the manuscript. KGH and TT were responsible for all animal care, collected the materials and helped to carry out a part of experiments.

Conflict of interest The authors declare that they have no competing interests.

Acknowledgments This research was supported by Grants-in-Aid for Scientific Research (No. 25780276) from the Japanese Society for the Promotion of Science (JSPS), and Research Program on Innovative Technologies for Animal Breeding, Reproduction, and Vaccine Development (REP-1001) from the Ministry of Agriculture, Forestry and Fisheries of Japan. The authors thank the staff of the National Institute of Livestock and Grassland Sciences, Japan, for their skilled technical assistance.

references

[1] Niswender GD, Juengel JL, Silva PJ, Rollyson MK, McIntush EW. Mechanisms controlling the function and life span of the corpus luteum. Physiological Reviews 2000;80:1–29. [2] Miyamoto A, Lützow VH, Schams D. Acute action of prostaglandin F2a, E2, and I2 in microdialyzed bovine corpus luteum in vitro. Biology of Reproduction 1993;49:423–30. [3] Okuda K, Uenoyama Y, Lee KW, Sakumoto R, Skarzynski DJ. Progesterone stimulation by prostaglandin F2a involves protein kinase C pathway in cultured bovine luteal cells. Journal of Reproduction and Development 1998;44:79–84. [4] Weems CW, Weems YS, Randel RD. Prostaglandins and reproduction in female farm animals. Veterinary Journal 2006;171:206–28. [5] Weems YS, Arreguin-Arevalo JA, Nett TM, Vann RC, Ford SP, Bridges PJ, et al. In vivo intra-luteal implants of prostaglandin (PG) E1 or E2 (PGE1, PGE2) prevent luteolysis in cows. I. Luteal weight, circulating progesterone, mRNA for luteal luteinizing hormone (LH) receptor, and occupied and unoccupied luteal receptors for LH. Prostaglandins & Other lipid Mediators 2011;95:35–44. [6] Asselin E, Drolet P, Fortier MA. Cellular mechanisms involved during oxytocin-induced prostaglandin F2a production in endometrial epithelial cells in vitro: role of cyclooxygenase-2. Endocrinology 1997;138:4798–805. [7] Okuda K, Sakumoto R. Multiple roles of TNF super family members in corpus luteum function. Reproductive Biology and Endocrinology 2003;1:95. [8] McDonald LE, McNutt SH, Nichols RE. The essentiality of the bovine corpus luteum of pregnancy. American Journal of Veterinary Research 1953;14:539–41. [9] Henson MC. Pregnancy maintenance and the regulation of placental progesterone biosynthesis in the baboon. Human Reproduction Update 1998;4:389–405. [10] O'Shea JD, Rodgers RJ, D'Occhio MJ. Cellular composition of the cyclic corpus luteum of the cow. Journal of Reproduction and Fertility 1989;85:483–7. [11] Fields MJ, Fields PA. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 1996;45:1295–325. [12] O'Shea JD, McCoy K. Weight, composition, mitosis, cell death and content of progesterone and DNA in the corpus luteum of pregnancy in the ewe. Journal of Reproduction and Fertility 1988;83:107–17. [13] Farin CE, Sawyer HR, Niswender GD. Analysis of cell types in the corpus luteum of the sheep. Journal of Reproduction and Fertility 1989;37:181–7. [14] Yuan W, Connor ML, Buhr MM. Responsiveness of porcine large and small luteal cells to luteotropic or luteolytic

