Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia Chun Ge Li a,1, Hui Wang a,1, Hong Ju Chen a, Yan Zhao a, Pei Sheng Fu b, Xiang Shan Ji a,⁎ a b

College of Animal Science and Technology, Shandong Agricultural University, Taian 271018, China Shandong Institute of Freshwater Fisheries, Jinan 250117, China

a r t i c l e

i n f o

Article history: Received 2 March 2014 Received in revised form 17 July 2014 Accepted 18 August 2014 Available online 6 September 2014 Keywords: Nile tilapia High-temperature masculinization Heat shock protein Methylation Sex differentiation

a b s t r a c t Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperatureinduced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Although susceptibility to environmental influences on sex is seen in some species of fish, this is also common in reptiles (Conover and Heins, 1987; Baroiller et al., 1995; Godwin et al., 2003; Blázquez and Somoza, 2010). In fish displaying environmental sex determination, the main environmental factor influencing sex seems to be temperature (temperature-dependent sex determination, TSD) (Baroiller and D'Cotta, 2001; Ospina-Alvarez and Piferrer, 2008). In Nile tilapia, the genetic sex is generally determined by a mixture of major (XX/XY) and minor genetic factors (Baroiller et al., 1999; Devlin and Nagahama, 2002; Cnaani et al., 2008). However, high temperature can override this and switch the mechanism when the gonad is undifferentiated (Tessema et al., 2006). It is well known that high temperature treatment applied after hatching (around 10 days post-fertilization) and lasting from 10 to 28 days significantly skewed sex ratios towards males (Baroiller et al., 1995, 2009; Abucay et al., 1999; Baras et al., 2001; Tessema et al., 2006; Rougeot et al., 2008; Dang et al., 2011). In the masculinization process of tilapia, high temperature acts on the cascade of sex differentiation, somehow

⁎ Corresponding author at: 61, Daizong Street, College of Animal Science and Technology, Shandong Agricultural University, Taian 271018, Shandong, China. E-mail address: [email protected] (X.S. Ji). 1 Contributed equally.

http://dx.doi.org/10.1016/j.cbpb.2014.08.006 1096-4959/© 2014 Elsevier Inc. All rights reserved.

impeding ovarian differentiation and redirecting the pathway towards testis development (D'Cotta et al., 2001a, 2001b). High temperature may be activating or repressing sexual differentiating genes by following a common pathway with normal testicular differentiation in Nile tilapia (D'Cotta et al., 2007, 2008; Poonlaphdecha et al., 2013; Vernetti et al., 2013). Administration of androgens to fish larvae at gonad undifferentiated stages can generate partial or complete masculinization in a number of fish species (Leet et al., 2011). Likewise, functional female phenotypes can also be induced at this same period with estrogens (Baroiller and D'Cotta, 2001). From this, it is evident that the sex steroids play a pivotal role in fish sex determination and differentiation. It is well known that the aromatase enzyme (=CYP19 gene) catalyzes the conversion from testosterone to 17β-estradiol and generally from androgens to estrogens (Baroiller et al., 1995) and if inhibited, blocks estrogen production causing a female to male sex reversal (Guiguen et al., 1999; Uchida et al., 2004). Furthermore, the transcription factor FOXL2 has been characterized as an ovarian specific upstream regulator of a CYP19A1A promoter that would co-activate CYP19A1A expression, along with some additional partners such as NR5A1 (SF1) or cAMP (Wang et al., 2007). The changes in transcription of genes involved in steroidogenesis and hence in sexual differentiation, become an alternative to explain where the temperature is acting (D'Cotta et al., 2001a, 2001b, 2007, 2008; Poonlaphdecha et al., 2013; Vernetti et al., 2013). There are many genes associating with

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

gonadal sex differentiation (Ijiri et al., 2008). A systematic differential expression analysis of genes involved in high temperature-induced sex differentiation in Nile tilapia was very necessary. In recent years, epigenetic mechanisms such as DNA methylation and histone modifications have been implicated in the complex regulation of CYP19 gene (Kumar et al., 2009; Monga et al., 2011). These mechanisms exert effects that are essential to the regulation of gene expression. Navarro-Martín et al. (2011) found that exposure of undifferentiated sea bass larvae to high temperature increased the CYP19A promoter methylation levels of females and males, indicating that high temperature induced-masculinization involves DNA methylation-mediated control of aromatase gene expression. As a result, it is meaningful to determine the expression changes of DNA methyltransferase genes after high temperature treatment in Nile tilapia. Heat shock proteins (HSPs) are a class of functionally related proteins involved in the folding and unfolding of other proteins and their expressions are induced by heat and other stresses (Kohno et al., 2010). It is reported that for several steroid receptors, binding to HSP90 was required for the receptor to be in a native hormonebinding state, and for all of the receptors, hormone binding promoted dissociation of the receptor from HSP90 and conversion of the receptor to the DNA-binding state (Pratt and Toft, 1997). Furthermore, heat shock protein 27 as an estrogen receptor-β (ERβ) associated protein could act as a co-repressor of estrogen signaling (Al-Madhoun et al., 2007). As a result, HSPs are interesting candidates to play important roles during the interaction of temperature and estrogen signaling (Kohno et al., 2010). Considering the possible regulatory role of sex differentiation genes, DNA methylation genes, and HSPs in fish sex differentiation, we hypothesized that high temperature effects on sex differentiation in the Nile tilapia could involve high temperature-regulated expression of them. The objectives of the present study were to determine the mRNA expression changes of sex differentiation genes, DNA methylation genes, HSPs in the Nile tilapia brain and undifferentiated gonads after high temperature treatment. 2. Materials and methods 2.1. Fish culture and sampling Nine hundred Nile tilapia larvae at 7 days post fertilization (dpf) from 5 families (100–250 larvae each family) were obtained from Shandong Institute of Freshwater Fisheries (Jinan, China). The larvae were randomly divided into three groups and reared in 0.5 m3 tanks in the experimental base of Shandong agricultural university under natural photoperiod, and fed pelleted tilapia food of appropriate sizes from 9 dpf onwards. The high temperature treatment to induce masculinization in the Nile tilapia was performed as previously described (Baroiller et al., 1995; Tessema et al., 2006; Dang et al., 2011) and temperature treatments were initiated at 10 dpf. Water temperature of group one (high-temperature induction group) was gradually elevated to 36 °C in 4 h and cultured at 36 °C for 12 days. The temperature of group two (recovery group) was also increased to 36 °C in 4 h and the larvae were cultured at 36 °C for 9 days. Then, the temperature decreased to 28 °C and continued to rear at 28 °C for 3 days. Group three (control group) was cultured at 28 °C for 12 days. Fish were simultaneously sampled at 22 dpf (the end of temperature treatment) for the three groups under a stereomicroscope dissecting both the gonad and brain–pituitary. It has been reported that the appropriate masculinization parameters in Nile tilapia were 36 °C treatment of 9–10 dpf larvae for 9–12 days (Tessema et al., 2006; Dang et al., 2011). In order to acquire larvae of same size, the larvae in the induction group were treated for 12 days at 36 °C and the larvae in the recovery group were treated for 9 days at 36 °C. Previous reports determined the expression changes of several sex differentiation genes of high-

