Plant Science 213 (2013) 30–37

Contents lists available at ScienceDirect

Plant Science journal homepage: www.elsevier.com/locate/plantsci

Differential expression of cysteine peptidase genes in the inner integument and endosperm of developing seeds of Jatropha curcas L. (Euphorbiaceae) Antônio J. Rocha a,1 , Emanoella L. Soares a,1 , José H. Costa a,∗ , Washington L.G. Costa a , Arlete A. Soares b , Fábio C.S. Nogueira c , Gilberto B. Domont c , Francisco A.P. Campos a a

Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Ceará, Fortaleza, CE, Brazil Departamento de Biologia, Universidade Federal do Ceará, Fortaleza, CE, Brazil c Unidade Proteômica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil b

a r t i c l e

i n f o

Article history: Received 1 August 2013 Received in revised form 26 August 2013 Accepted 27 August 2013 Available online 5 September 2013 Keywords: Programmed cell death Protein processing Oilseeds Vacuolar processing enzyme KDEL-tailed cysteine peptidase

a b s t r a c t In several plant tissues, programmed cell death (PCD) is mediated by the combined action of cysteine peptidases, namely KDEL-tailed cysteine peptidases (KDEL-CysEP) and vacuolar processing enzymes (VPE). Here, we performed a search of the draft genome of Jatropha curcas L. (Euphorbiaceae) and identified 2 genes for KDEL-CysEP (Jc-CysEP1 and Jc-CysEP2) and 3 genes for VPE (Jc-ˇVPE, Jc-VPE and Jc-ıVPE) and determined the expression patterns of these genes by RT-qPCR in integument and cellular endosperm of seeds collected at seven different developmental stages. We were able to demonstrate that the expression of Jc-CysEP1, Jc-CysEP2, Jc-ˇVPE and Jc-VPE proceeded rapidly from Stage IV, with Jc-CysEP2 displaying the highest relative expression; expression of Jc-ıVPE could not be detected in any of the tissues/developmental stages analyzed. Additionally, we showed that the expression pattern of these peptidases correlates with anatomical changes in integument and cellular endosperm, thus suggesting a role for both classes of peptidases in PCD and in protein processing, both of which occur simultaneously in each of these tissues. © 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Jatropha curcas L. (Euphorbiaceae) seeds are widely recognized as a potential source of raw material for the production of biodiesel. The exploitation of this potential is hampered by a lack of understanding of key aspects of the developmental biology of the seeds, such as the roles of the inner and outer integuments in providing the carbon and nitrogen sources that will feed the enzymatic machinery responsible for the deposition of fatty acids, triacylglycerols and reserve protein in the developing endosperm. Seeds are made of three tissues, namely the seed coat derived from maternal tissues, the endosperm and the embryo proper, both of which are fertilization products [1]. The seed coat, which is

Abbreviations: BLAST, basic local alignment search tool; cDNA, complementary DNA; EST, expressed sequence tag; KDEL-CysEP, KDEL-tailed cysteine peptidase; nr, non redundant; SRA, sequence read archive; TSA, transcriptome shotgun assembly; VPE, Vacuolar processing enzyme; WGS, whole-genome shotgun. ∗ Corresponding author at: Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Ceará, Campus do Pici, Cx., Postal 6033, Fortaleza, Ceará, CEP 60451-970, Brazil. Tel.: +55 85 3366 9825; fax: +55 85 3366 9829. E-mail address: [email protected] (J.H. Costa). 1 Contributed equally. 0168-9452/$ – see front matter © 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.plantsci.2013.08.009

involved in the determination of several quality traits, originates from the differentiation of one or two integuments, in a sequence of events which besides culminating with its formation, delivers to the embryo and endosperm nutrients ultimately taken from the mother plant [2]. Anatomical studies of J. curcas seeds are scanty and restricted to mature seeds [3]. In Ricinus communis, another Euphorbiaceae species, seed anatomy is already well established [4], but it is not known to what extent it is similar to that of J. curcas and for this reason a detailed anatomical description of J. curcas seeds is necessary in order to avoid misunderstandings, especially in studies that make use of isolated tissues. The concept that maternal tissues such as the nucellus and integuments may act as a transient source of reserves which may be mobilized to suit the needs of the developing seeds, has received wide experimental support [5–9], but details of the mechanisms involved in the delivery of carbon and nitrogen sources are lacking, even though it is firmly established that programmed cell death (PCD) plays a pivotal role in it [10]. Developmental PCD has been studied in some detail in a variety of seeds such as castor [6,9], wheat [11] and chayote [7], where it has been shown that two classes of cysteine endopeptidases, namely the vacuolar processing enzyme (VPE) and the KDEL-tailed cysteine endopeptidase (KDELCysEP), are the executors of cell death. The VPEs and KDEL-CysEP