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

REPBIO-99; No. of Pages 7 reproductive biology xxx (2014) xxx–xxx

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

hormones and cell morphologic changes during the estrous cycle and pregnancy. Journal of Animal Science 1993;71:481–91. Wasielak M, Glowacz M, Kaminska K, Waclawik A, Bogacki M. The influence of embryo presence on prostaglandins synthesis and prostaglandin E2and F2a content in corpora lutea during periimplantation period in the pig. Molecular Reproduction and Development 2008;75:1208–16. Sugino N, Takiguchi S, Kashida S, Karube A, Nakamura Y, Kato H. Superoxide dismutase expression in the human corpus luteum during the menstrual cycle and in early pregnancy. Molecular Human Reproduction 2000;6:19–25. Eliasson M, Boström M, DePierre JW. Levels and subcellular distributions of detoxifying enzymes in the ovarian corpus luteum of the pregnant and non-pregnant pig. Biochemical Pharmacology 1999;58:1287–92. Harrison LM, Kenny N, Niswender GD. Progesterone production, LH receptors, and oxytocin secretion by ovine luteal cell types on days 6, 10 and 15 of the oestrous cycle and day 25 of pregnancy. Journal of Reproduction and Fertility 1987;79:539–48. Weems YS, Lammoglia MA, Vera-Avila HR, Randel RD, Sasser RG, Weems CW. Effects of luteinizing hormone (LH), PGE2, 8-EPI-PGE1, 8-EPI-PGF2a, trichosanthin, and pregnancy specific protein B (PSPB) on secretion of prostaglandin (PG) E (PGE) or F2a (PGF2a) in vitro by corpora lutea (CL) from nonpregnant and pregnant cows. Prostaglandins & Other lipid Mediators 1998;55:359–76. Wathes DC, Swann RW, Pickering BT. Variations in oxytocin, vasopressin and neurophysin concentrations in the bovine ovary during the oestrous cycle and pregnancy. Journal of Reproduction and Fertility 1984;71:551–7. Sakamoto K, Miwa K, Ezashi T, Okuda-Ashitaka E, Okuda K, Houtani T, et al. Expression of mRNA encoding the prostaglandin F2 alpha receptor in bovine corpora lutea throughout the oestrous cycle and pregnancy. Journal of Reproduction and Fertility 1995;103:99–105. Sakumoto R, Murakami S, Kishi H, Iga K, Okano A, Okuda K. Tumor necrosis factor-a and its receptor in the corpus luteum of pregnant cows. Molecular Reproduction and Development 2000;55:406–11. Sakumoto R, Komatsu T, Kasuya E, Saito T, Okuda K. Expression of mRNAs for interleukin-4, interleukin-6 and their receptors in porcine corpus luteum during the estrous cycle. Domestic Animal Endocrinology 2006;31:246–57. Townson DH, O'Connor CL, Pru JK. Expression of monocyte chemoattractant protein-1 and distribution of immune cell populations in the bovine corpus luteum throughout the estrous cycle. Biology of Reproduction 2002;66:361–6. Sakumoto R, Vermehren M, Kenngott RA, Okuda K, Sinowatz F. Changes in the levels of progesterone receptor mRNA and protein in the bovine corpus luteum during the estrous cycle. Journal of Reproduction and Development 2010;56:219–22. Skarzynski DJ, Miyamoto Y, Okuda K. Production of prostaglandin F2a by cultured bovine endometrial cells in

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36] [37]

[38]

response to tumor necrosis factor-a: cell type specificity and intracellular mechanisms. Biology of Reproduction 2000;62:1116–20. Tamane R, Pilmane M, Jemeljanovs A, Dabuzinskiene A. Expression of progesterone receptors in bovine corpus luteum during pregnancy. Medicina 2004;40:459–66. Okuda K, Uenoyama Y, Naito C, Sakabe Y, Kawate N. Luteinizing hormone receptors in the bovine corpus luteum during the oestrous cycle and pregnancy. Reproduction Fertility and Development 1999;11:147–51. Stormshak F, Erb RE. Progestins in bovine corpora lutea, ovaries, and adrenals during pregnancy. Journal of Dairy Science 1961;44:310–20. Roche JF, Ireland JJ, Boland MP, McGeady TM. Concentrations of luteinizing hormone and progesterone in pregnant and non-pregnant heifers. The Veterinary Record 1985;116:153–5. Arosh JA, Banu SK, Kimmins S, Chapdelaine P, Maclaren LA, Fortier MA. Effect of interferon-tau on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology 2004;145:5280–93. Waclawik A, Kaczmarek MM, Kowalczyk AE, Bogacki M, Ziecik A. Expression of prostaglandin synthesis pathway enzymes in the porcine corpus luteum during the oestrous cycle and early pregnancy. Theriogenology 2008;70:145–52. Weems YS, Lammoglia MA, Vera-Avila HR, Randel RD, King C, Sasser RG, et al. Effect of luteinizing hormone (LH), PGE2, 8-EPI-PGE1, 8-EPI-PGE2, trichosanthin, and pregnancy specific protein B (PSPB) on secretion of progesterone in vitro by corpora lutea (CL) from nonpregnant and pregnant cows. Prostaglandins & Other lipid Mediators 1998;55:27–42. Weems YS, Nett TM, Rispoli LA, Davis TL, Johnson DL, Uchima T, et al. Prostaglandin E1 (PGE1), but not prostaglandin E2 (PGE2), alters luteal and endometrial luteinizing hormone (LH) occupied and unoccupied LH receptors and mRNA for LH receptors in ovine luteal tissue to prevent luteolysis. Prostaglandins & Other Lipid Mediators 2010;91:42–50. Magata F, Shirasuna K, Strüve K, Herzog K, Shimizu T, Bollwein H, et al. Gene expressions in the persistent corpus luteum of postpartum dairy cows: distinct profiles from the corpora lutea of the estrous cycle and pregnancy. Journal of Reproduction and Development 2012;58: 445–52. Wathes DC, Swann RW. Is oxytocin an ovarian hormone. Nature 1982;297:225–7. Sheldrick EL, Flint AP. Luteal concentrations of oxytocin decline during early pregnancy in the ewe. Journal of Reproduction and Fertility 1983;68:477–80. Parkinson TJ, Wathes DC, Jenner LJ, Lamming GE. Plasma and luteal concentrations of oxytocin in cyclic and early pregnant cattle. Journal of Reproduction and Fertility 1992;94:161–7.

Please cite this article in press as: Sakumoto R, et al. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol (2014), http://dx.doi.org/10.1016/j.repbio.2013.12.003

7

Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy.

Functional differences between the corpus luteum (CL) of pregnancy and CL of the cycle in cows were examined. Messenger RNA and protein levels of pros...
892KB Sizes 0 Downloads 3 Views