37

temperature treated larvae compared with control larvae (D'Cotta et al., 2001b, 2007; Poonlaphdecha et al., 2013). Nowadays, nobody knows whether the expression levels of sex differentiation related genes changed if the high-temperature treated fish were transferred to culture water (28 °C) for several days. In this study, we determined the expression changes of selected genes of larvae in the recovery group compared with control larvae. Because the Nile tilapia gonad at 22 dpf is very small, the gonad and a little peritoneum together were scraped with knife. 30–40 experimental fish for each group were sampled, and the gonad and brain–pituitary were respectively stored in liquid nitrogen for RNA extraction. Six one-year-old adult fish were purchased from Shandong Institute of Freshwater Fisheries (Jinan, China). The identification of sex was confirmed by optical microscopy following dissection and the gonads were collected and stored in liquid nitrogen for RNA extraction. 2.2. RNA extraction and cDNA synthesis The RNA was respectively extracted from the gonads and brain– pituitary using a TRIzol reagent (Tiangen, Beijing) according to the manufacturer's instruction. Reverse transcription (RT) contained two steps. (1) Reaction of the genomic DNA removal was performed at 42 °C for 2 min and then 4 °C in a total volume of 10 μL consisting of 1 μg total RNA, 5 ×gDNA Eraser buffer, and 1 μL gDNA Eraser. (2) Reaction to reverse transcription was performed at 37 °C for 15 min, 85 °C for 5 s and then 4 °C in a total volume of 20 μL consisting of 10 μL reaction solution of step 1, 4 μL 5 × PrimeScript buffer, 4 μL PrimeScript RT Enzyme MixI, and 1 μL RT Primer Mix (Takara, Dalian, China). 2.3. Sex identification of Nile tilapia larvae The RNA was extracted from the gonads of adults and larvae. The real time PCR, the CYP19A1A and ERβ as primer (Table 1) and the gonad cDNA as template were utilized to determine the Ct (cycle threshold) value for CYP19A1A and ERβ in adult or larvae (Ijiri et al., 2008; Blázquez et al., 2009). According to the obtained Ct values from adults, we can set the fold change threshold value of CYP19A1A between females and males. Similarly, the phenotypic sex of Nile tilapia larvae or high-temperature treated larvae was determined according to the set CYP19A1A Ct threshold value (Poonlaphdecha et al., 2013). qRT-PCR of ERβ was done to further verify the phenotypic sex identification result of CYP19A1A. 2.4. Gene selection and cloning A total of 18 genes (Table 1) were selected based on their possible role in fish sex differentiation. The 18 genes included 4 HSPs, 12 sex differentiation genes, and 2 DNA methylation genes. The 4 HSPs were heat shock protein 27, HSP27; DNAJB1, also named as heat shock protein 40; heat shock protein 70, HSP70; and heat shock protein 90, HSP90. 12 sex differentiation genes were CYP19A1A (cytochrome P450, family 19; ovarian type of aromatase), FOXL2 (forkhead box L2), CYP19A1B (cytochrome P450, family 19; brain type of aromatase), ERα (estrogen receptor α), ERβ (estrogen receptor β), CYP11B2 (cytochrome P450, family 11, steroid 11β-hydroxylase), DMRT1 (doublesex and mab-3 related transcription factor 1), SOX9A (SRY-box containing gene 9a), GTHα (gonadotropin α), FSHβ (follicle-stimulating hormone β), LHβ (luteotropic hormone β), ARα (androgen receptor α). 2 DNA methylation genes were DNMT1 (DNA-methyltransferase 1-like) and DNMT3A (DNA-methyltransferase 3a). In addition, elongation factor 1α was selected as internal quantitative control (Du et al., 2008). 14 genes (CYP19A1A, CYP19A1B, CYP11B2, DMRT1, FOXL2, ERα, ERβ, SOX9A, HSP27, DNAJB1, HSP70, HSP90, DNMT1 and DNMT3A) were used for

38

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

Table 1 Primers for qRT-PCR. Gene

Forward primer

Reverse primer

Product size

GenBank

CYP19A1A CYP19A1B CYP11B2 DMRT1 FOXL2 SOX9A ERα ERβ HSP27a DNAJB1a HSP70a HSP90a DNMT1a DNMT3Aa GTHα FSHβ LHβ ARα EF-1αa

AGGCGATGAGTCCTGTAGGCTTAG CTCATCTTCGCCCAGAACCAC CAAAGAAGTCCTCAGGTTGTACCCA TGAGCCAGGACAAACAGAGTAAGC TGGCAGAACAGCATCAGACACAAC GTGTTGAAGGGTTACGACTGGACG ACCACTTCAACACCCGTCTACAG GCCAAGAAGATTCCAGGGTTT CCCAGAACTAATGACACCGCA TCGCTGAGTTCTTCGGTGGC CAGACCTTCACCACCTACTCCGAC TTCCCTCAAGGACTATGTCTCTCG ACAGGAAGGTCTCTTTGAACGATG CTACACTATGGCAATGGCACAGGT GGCTCACTGAAATCACCTGGACTG GTCGCCCAAAGAACATCAGCCTC AGAATGCTCCTTGCTCTGATGTTG CAGCCCTATGTCCTTGCTTACCAG GATTGGCGGTATCGGAACTG

TTATTGTAGTAGTTGCTGGCTGTGC CACCTTCAGGCTTTGGTAATCG GGACCAAAGTTCCAGCAGGTATGT GCTCCAACTTCATTCTTGACCATC TGTAGGACATCGGAGTGGGTGGCT CCGTTCTTGACAGACTTTCTCCGC GGTCCTTACGCATACCTCCTTTC GGAACTGAGGCACATGTTGGAG GTGCTCGATGGCTGGTTTGA CGTCTGGATTGAGCCTCTTGC CTCGGCTTTGTATTTCTCTGCGTC CCATCCATAGGTGCTGGTGACAAT TCCATACCACCCTCCATAAACCAG CAGGCAGTCATCATTGGCTTTCTC ATGGCAGTCTGTATGGTTTCTCAC TGTATCCAGACAAGGTCCCGCAGT CAACTCAAAGCCACGGGGTAGGT CGCTGGTCATTGAAAATCAGGTCT AGGATGATGACCTGAGCGTTG

241 222 104 319 313 317 364 306 376 285 198 395 308 241 321 261 326 238 276

AF472620 AF472621 FJ713103 AF203489.1 AY554172 DQ632574.1 U75604.1 U75605.1 XM_003456155 XM_003442106 XM_003460596 XM_003440645 XM_003442087.1 XM_003442794 AY294017.1 AY294015.1 AY294016.1 AB045211.1 XM_003458541

a

bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp bp

Predicted sequence.

analyzing the expression changes in the gonad after hightemperature treatment and 13 genes (CYP19A1B, GTHα, FSHβ, LHβ, ARα, ERα, ERβ, HSP27, DNAJB1, HSP70, HSP90, DNMT1 and DNMT3A) were used for analyzing the expression changes in the brain.

A 40

Adult female

Among the 18 selected genes, 7 genes (HSP27, DNAJB1, HSP70, HSP90, DNMT1, DNMT3A, and EF-1α) did not have cDNA sequences in the GenBank database and cDNA cloning was conducted (Ji et al., 2011) based on predicted transcript sequences. Briefly, gene-specific primers (Table 1) were designed according to the predicted sequences. Purified PCR products were directly sent to Sangon Biotech Co., Ltd. for sequencing.

Adult male Control female

35

Control male

2.5. Quantitative real time RT-PCR

Ct Value

Induction female Induction male

30

Recovery female Recovery male

25

20

0

1

Adult

2

Control

3

Induction

4

Recovery

B 40

Ct value

35

30

After sex identification of the sampled 30–40 experimental fish, 3 females and 3 males in the control group, 3 females and 3 males in the induction group, and 3 females and 3 males in the recovery group were used for qRT-PCR. The primers of each gene were designed using primer premier 5.0 and the primer sequence was shown in Table 1. Quantitative real time RT-PCR (qRT-PCR) was conducted in Mx3000p™ real time PCR system. Quantitative real time PCR reaction systems (20 μL) consists of 10 μL SYBR Premix Ex Taq (2 ×), 0.4 μL of each gene specific primer (10 nmol), 2 μL cDNA, and 0.4 μL ROX reference dye II. The PCR amplification procedure was initial denaturation at 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s, followed by disassociation curve analysis to determine target specificity. The expression of EF-1α was used as internal control. The three replicates for each gene and for each individual were done and the fluorescence intensities of each gene, as measured by cycle threshold (Ct) values, were compared by 2−△△Ct method. PCR specificity was assessed by melting curve analysis.

25

2.6. Statistical analysis 20

0

1

Adult

2

Control

3

Induction

4

Recovery

Fig. 1. qRT-PCR of CYP19A1A (A) and ERβ (B) for sex identification of larvae. Scatter plots showed the cycle threshold (Ct) for each sample. The four different types of fish were respectively adult Nile tilapia (3 females and 3 males) and larvae from control group (4 females and 4 males), induction group (4 females and 6 males) and recovery group (3 females and 6 males). The scatter plots clustered into two groups for each type of fish, representing phenotypic females and males. Note: The ERβ Ct value of four individuals in control, induction and recovery group was all 40, meaning no amplification.