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

are members of the legumain (C13) and papain (C1) families of cysteine peptidases, according to the classification of the MEROPS database (http://merops.sanger.ac.uk). These enzymes were originally thought to be responsible for the maturation/activation of seed reserve proteins [9], but it is well established now that they are also involved in the maturation/activation of various vacuolar proteins [12,13]. The publication of the draft genome sequence of J. curcas [14,15] and of large scale transcriptomic studies [2,16–19] have created an important database to foster protein identification [20,21] and gene expression studies. In the present work, we took advantage of this flurry of genomic and transcriptomic information to identify in the J. curcas genome all of the genes coding for VPEs and KDELCysEPs. We also studied the expression of these genes in the inner integument and in the developing endosperm in order to gain some insight of the involvement of these genes in PCD and in the maturation of storage proteins. Additionally, we provide an anatomical description of the developing seeds in order to better interpret the functional significance of the changes in gene expression of the VPEs and KDEL-CysEPs during seed development. 2. Results 2.1. Histology of seed development The seeds of J. curcas are bitegmic and have a crassinucellate nucellus that extends beyond both integuments, protruding from the micropyle until the obturator, forming the nucellar beak (Fig. 1A). Ten days after pollination, apart from a thin layer in the micropylar region, the nucellus is totally consumed. The inner integument has vascular bundles and in the early stages of development as the result of periclinal and anticlinal cell divisions it becomes plurilayered and thicker (Fig 1A and B). However, in early embryogenesis, the cell layers closer to the central cavity become vacuolated and collapse forming a layer of cell debris (Fig. 1C), leading to a diminution in the number of cell layers. At this juncture, the cell layers closer to the testa expand, become vacuolated and no longer proliferate. In late embryogenesis, the mesophyll of the inner integument is reduced to a few layers and the seed is almost entirely filled with cellular endosperm (Fig. 1D). Another distinguishing feature of this developmental stage is that the endosperm cells closer to the embryo become collapsed forming a layer of cell corpses as seen in the mesophyll of the inner integument (Fig. 1E). 2.2. Identification of cysteine peptidase genes in J. curcas databases Our initial efforts were focused on the identification of cysteine peptidase genes that code for KDEL-CysEPs and VPEs that belong to the papain (C1) and legumain (C13) families of cysteine peptidases, respectively. A tBLASTn search in the J. curcas genome revealed 25 hits to members of the papain family, with significant E values (2e121 to 2e-16). From these only Jcr4S01104 contig presented the C-terminal extension KDEL and Jcr4S00066 contig presented the Cterminal extension RDEL in the deduced proteins. A more detailed bioinformatics analysis through tBLASTn search against J. curcas sequences is available in NCBI databases, revealed also these same sequences. The full-length cDNA sequences coding for the proteins with the KDEL (EZ413967.1) and RDEL (EZ409103.1) C-terminal extensions are available in the TSA database (GenBank – NCBI). Within the legumain family only 3 genes were identified in the J. curcas genome (contigs: Jcr4S00409; Jcr4S00087; Jcr4S00049). Two full-length cDNAs with accession numbers (EZ418688) and (EZ411384; EZ417273) were retrieved from the TSA database