The transcript level of each gene was described with its relative concentration (RCgene/RC EF-1α). All data were expressed as mean ± SE and analyzed by one-way ANOVA followed by LSD multiple comparison tests using SPSS 13.0 (SPSS Co. Ltd., Chicago). A p-value of b0.05 was considered statistically significant. To examine the relationship between the expression levels of CYP19A1A, FOXL2 and DMRT1 in the gonad and other genes in the gonad or brain, Spearman rank correlation analysis was conducted independently for females and males using SPSS 13.0.

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

3. Results 3.1. Sex identification of Nile tilapia larvae The mean qRT-PCR Ct (cycle threshold) values of CYP19A1A in adult females and males were respectively 21.81 and 31.56 and the mean Ct value difference between females and males was 9.75 (Fig. 1A). The fold change threshold value between adult females and adult males was set at 6.0. Similarly, among the 9 larvae samples of the control group, 5 clustered into one group, and another 4 clustered into another group. The mean Ct values of the two clusters were respectively 24.04 and 31.55, and the Ct difference between the two clusters was 7.51. Ijiri et al. (2008) found that the expression level of CYP19A1A was significantly higher in XX gonads than in XY gonads from 5 days after hatching and CYP19A1A levels in XY gonads were barely detectable throughout the sampling period (from 5 to 70 days after hatching). Taking into account the result of CYP19A1A qRT-PCR in adult Nile tilapia, the two clusters were included to represent phenotypic female larvae and male larvae, respectively. Similarly, the larvae in the induction and recovery groups clustered together into two groups, representing phenotypic females and males. qRT-PCR of ERβ further verified the sex identification result of CYP19A1A (Fig. 1B). Finally, 5 females and 4

39

males in the control group, 4 females and 6 males in the induction group, and 3 females and 6 males in the recovery group were identified from the sampled experimental fish and shown in Fig. 1. The phenotypic sex of other sampled fish was not detected owing to the poor RNA or PCR. 3.2. Gene sequencing The alignment result showed that the seven partial gene sequences cloned were completely identical to predicted sequences. The deduced partial amino acid sequences of HSP27, DNAJB1, HSP70, HSP90, DNMT1, DNMT3A, and EF-1α shared a relatively high identity (43%–91%) with that of zebrafish. 3.3. High temperature-induced-effects on the expression of ovary development related genes The expression changes of ovary development related genes induced by high temperature were examined by a volcano plot where log2-transformed fold changes in gene expression were plotted against t-test p-values (Figs. 2, 3). Genes plotted farther from the central axes have greater fold-changes and p-values. The expression of CYP19A1A was significantly down-regulated in the gonad of both sexes in the

Fig. 2. Volcano plots of high temperature-induced changes in gene expression pattern in gonads from Nile tilapia. Three female and three male larvae were respectively sampled for qRTPCR. Induction: high-temperature induction group; Recovery: recovery group. A: ovary of induction group; B: ovary of recovery group; C: testis of induction group; D: testis of recovery group. The changes in expression patterns in the treated groups are relative to the control groups. Genes plotted farther from the either the x- or y-axis have larger changes in gene expression. The horizontal dotted line denotes the threshold for p = 0.05. The vertical dotted lines denote the two-fold thresholds. Red dots indicate ≧2-fold up-regulation expression, blue dots ≧2-fold down-regulation expression, black dots no significant change. White dots indicate b2-fold down-regulation expression although the changes of the expression levels are significant.

40

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

Fig. 3. Volcano plots of high temperature-induced changes in gene expression pattern in brains from Nile tilapia. Three female and three male larvae were respectively sampled for qRTPCR. Induction: high-temperature induction group; Recovery: recovery group. A: female brain of induction group; B: female brain of recovery group; C: male brain of induction group; D: male brain of recovery group. The changes in expression patterns in the treated groups are relative to the control groups. Genes plotted farther from the either the x-or y-axis have larger changes in gene expression. The horizontal dotted line denotes the threshold for p = 0.05. The vertical dotted lines denote the two-fold thresholds. Red dots indicate ≧2-fold up-regulation expression, blue dots ≧2-fold down-regulation expression and black dots no significant change.

induction and recovery groups except for the ovary of the recovery group. In the gonad, high temperature also caused significant downregulation expression of FOXL2, except in the testis of the induction group. In the induction group, the expression of ERα was significantly up-regulated in the ovary but down-regulated in the testis. In the recovery group, the expression of ERα did not significantly change in the ovary but still down-regulated in the testis. The expression of SOX9A did not significantly change in the gonad of both sexes in the induction and recovery groups. The expressions of GTHα, LHβ and ERα, which are known to be implicated in ovarian development (Yamaguchi et al., 2007), were significantly down-regulated in the brain of both sexes in the induction and recovery groups (Fig. 3). The magnitudes of change for GTHα ranged from −47.3 to −548.1 fold in various treatment groups, for LHβ ranged from −14.7 to −89.4 fold, and for ERα ranged from −3.3 to −25.5 fold (Table 2). Interestingly, the expression changes of FSHβ and CYP19A1B between the induction group and the recovery group were different. The expression of FSHβ did not significantly change in the brain of both sexes of the induction group, but N 6-fold down-regulated in the brain of both sexes of the recovery group. Similarly, the expression of CYP19A1B (brain aromatase gene) did not significantly change in the

brain of both sexes of the induction group, but was significantly down-regulated in the brain of both sexes of the recovery group. In the induction group, the expression of ERβ was significantly upregulated in the female brain but not in the male brain. In the recovery group, the expression of ERβ was still significantly up-regulated in the female brain but was down-regulated in the male brain. 3.4. High temperature-induced effects on the expression of testis development related genes During high temperature-induced masculinization, another important aspect was whether the transcript expression of genes related to testis development up-regulated after high temperature treatment. The expression of CYP11B2 was significantly up-regulated in the ovary in the induction and recovery groups, but not in the testis in both groups (Fig. 2). In the ovary, the expression of DMRT1 did not change in the induction group but significantly up-regulated in the recovery group. In the brain, high temperature induced the significant up-regulation of ARα in females of the induction group, but not in males of the induction group. In the recovery group, the expression of ARα did not significantly change in female and male brains.

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

41

Table 2 qRT-PCR of selected genes in three groups.a,b Tissue

Gene

Female

Male

Control Gonad

Brain

CYP19A1A CYP19A1B CYP11B2 DMRT1 FOXL2 ERα ERβ SOX9A HSP27 DNAJB1 HSP70 HSP90 DNMT1 DNMT3A CYP19A1B GTHα FSHβ LHβ ARα ERα ERβ HSP27 DNAJB1 HSP70 HSP90 DNMT1 DNMT3A

1.69 1.15 1.08 1.00 1.83 1.01 1.04 1.13 0.90 1.01 1.00 1.30 1.15 1.79 1.02 1.00 1.13 1.60 1.01 1.06 1.04 1.00 1.02 1.03 1.03 1.00 1.02

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

Induction 0.11 0.37 0.10 0.08 0.03 0.15 0.10 0.33 0.10 0.10 0.15 0.40 0.26 0.18 0.22 0.02 0.23 0.45 0.14 0.35 0.29 0.10 0.21 0.28 0.25 0.05 0.18

0.42 3.37 3.50 1.64 0.80 2.79 0.76 0.61 2.83 8.56 8.45 8.64 1.92 2.68 0.41 0.01 1.04 0.03 2.59 0.13 4.92 4.93 8.49 3.92 1.69 15.96 7.02

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.01⁎ 0.25⁎ 0.43⁎⁎ 0.43 0.02⁎ 0.33⁎ 0.03⁎ 0.20 0.31⁎⁎ 1.54⁎ 1.13⁎⁎ 0.93⁎⁎ 0.32 0.43⁎ 0.04 0.00⁎⁎ 0.21 0.01⁎ 0.03⁎ 0.00⁎⁎ 0.27⁎⁎ 0.63⁎ 0.38⁎⁎ 0.04⁎ 0.09 1.49⁎⁎ 0.36⁎⁎

Recovery

Control

1.44 1.23 2.38 4.39 0.36 1.96 1.12 0.54 1.28 6.11 5.43 7.22 1.64 0.20 0.20 0.02 0.14 0.11 1.76 0.04 2.23 11.81 4.00 2.66 1.12 13.61 2.27

0.90 1.06 1.01 1.63 1.02 2.97 – 1.00 1.13 1.15 1.15 5.27 1.09 1.05 1.07 1.07 1.04 1.16 1.03 1.00 1.09 1.05 1.03 1.07 1.21 1.21 1.02

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.04 0.35 0.22⁎ 0.92⁎ 0.06⁎ 0.08 0.03 0.11 0.12 0.15⁎ 0.08⁎ 0.82⁎⁎ 0.31 0.00 0.05⁎ 0.00⁎⁎ 0.01⁎ 0.01⁎ 0.40 0.01⁎⁎ 0.28⁎ 0.53⁎⁎ 0.93⁎⁎ 0.37 0.16 0.72⁎⁎ 0.29⁎⁎

± ± ± ± ± ±

0.10 0.26 0.12 0.28 0.22 0.34

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.06 0.05 0.07 0.26 0.42 0.44 0.23 0.38 0.37 0.28 0.29 0.27 0.06 0.42 0.32 0.26 0.39 0.29 0.67 0.22

Induction

Recovery

0.26 ± 0.04⁎⁎ 1.83 ± 0.18 1.77 ± 0.36 0.55 ± 0.24 0.82 ± 0.29 0.37 ± 0.09⁎⁎ – 0.92 ± 0.03 3.88 ± 0.50⁎ 0.30 ± 0.12⁎ 9.26 ± 0.27⁎⁎ 15.00 ± 1.59⁎ 4.38 ± 0.08⁎ 1.22 ± 0.05 0.47 ± 0.09 0.01 ± 0.00⁎ 0.36 ± 0.11 0.02 ± 0.01⁎ 0.67 ± 0.34 0.30 ± 0.09⁎

0.26 ± 0.02⁎⁎ 0.90 ± 0.04 0.66 ± 0.00 0.01 ± 0.00⁎ 0.01 ± 0.00⁎ 0.96 ± 0.00⁎⁎ – 0.59 ± 0.01⁎ 2.38 ± 0.23 1.27 ± 0.29 2.35 ± 0.16⁎ 5.12 ± 0.40 0.58 ± 0.10 0.25 ± 0.05⁎ 0.31 ± 0.03⁎ 0.002 ± 0.00⁎ 0.17 ± 0.05⁎ 0.01 ± 0.00⁎ 2.20 ± 0.18 0.05 ± 0.02⁎⁎ 0.04 ± 0.00⁎

0.24 3.37 1.78 3.77 0.56 0.33 0.82

± ± ± ± ± ± ±

0.09 2.29 0.72 0.42⁎ 0.05 0.10 0.12

2.13 1.70 8.15 2.00 0.56 0.69

± ± ± ± ± ±

0.07 0.39 1.15⁎⁎ 0.30⁎ 0.24 0.05

–Not expressed. a 3 individuals for each group were used for qRT-PCR. Gene expression level in each animal was calculated as fold change compared to elongation factor 1α. b Statistical analysis was used to evaluate differences between treated group and control group. ⁎ p b 0.05. ⁎⁎ p b 0.01.

3.5. High temperature-induced effects on DNA methylation genes High temperature significantly up-regulated the expression level of DNMT1 in the testis of the induction group, but not in the ovary of the induction group. However, the expression of DNMT3A did not change in the gonad of both sexes of the induction group, but significantly down-regulated in the gonad of both sexes of the recovery group. High temperature also significantly up-regulated the expression levels of DNMT1 and DNMT3A in the female brain of both groups, and had no effect on the expressions of DNMT1 and DNMT3A in the male brain of both groups.

Table 3 Spearman rank correlation coefficients (numbers) and probabilities (*) between expression levels of CYP19A1A mRNA in the gonad and other genesa,b,c in the gonad or brain. Tissue

Gonad

3.6. High temperature-induced effects on heat shock protein genes In the induction group, the expression levels of 4 HSPs (HSP27, DNAJB1, HSP70, and HSP90) were significantly up-regulated in the ovary, and 3 HSPs (HSP27, HSP70, and HSP90) were up-regulated in the testis (Fig. 2). In the recovery group, the number of HSPs upregulated was only three (DNAJB1, HSP70, and HSP90) in the ovary, and one (HSP70) in the testis. High temperature-induced effects on the expression of HSPs between the gonad and the brain were significantly different. In the male brain, only the HSP70 expression level was up-regulated in the induction and recovery groups (Fig. 3C, D). In the female brain, the expressions of HSP27, DNAJB1 and HSP70 were up-regulated in the induction group, and HSP27 and DNAJB1 in the recovery group. 3.7. Correlation between expression levels of CYP19A1A and other genes The expression of CYP19A1A and some other genes in the gonad and brain of both sexes was inter-correlated. In the gonad, CYP19A1A was significantly correlated with CYP11B2 and ER β in females (Table 3), and also correlated with FOXL2 in both sexes, but it was not significant.

Brain

Gene

CYP19A1B FOXL2 DMRT1 CYP11B2 SOX9A ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90 GTHα FSHβ LHβ ARα CYP19A1B ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90

Female

Male

CYP19A1A

CYP19A1A

−0.429 0.407 −0.114 −0.829* 0.429 −0.314 0.886* −0.086 −0.257 −1.000* −0.886* −0.943* −0.943* 0.771* −0.086 0.886* −0.714* 0.429 0.371 −0.943* −0.943* −0.943* −0.429 −0.943* −0.943* −0.899*

−0.300 0.600 0.800 0.167 0.812* −0.100 0 −0.300 0.300 −0.371 0.714 −0.600 −0.029 0.833* 0.667* 0.667* 0.083 0.029 0.086 0.200 0.829* −0.029 −0.886* −0.371 −0.257 0.429

a Gene expressed level in each animal was calculated as fold change compared to elongation factor 1α. b Analyses were conducted separately within females (n = 9) and males (n = 9). c *p b 0.05.

42

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

CYP19A1A was significantly and negatively correlated with four HSPs (HSP27, DNAJB1, HSP70, and HSP90) in females. In males, CYP19A1A was significantly and negatively correlated with SOX9A. In the brain, the expression of CYP19A1A was significantly and positively correlated with the expressions of GTHα and LHβ in both sexes, and with FSHβ in the male brain. CYP19A1A was significantly and negatively correlated with ARα in the female brain. The expression of CYP19A1A was significantly and negatively correlated with three HSPs (DNAJB1, HSP70, and HSP90), and two DNA methylation genes (DNMT1 and DNMT3A) in the female brain. CYP19A1A was negatively correlated with HSP27, and positively with DNMT1 in the male brain. In the gonad, FOXL2 was significantly and negatively correlated with DMRT1 and DNAJB1 in females, and positively correlated with DMRT1 and DNMT3A in males (Table 4). In the brain, FOXL2 was significantly correlated with CYP19A1B, ERα and HSP27 in females, and correlated with GTHα, ERα, ERβ and HSP70 in males. In the gonad, DMRT1 was significantly and negatively correlated with FOXL2 in females, and positively correlated with FOXL2 and SOX9A in males (Table 5). In the brain, DMRT1 was significantly correlated with CYP19A1B, ERα and HSP27 in females, and correlated with GTHα, FSHβ, ERα, ERβ and HSP70 in males. 4. Discussion A great deal of information is known regarding the temperature effects on differentiation in fish (Devlin and Nagahama, 2002; Ospina-Alvarez and Piferrer, 2008). This study was undertaken to better define the molecular mechanisms through which high temperatures induce masculinization in Nile tilapia. The expression changes of 12 sex differentiation genes, 2 DNMTs, and 4 Hsps under high temperature were analyzed. Firstly, qRT-PCR of CYP19A1A and ERβ was performed to sex the undifferentiated tilapia on thermosensitive period. In tilapia, sexually dimorphic expression of CYP19A1A and estrogen receptors has been reported (D'Cotta et al., 2001a). CYP19A1A is only expressed Table 4 Spearman rank correlation coefficients (numbers) and probabilities (*) between expression levels of FOXL2 mRNA in the gonad and other genesa,b,c in the gonad or brain. Tissue

Gonad

Brain

Gene

CYP19A1B CYP19A1A DMRT1 CYP11B2 SOX9A ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90 GTHα FSHβ LHβ ARα CYP19A1B ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90

Female

Male

FOXL2

FOXL2

−0.029 0.407 −0.943* −0.543 0.371 −0.429 −0.257 −0.486 0.429 −0.429 −0.853* −0.486 −0.429 0.486 0.543 0.600 −0.429 0.886* 0.943* −0.371 0.486 −0.486 −1.000* −0.486 −0.486 −0.058

−0.058 0.600 0.812* 0.471 0.794 0.232 −0.588 0.203 0.928* −0.232 −0.174 −0.232 0.058 0.928* 0.493 0.290 −0.725 0.348 0.812* 0.812* −0.058 0.319 −0.116 −0.116 −0.928* −0.145

a Gene expressed level in each animal was calculated as fold change compared to elongation factor 1α. b Analyses were conducted separately within females (n = 9) and males (n = 9). c *p b 0.05.

Table 5 Spearman rank correlation coefficients (numbers) and probabilities (*) between expression levels of DMRT1 mRNA in the gonad and other genesa,b,c in the gonad or brain. Tissue

Gonad

Brain

Gene

CYP19A1B CYP19A1A FOXL2 CYP11B2 SOX9A ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90 GTHα FSHβ LHβ ARα CYP19A1B ERα ERβ DNMT1 DNMT3A HSP27 DNAJB1 HSP70 HSP90

Female

Male

DMRT1

DMRT1

0.086 −0.114 −0.943* 0.486 −0.257 0.486 0.371 0.314 −0.371 0.371 0.736 0.429 0.486 −0.429 −0.600 −0.771 0.486 −0.943* −1.000* 0.429 0.429 0.429 0.943* 0.429 0.429 −0.029

0.086 0.800 0.812* 0.464 0.986* 0.543 −0.406 0.314 0.657 −0.371 0.143 −0.371 0.143 0.943* 0.829* 0.657 −0.371 0.371 0.829* 0.886* 0.429 0.600 −0.486 −0.543 −0.943* −0.314

a Gene expressed level in each animal was calculated as fold change compared to elongation factor 1α. b Analyses were conducted separately within females (n = 9) and males (n = 9). c *p b 0.05.

in the gonad (Chang et al., 2005) and estrogen receptors (ERα and ERβ) were only expressed in the liver, gonad, pituitary, and brain (Davis et al., 2008). Therefore, the gonad containing a little peritoneum did not affect the detection for the amplification of CYP19A1A or ERβ. Blázquez et al. (2009) found that CYP19A1A among 7 genes was the best variable to discriminate sex in sea bass and CYP19A1A alone was capable of correctly classifying 100% of the fish. Together previous studies and our work indicated that qRT-PCR of CYP19A1A and ERβ could be used for predicting future females and future males of tilapia larvae. The expression of CYP19A1A of XX females masculinized by high temperatures was suppressed in Nile tilapia. This phenomenon has also been found in the pejerrey (Fernandino et al., 2008). However, treatment with the aromatase inhibitor Fadrozole caused masculinization of pejerrey without changing the pattern of gene expression of CYP19A1A. Therefore, CYP19A1A is a good marker of temperaturesensitive masculinization (Poonlaphdecha et al., 2013). In this study, we found that the expression of CYP19A1A was significantly down-regulated in the gonad of both sexes in the induction group. CYP19A1A is a key enzyme involved in the production of endogenous estrogen, and its implication in fish ovarian differentiation is now well documented (Vizziano et al., 2008). High temperature has been shown to reduce CYP19A1A expression when elevated temperatures induced testis differentiation in tilapia (D'Cotta et al., 2001b; Poonlaphdecha et al., 2013), Japanese flounder (Kitano et al., 1999) and pejerrey (Fernandino et al., 2008). Temperature suppression of CYP19A1A mRNA expression blocked the estrogen biosynthesis and triggered the sex-reversal of the females to males. Moreover, estrogen completely rescued high temperature- and cortisol-induced masculinization of XX medaka, implicating that high temperature caused femaleto-male sex reversal in medaka by the suppression of CYP19A1A expression (Kitano et al., 2012). FOXL2 was shown to be able to up-regulate CYP19A1A in tilapia (Wang et al., 2007) as well as in the Japanese flounder (Yamaguchi et al., 2007), and estrogens up-regulate FOXL2 in rainbow trout (Baron et al., 2004). Correlated spatial and temporal

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

expressions of FOXL2 with that of CYP19A1A have been observed in the rainbow trout (Vizziano et al., 2008). Similar to our results, FOXL2 expression has also been shown to be suppressed in the temperaturemasculinized XX female (TM) tilapia from 17 to 19 dpf onwards (Poonlaphdecha et al., 2013) and in Japanese flounder during early sex differentiation (Yamaguchi et al., 2007). Temperature modulation of ERα expression has not yet been studied in fish. Current study showed that the expression of ERα was significantly up-regulated in the ovary but down-regulated in the testis in the induction group. Ijiri et al. (2008) found that Nile tilapia ERα was expressed at similar levels in XX and XY gonads from 5 to 35 days in both sexes. Equal expression of ERα between undifferentiated XX and XY gonads was reported from medaka (Kawamura et al., 2003). The suppression of ERα expression in the male gonad induced by high temperature further blocked estrogen action in inducing ovarian development. We also found that the expressions of GTHα, LHβ and ERα in the brain, which are known to be implicated in ovarian development (Yamaguchi et al., 2007), were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. Although many studies focused on temperature-induced expression changes of sex differentiation genes in the gonad, little is known regarding brain gene expression changes induced by high temperature in fish. In Southern catfish, GTHα were expressed in the pituitary, higher in female than in male (Wu et al., 2009). In the rainbow trout, GTHα expression increased throughout gametogenesis and periovulatory period (Gomez et al., 1999). In the current study, we found that the expression of GTHα in the brain reduced under high temperature in the induction and recovery groups. LHβ is another critical mediator of sexual development and its expression is modulated by cAMP/PKA system (Horton and Halvorson, 2004; Shinoda et al., 2010). Pérez et al. (2011) found that low temperature caused a higher expression of LHβ and FSHβ in European eel pituitary and higher E2 levels. The present work showed that the expression of brain LHβ was suppressed under high temperature, and the expression of FSHβ did not significantly change in the brains of the induction group, but was N 6-fold down-regulated in the brain of the recovery group. ERα can mediate stimulatory effects of estrogen on CYP19A1A gene expression (Kumar et al., 2009). The expression of ERα can be transcriptionally regulated by epigenetic mechanisms including methylation and acetylation (Pinzone et al., 2004). Tsai et al. (2003) found that between days 10 and 20 posthatching, and between days 20 and 30 posthatching, Mossambicus tilapia brain ERα mRNA expression was not altered at a high temperature (32 °C) without considering the larvae sexes. In this study, we found that the magnitudes of expression changes of ERα in the brain ranged from −3.33 to −25.47 fold under higher temperature (36 °C). Except for the possible difference between the species, I think that low temperature (32 °C) cannot induce high percentage of males and only emerge little effect on some gene expressions. Baras et al. (2001) has ever concluded that high percentage male progenies could only be obtained at very high temperatures, close to the upper incipient lethal temperature of juvenile Nile tilapia (38.5–39.0 °C). Comparing with the expression changes of ovary developmentrelated genes in high temperature-induced masculinization, testis development-related genes expression changed only in females. For instance, the expression of CYP11B2 was significantly up-regulated in the ovary in the induction and recovery groups, but not in the testis in both groups. In the brain, high temperature induced the significant up-regulation of ARα in females of the induction group, but not in the males of the induction group. The absence of both androgen and estrogen syntheses in early XY gonadal development has been reported in tilapia and rainbow trout (Guiguen et al., 1999). Tao et al. (2013) suggested that endogenous estrogen is critical to ovarian determination in tilapia and that androgen is not necessary for testicular determination. Collectively, although androgen is not necessary for testicular determination, the increases of testis development-related gene expression in females are very helpful for high temperature-induced

43

masculinization. However, the high temperature did not further up-regulate the expression levels of testis development-related genes in males. The important finding in this study was that there are significant correlations between the expression of CYP19A1A in gonads and the expression of GTHα and LHβ in both sexes in the brain, FSHβ in the male brain, and ARα in the female brain during high-temperature masculinization. The expression of FOXL2 in the gonad was significantly correlated with GTHα, ERα, and ERβ in the male brain. The expression of DMRT1 in the gonad was significantly correlated with CYP19A1B and ERα in the female brain, and correlated with ERα and ERβ in the male brain. Previous reports showed that GTH, FSH, and LH play important roles in gonadal development and are the most likely candidates to elicit early gonadal differentiation in vertebrates including fish (Wu et al., 2009). The androgen receptor is a ligand-dependent transcription factor and androgens generally act on target cells through ARs (Tosaka et al., 2010). Similarly, estrogens critically involved in reproductive processes of vertebrates, signal primarily through their intracellular estrogen receptors (ERs) (Nelson and Habibi, 2013). Under high-temperature masculinization, the expressions of these important gonad development relating genes in the brain changed and showed a significant correlation with CYP19A1A, FOXL2, or DMRT1 in the gonads. These results show that high temperature can affect the expressions of some genes in the tilapia brain and high temperature action on the tilapia brain might induce the expression changes of sex differentiation genes (CYP19A1A, FOXL2, or DMRT1) in the gonads. Methylation levels of many sex differentiation genes showed sexual dimorphism. For instance, Wen (2010) found no CpG methylation of Japanese flounder DMRT1 promoter in the testis and 57.69% in ovary. The levels of Japanese flounder DMRT4 promoter methylation in the gonads were also sexually dimorphic. These results showed that epigenetic modifications might play an important role during fish sex differentiation. One striking result from the current study was that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, but not in the ovary of the induction group, which was consistent with the expression changes of sex differentiation genes in the gonad after high-temperature treatment. High temperature also significantly up-regulated the expression levels of DNMT1 and DNMT3A in the female brain of both groups. Thermal plasticity of expression of DNMTs has been observed in current and previous studies. For example, during zebrafish somatogenesis (20S) there is a general up-regulation of DNMT3 genes with increasing embryonic temperature (Campos et al., 2012). Navarro-Martín et al. (2011) found that exposure of undifferentiated sea bass larvae to high temperature increased the CYP19A promoter methylation levels in the gonad. Although the link between the increases of CYP19A promoter methylation levels and changes of DNA methyltransferase expression levels was not studied, these obtained results in this study inferred that DNA methylation of the CYP19A promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in Nile tilapia (Navarro-Martín et al., 2011). The current study showed that the expression of CYP19A1A in the gonad was significantly and negatively correlated with DNMT1 and DNMT3A in the female brain, and positively with DNMT1 in the male brain. This is first report of the link between changes of CYP19A promoter methylation levels and DNA methyltransferase expression levels. In the future, we will test the connection between DNA methylation of sex regulatory genes and changes of methylase expression upon high temperature induction. It is well known that high temperature mostly up-regulate HSP gene expression within a few hours after the temperature shift. However, high temperatures could efficiently masculinize some Nile tilapia progenies if started around 10 days post fertilization (dpf) and if applied for at least 9 days, with a shorter period being less effective (Baroiller et al., 2009). As a result, long-time high-temperature treatment is very necessary to masculinize some Nile tilapia progenies. In order to

44

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45

investigate the roles of HSP mRNA expression changes during long-time high-temperature treatment in masculinizing Nile tilapia progenies, we analyzed the expression changes of 4 HSP genes after high-temperature treatment for 9 days. The mRNA expression changes of HSP genes during high-temperature treatment could slightly vary on different time points. We will further analyze the mRNA expression changes of HSP genes on different time points and investigate the dynamic changes of these gene expressions during the whole process in the future. One striking result from the current study was that the expression levels of most HSPs in the Nile tilapia gonad were significantly up-regulated after high temperature treatment. Most of the data collected to date suggest that the steroid hormone receptors are associated with HSP90s in the absence of their specific ligand (Pratt and Toft, 1997). Whether HSP90 expression increases after heat shock is used for associating with steroid hormone receptors remains unknown. Previous studies have shown that gonadal HSP27 can reduce the E2 signal directly at trans-activation, whereas gonadal HSP70A could induce E2 signaling by stimulating vitamin D signaling that leads to the induction of augmented CYP19A1 expression (Kohno et al., 2010). In this study, we found that the expressions of HSP27 and HSP70 were up-regulated after heat shock, whereas the role of increased expressions of HSP27 and HSP70 remains to be elucidated. Furthermore, high temperature-induced effects on the expressions of HSPs between the gonad and the brain were significantly different and only HSP70 expression level was up-regulated in the male brain. Zhang and Zhang (2012) also found that oyster HSP70 expression changes were tissue/organspecific under heat shock. Cheng et al. (2007) reported that the HSP70 mRNA levels of Pacific abalone in the gill were always higher than those in the muscle at any time after heat shock. In this study, we found that HSP70 transcription level was the most sensitive to high temperature treatment among four Nile tilapia HSPs. Ojima et al. (2005) showed that increased levels of HSP70 expression were also most conspicuous after heat shock among nine rainbow trout HSPs. Qian et al. (2012) has also compared gene expression profiles of four shrimp HSPs in response to thermal stress and obtained similar results. The mechanism whereby heat shock affects the expression of HSP70 is very complicated. Keller et al. (2008) showed that ERK inhibitors PD98059 and U0126 blocked heat stress-induced ERK1/2 phosphorylation, and also diminished heat-induced HSP70 expression, which suggested that the heat shock response in zebrafish utilized mitogenactivated protein kinase (MAPK) signaling pathway. Because the expressions of HSPs are temperature-sensitive, they are all good candidates for studying TSD in fish species. Current study showed that HSPs were negatively correlated with some sex differentiation genes in gonads during high-temperature masculinization. For instance, CYP19A1A was significantly and negatively correlated with four HSPs (HSP27, DNAJB1, HSP70, and HSP90) in the ovary, three HSPs (DNAJB1, HSP70, and HSP90) in the female brain, and with HSP27 in the male brain. FOXL2/DMRT1 was significantly and negatively correlated with HSP27 in female brain, and HSP70 in male brain. These results show that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes (CYP19A1A, FOXL2, or DMRT1) in gonads. In this study, we found that the expression changes of some genes compared to control was different between the induction group and the recovery group. For instance, the expression of FSHβ/CYP19A1B did not significantly change in the brain of both sexes of the induction group, but was significantly down-regulated in the brain of both sexes of the recovery group. The expression of ERα was significantly upregulated in ovary in induction group and did not significantly change in recovery group. The expression levels of four HSPs were significantly up-regulated in the induction group and only three in the recovery group in the ovary. In the testis, the number of expression changes of HSPs was three in the induction group and only one (HSP70) in the recovery group. Collectively, the expressions of some genes, previously up-regulated in the induction group, were not significantly different

with control in the recovery group. From previous reports (Poonlaphdecha et al., 2013) and this study, we well know that the expressions of many genes were altered during high-temperature masculinization. The expressions of some altered genes returned to control level after culturing at 28 °C for three days. In the future, it is necessary to check the expression differences of some sex differentiation related genes in different life stages between high-temperature treated tilapia and control. In this study, we analyzed the effect of high temperature on mRNA expressions of 9 genes (CYP19A1B, ERα, ERβ, HSP27, DNAJB1, HSP70, HSP90, DNMT1 and DNMT3A) in both the brain and the gonad, and appeared the effect of high temperature on mRNA expression of many genes to be different between the brain and the gonad. For instance, the expression of ERα was significantly up-regulated in the induction and the recovery group in the female gonad (ovary), and downregulated in the induction and the recovery group in the female brain. Since the gonads are known estrogen targets, some groups have found that gonadal ERa is typically induced by exposure to estradiol (Nelson and Habibi, 2013). After high-temperature treatment, the changes of estradiol level were different between the gonad and the brain, and this might further affect the expression of Era in the brain and the gonad. In the absence of ligand, ERs are mostly found in the cytoplasm as complexes with inhibitory heat shock proteins. After hightemperature treatment, the expression of HSP90 was significantly upregulated in the induction and recovery group in female gonad (ovary), and did not significantly change in female brain. The upregulation of HSP90 expression in the ovary might also affect the expression of ERα. Collectively, the reason for the differential effect of high temperature on mRNA expressions of many genes between the brain and the gonad was very complicated. Owing to the important role of the brain in regulating sex differentiation, it is very necessary to study the indirect effect of expression changes of many genes in the brain after high-temperature treatment on gene expression in the gonad in the future. Acknowledgments The study was supported by the Research Award Fund for Outstanding Young Scientists of Shandong Province (BS2013NY002), the National Natural Science Foundation (31472270), and the earmarked fund for the Modern Agro-industry Technology Research System in Shandong Province (SDAIT-15-011-09). References Abucay, J.S., Mair, G.C., Skibinski, D.O.F., Beardmore, J.A., 1999. Environmental sex determination: the effect of temperature and salinity on sex ratio in Oreochromis niloticus L. Aquaculture 173, 219–234. Al-Madhoun, A.S., Chen, Y.X., Haidari, L., Rayner, K., Gerthoffer, W., McBride, H., O'Brien, E.R., 2007. The interaction and cellular localization of HSP27 and ERβ are modulated by 17β-estradiol and HSP27 phosphorylation. Mol. Cell. Endocrinol. 270, 33–42. Baras, E., Jacobs, B., Mélard, C., 2001. Effect of water temperature on survival, growth and phenotypic sex of mixed (XX–XY) progenies of Nile tilapia Oreochromis niloticus. Aquaculture 192, 187–199. Baroiller, J.F., D'Cotta, H., 2001. Environment and sex determination in farmed fish. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 130, 399–409. Baroiller, J.F., Chourrout, D., Fostier, A., Jalabert, B., 1995. Temperature and sex chromosomes govern sex ratios of the mouthbrooding cichlid fish Oreochromis niloticus. J. Exp. Zool. 273, 216–223. Baroiller, J.F., Guiguen, Y., Fostier, A., 1999. Endocrine and environmental aspects of sex differentiation in fish. Cell. Mol. Life Sci. 55, 910–931. Baroiller, J., D'Cotta, H., Bezault, E., Wessels, S., Hoerstgen-Schwark, G., 2009. Tilapia sex determination: where temperature and genetics meet. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 153, 30–38. Baron, D., Cocquet, J., Xia, X., Fellous, M., Guiguen, Y., Veitia, R.A., 2004. An evolutionary and functional analysis of FoxL2 in rainbow trout gonad differentiation. J. Mol. Endocrinol. 33, 705–715. Blázquez, M., Somoza, G.M., 2010. Fish with thermolabile sex determination (TSD) as models to study brain sex differentiation. Gen. Comp. Endocrinol. 166, 470–477. Blázquez, M., Navarro-Martín, L., Piferrer, F., 2009. Expression profiles of sex differentiation-related genes during ontogenesis in the European sea bass acclimated to two different temperatures. J. Exp. Zool. B Mol. Dev. Evol. 312, 686–700.

C.G. Li et al. / Comparative Biochemistry and Physiology, Part B 177–178 (2014) 36–45 Campos, C., Valente, L.M., Fernandes, J.M., 2012. Molecular evolution of zebrafish dnmt3 genes and thermal plasticity of their expression during embryonic development. Gene 500 (1), 93–100. Chang, X., Kobayashi, T., Senthilkumaran, B., Kobayashi-Kajura, H., Sudhakumari, C.C., Nagahama, Y., 2005. Two types of aromatase with different encoding genes, tissue distribution and developmental expression in Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol. 141, 101–115. Cheng, P.Z., Liu, X., Zhang, G.F., He, J.G., 2007. Cloning and expression analysis of a HSP70 gene from Pacific abalone (Haliotis discus hannai). Fish Shellfish Immunol. 22, 77–87. Cnaani, A., Lee, B.Y., Zilberman, N., Ozouf-Costaz, C., Hulata, G., Ron, M., D'Hont, A., Baroiller, J.F., D'Cotta, H., Penman, D.J., Tomasino, E., Coutanceau, J.P., Pepey, E., Shirak, A., Kocher, T.D., 2008. Genetics of sex determination in tilapiine species. Sex. Dev. 2 (1), 43–54. Conover, D.O., Heins, S.W., 1987. Adaptive variation in environmental and genetic sex determination in a fish. Nature 326, 496–498. D'Cotta, H., Fostier, A., Guiguen, Y., Govoroun, M.S., Baroiller, J.F., 2001a. Aromatase plays a key role during normal and temperature-induced sex differentiation of tilapia Oreochromis niloticus. Mol. Reprod. Dev. 59, 265–276. D'Cotta, H., Fostier, A., Guiguen, Y., Govoroun, M., Baroiller, J.F., 2001b. Search for genes involved in the temperature-induced gonadal sex differentiation in the tilapia, Oreochromis niloticus. J. Exp. Zool. 290, 574–585. Dang, G.C., Liu, Y.Q., Fu, P.S., Cheng, A.D., Liu, Y., Zhao, Y., Zhu, Y.A., Song, J.Y., Ji, X.S., 2011. Effect of high-temperature treatment on sex differentiation and growth in Nile tilapia Oreochromis niloticus. Prog. Fish. Sci. 32, 32–37. Davis, L.K., Pierce, A.L., Hiramatsu, N., Sullivan, C.V., Hirano, T., Grau, E.G., 2008. Genderspecific expression of multiple estrogen receptors, growth hormone receptors, insulin-like growth factors and vitellogenins, and effects of 17b-estradiol in the male tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol. 156, 544–551. D'Cotta, H., Pepey, E., Pfennig, F., Bienvenu, D., Gutzeit, H.O., Volff, J.N., Wennning, M., Baroiller, J.F., 2007. Sox9a, Sox9b and Amh are up-regulated in the gonads during natural and temperature-induced tilapia male differentiation. Proceedings of the 8th International Symposium on Reproductive Physiology of Fish, June 3rd–8th, Saint-Malo, France. D'Cotta, H., Pepey, E., Wessels, S., Poonlaphdecha, S., Reinelt, B., Hoerstgen-Schwark, G., Baroiller, J.F., 2008. Temperature-induced male differentiation in the Nile tilapia: gonad gene expression using female monosex populations and divergent thermosensitive lines. Proceedings of the 20th International Congress of Zoology, S10 Sex Determination & Differentiation, Paris, August, pp. 26–29. Devlin, R.H., Nagahama, Y., 2002. Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences. Aquaculture 208, 191–364. Du, S.J., Li, H., Bian, Y., Zhong, Y., 2008. Heat-shock protein 90α1 is required for organized myofibril assembly in skeletal muscles of zebrafish embryos. Proc. Natl. Acad. Sci. U. S. A. 105, 554–559. Fernandino, J.I., Hattori, R.S., Shinoda, T., Kimura, H., Strobl-Mazzulla, P.H., Strüssmann, C. A., Somoza, G.M., 2008. Dimorphic expression of DMRT1 and CYP19A1 (ovarian aromatase) during early gonadal development in pejerrey, Odontesthes bonariensis. Sex. Dev. 2, 316–324. Godwin, J., Luckenbach, J.A., Borski, R.J., 2003. Ecology meets endocrinology: environmental sex determination in fishes. Evol. Dev. 5, 40–49. Gomez, J.M., Weil, C., Ollitrault, M., Le Bail, P.Y., Breton, B., Le Gac, F., 1999. Growth hormone (GH) and gonadotropin subunit gene expression and pituitary and plasma changes during spermatogenesis and oogenesis in rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 113 (3), 413–428. Guiguen, Y., Baroiller, J.F., Ricordel, M.J., Iseki, K., Mcmeel, O.M., Martin, S.A., Fostier, A., 1999. Involvement of estrogens in the process of sex differentiation in two fish species: the rainbow trout (Oncorhynchus mykiss) and a tilapia (Oreochromis niloticus). Mol. Reprod. Dev. 54, 154–162. Horton, C.D., Halvorson, L.M., 2004. The cAMP signaling system regulates LH beta gene expression: roles of early growth response protein-1, SP1 and steroidogenic factor-1. J. Mol. Endocrinol. 32, 291–306. Ijiri, S., Kaneko, H., Kobayashi, T., Wang, D.S., Sakai, F., Paul-Prasanth, B., Nakamura, M., Nagahama, Y., 2008. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol. Reprod. 78, 333–341. Ji, X.S., Chen, S.L., Jiang, Y.L., Xu, T.J., Yang, J.F., Tian, Y.S., 2011. Growth differences and differential expression analysis of pituitary adenylate cyclase activating polypeptide (PACAP) and growth hormone-releasing hormone (GHRH) between the sexes in half-smooth tongue sole Cynoglossus semilaevis. Gen. Comp. Endocrinol. 170, 99–109. Kawamura, T., Omura, S., Sakai, S., Yamashita, I., 2003. No effects of estrogen receptor overexpression on gonadal sex differentiation and reversal in Medaka fish. Zool. Sci. 20 (1), 43–47. Keller, J.M., Escara-Wilke, J.F., Keller, E.T., 2008. Heat stress-induced heat shock protein 70 expression is dependent on ERK activation in zebrafish (Danio rerio) cells. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 150, 307–314. Kitano, T., Takamune, K., Kobayashi, T., Nagahama, Y., Abe, S.I., 1999. Suppression of P450 aromatase gene expression in sex-reversed males produced by rearing genetically female larvae at a high water temperature during a period of sex differentiation in the Japanese flounder (Paralichthys olivaceus). J. Mol. Endocrinol. 23, 167–176. Kitano, T., Hayashi, Y., Shiraishi, E., Kamei, Y., 2012. Estrogen rescues masculinization of genetically female medaka by exposure to cortisol or high temperature. Mol. Reprod. Dev. 79 (10), 719–726. Kohno, S., Katsu, Y., Urushitani, H., Ohta, Y., Iguchi, T., Guillette Jr., L.J., 2010. Potential contributions of heat shock proteins to temperature-dependent sex determination in the American alligator. Sex. Dev. 4, 73–87.

45

Kumar, P., Kamat, A., Mendelson, C.R., 2009. Estrogen receptor alpha (ER) mediates stimulatory effects of estrogen on aromatase (CYP19) gene expression in human placenta. Mol. Endocrinol. 23, 784–793. Leet, J.K., Gall, H.E., Sepúlveda, M.S., 2011. A review of studies on androgen and estrogen exposure in fish early life stages: effects on gene and hormonal control of sexual differentiation. J. Appl. Toxicol. 31 (5), 379–398. Monga, R., Ghai, S., Datta, T.K., Singh, D., 2011. Tissue-specific promoter methylation and histone modification regulate CYP19 gene expression during folliculogenesis and luteinization in buffalo ovary. Gen. Comp. Endocrinol. 173, 205–215. Navarro-Martín, L., Viñas, J., Ribas, L., Díaz, N., Gutiérrez, A., Di Croce, L., Piferrer, F., 2011. DNA methylation of the gonadal aromatase (CYP19A) promoter Is involved in temperature-dependent sex ratio shifts in the European sea bass. PLoS Genet. 7, 1–15. Nelson, E.R., Habibi, H.R., 2013. Estrogen receptor function and regulation in fish and other vertebrates. Gen. Comp. Endocrinol. 192, 15–24. Ojima, N., Yamashita, M., Watabe, S., 2005. Quantitative mRNA expression profiling of heat-shock protein families in rainbow trout cells. Biochem. Biophys. Res. Commun. 329, 51–57. Ospina-Alvarez, N., Piferrer, F., 2008. Temperature-dependent sex determination in fish revisited: prevalence, a single sex ratio response pattern, and possible effects of climate change. PLoS One 3, 1–11. Pérez, L., Peñaranda, D.S., Dufour, S., Baloche, S., Palstra, A.P., Van Den Thillart, G.E., Asturiano, J.F., 2011. Influence of temperature regime on endocrine parameters and vitellogenesis during experimental maturation of European eel (Anguilla anguilla) females. Gen. Comp. Endocrinol. 174 (1), 51–59. Pinzone, J.J., Stevenson, H., Strobl, J.S., Berg, P.E., 2004. Molecular and cellular determinants of estrogen receptor alpha expression. Mol. Cell. Biol. 24 (11), 4605–4612. Poonlaphdecha, S., Pepey, E., Canonne, M., de Verdal, H., Baroiller, J.F., D'Cotta, H., 2013. Temperature induced-masculinization in the Nile tilapia causes rapid up-regulation of both DMRT1 and AMH expressions. Gen. Comp. Endocrinol. 193, 234–242. Pratt, W.B., Toft, D.O., 1997. Steroid receptor interactions with heat shock protein and immunophilin chaperones. Endocr. Rev. 18 (3), 306–360. Qian, Z., Liu, X., Wang, L., Wang, X., Li, Y., Xiang, J., Wang, P., 2012. Gene expression profiles of four heat shock proteins in response to different acute stresses in shrimp, Litopenaeus vannamei. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 156, 211–220. Rougeot, C., Prignon, C., Ngouanakengne, C., Melard, C., 2008. Effect of high temperature during embryogenesis on the sex differentiation process in the Nile tilapia, Oreochromis niloticus. Aquaculture 276, 205–208. Shinoda, T., Miranda, L.A., Okuma, K., Hattori, R.S., Fernandino, J.I., Yoshizaki, G., Somoza, G.M., Strüssmann, C.A., 2010. Molecular cloning and expression analysis of FSHR and LHR in relation to FSHB and LHB subunits during the period of temperaturedependent sex determination in pejerrey Odontesthes bonariensis. Mol. Reprod. Dev. 77, 521–532. Tao, W., Yuan, J., Zhou, L., Sun, L., Sun, Y., Yang, S., Li, M., Zeng, S., Huang, B., Wang, D., 2013. Characterization of gonadal transcriptomes from Nile tilapia (Oreochromis niloticus) reveals differentially expressed genes. PLoS ONE 8 (5), e63604. http://dx. doi.org/10.1371/journal.pone.0063604. Tessema, M., Mullerbelecke, A., Horstgenschwark, G., 2006. Effect of rearing temperatures on the sex ratios of Oreochromis niloticus populations. Aquaculture 258, 270–277. Tosaka, R., Todo, T., Kazeto, Y., Mark Lokman, P., Ijiri, S., Adachi, S., Yamauchi, K., 2010. Expression of androgen receptor mRNA in the ovary of Japanese eel, Anguilla japonica, during artificially induced ovarian development. Gen. Comp. Endocrinol. 168, 424–430. Tsai, C., Chang, S., Wang, L., Chao, T., 2003. Temperature influences the ontogenetic expression of aromatase and oestrogen receptor mRNA in the developing tilapia (Oreochromis mossambicus) brain. J. Neuroendocrinol. 15, 97–102. Uchida, D., Yamashita, M., Kitano, T., Iguchi, T., 2004. An aromatase inhibitor or high water temperature induces oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 137, 11–20. Vernetti, C.H.M.M., Rodrigues, M.D.N., Perez, G.H.J., Perez, C.C., Moreira, C.G.Á., Nlewadim, A.A., Moreira, H.L.M., 2013. Genes involved in sex determination and the influence of temperature during the sexual differentiation process in fish: a review. Afr. J. Biotechnol. 12 (17), 2129–2146. Vizziano, D., Baron, D., Randuineau, G., Mahè, S., Cauty, C., Guiguen, Y., 2008. Rainbow trout gonadal masculinization induced by inhibition of estrogen synthesis is more physiological than masculinization induced by androgen supplementation. Biol. Reprod. 78 (5), 939–946. Wang, D., Kobayashi, T., Zhou, L., Paul-Prasanth, B., Ijiri, S., Sakai, F., Okubo, K., Morohashi, K., Nagahama, Y., 2007. Foxl2 up-regulates aromatase gene transcription in a femalespecific manner by binding to the promoter as well as interacting with ad4 binding protein/steroidogenic factor 1. Mol. Endocrinol. 21, 712–725. Wen, A.Y., 2010. Genetic Analyses of Sex-related Genes During Gonadal Differentiation and Sexual Phenotype Formation in Olive Flounder, Paralichthys olivaceus(Doctoral Dissertation) Institute of Oceanology, Chinese Academy of Sciences, pp. 86–110. Wu, F., Zhang, X., Zhang, W., Huang, B., Liu, Z., Hu, C., Wang, D., 2009. Expression of three gonadotropin subunits in Southern catfish gonad and their possible roles during early gonadal development. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 153 (1), 44–48. Yamaguchi, T., Yamaguchi, S., Hirai, T., Kitano, T., 2007. Follicle-stimulating hormone signaling and Foxl2 are involved in transcriptional regulation of aromatase gene during gonadal sex differentiation in Japanese flounder, Paralichthys olivaceus. Biochem. Biophys. Res. Commun. 359, 935–940. Zhang, Z., Zhang, Q., 2012. Molecular cloning, characterization and expression of heat shock protein 70 gene from the oyster Crassostrea hongkongensis responding to thermal stress and exposure of Cu2+ and malachite green. Gene 497, 172–180.