31

corresponding to genes coding for VPEs within Jcr4S00409 and Jcr4S00087 contigs, respectively. No cDNA corresponding to the VPE gene within Jcr4S00049 contig was found in transcript databases (EST, TSA or SRA). Additionally, we were unable to detect transcripts corresponding to this sequence when we used two pairs of primers (Table 1) in RT-qPCR analysis. 2.3. Phylogenetic analysis of KDEL-CysEP and VPE cysteine peptidases In order to establish a phylogenetic analysis, we have retrieved all of the KDEL-CysEP and VPE genes from Arabidopsis thaliana, R. communis and Manihot esculenta genomes. After analyses, three genes coding for KDEL-CysEPs were found in A. thaliana, corresponding to entries AthCEP1, AthCEP2 and AthCEP3 [13], three genes in M. esculenta and two genes in R. communis, corresponding to CysEP1 and CysEP2 [13]. For VPE, four genes were found in A. thaliana, corresponding to ˛, ˇ,  and ı-VPEs [22–26], four genes in M. esculenta and two genes in R. communis. The J. curcas proteins corresponding to Jcr4S01104 and Jcr4S00066 clustered in two different clades, each clade constituted by orthologous proteins from the three Euphorbiaceae species (Fig. 2A). In this work we named these as Jc-CysEP1 (corresponding to Jcr4S01104) and Jc-CysEP2 (corresponding to Jcr4S00066) (Fig. 2A) based on orthologous genes from R. communis. No orthology could be established between genes from A. thaliana and the three Euphorbiaceae species (Fig. 2A). The alignment of the KDEL-CysEPs from J. curcas with the corresponding peptidases from R. communis, M. esculenta and A. thaliana (Supplementary Fig. 1) revealed the presence of features of KDELCysEPs [13] such as pre-sequence, pro-peptide within which is located the conserved motif of noncontiguous amino acid sequence ERFNIN (EX3RX3FX2NX3I/VX3N), catalytic pocket (QCHN), amino acids forming the S2 pocket and the ER retention signal. The VPEs were distributed in three different clades (Fig. 2B), within which are found the ␣, ␤, ␦ and ␥-VPEs from A. thaliana, the ␤ and ␥ from R. communis and ␤-1a and 1b, ␦ and ␥ from M. esculenta. The J. curcas VPEs from Jcr4S00409 and Jcr4S00049 contigs were classified as Jc-␤VPE and Jc-␦VPE, respectively as they are orthologous to corresponding VPE genes from R. communis, M. esculenta and A. thaliana, whereas the VPE from contig Jcr4S00087 was classified as a JC-␥VPE due to the higher sequence similarity (75%) with the ␥-VPE from A. thaliana (Fig. 2B). The alignment of the VPEs from J. curcas with corresponding peptidases from A. thaliana, R. communis, M. esculenta and other species, revealed several conserved regions (Supplementary Fig. 2). 2.4. Analysis of gene expression of KDEL-CysEPs and VPEs in developing J. curcas seeds The development of J. curcas seeds was divided into seven stages based on the time elapsed after pollination. The formation of the cellular endosperm begins at Stage IV (Fig. 1B), while the inner integument is present in Stages I to VI, being absent in Stage VII. The quantification of the relative transcript levels of KDEL-CysEP and VPE genes in endosperm and inner integument of developing seeds was carried out by RT-qPCR using four reference genes (GAPDH, PP2A2, EF1-˛ and T˛2) which corresponded to the best combination of stable genes under our experimental conditions as established by GeNorm analysis (Supplementary Fig. 3). The primer specificity for all studied genes was initially tested via standard RT-PCR, which amplified single products with expected sizes (data not shown). Additionally, melting curves in RT-qPCR assays displayed one single peak for each one of the products (Supplementary Fig. 4).

32

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

Fig. 1. Histological features of J. curcas seed development. (A). Seed structure 48 h after pollination. (B). Seed structure at developmental Stage IV; a magnified representation of the highlighted area is shown in (C). (D) Seed structure at developmental Stage V; a magnified representation of the highlighted area is shown in (E). Legends: arrowheads, vascular bundles; arrows, layer of cell corpses; C, caruncle; CC, central cavity; E, endosperm; Em; embryo; Ii, inner integument; Nb, nucellar beak; Nu, nucellus; Ob, obturator; Oi, outer integument; Ov, ovary.

Expression of Jc-CysEP1 occurred mainly in the inner integument (Fig. 3A), with low relative levels during Stage I to Stage III which then increased gradually from Stage IV, reaching the highest level at Stage VI. On the other hand, Jc-CysEP2 transcripts were detected both in the inner integument and in the endosperm (Fig. 3B). The relative expression of Jc-CysEP2 in the inner integument was very low during the development stages I, II and III, but then increasing sharply at Stage IV, to drop gradually up to Stage VI. As for the developing endosperm, the relative expression of Jc-CysEP2 was higher at Stage IV, but then decreased slightly up to Stage VII in which seed maturation was completed. During the development of the inner integument, the relative expression of Jc-ˇVPE changed little from Stage I to III, but then increased gradually during subsequent stages. In the endosperm, it increased gradually to reach the highest level at Stage VII in which the seeds reached full maturity (Fig. 4A). The relative expression of Jc-VPE increased gradually during the development of the inner integument reaching its highest level at Stage VI (Fig. 4B), while its expression in the endosperm was higher at Stage IV and decreased gradually during subsequent stages.

3. Discussion Our studies were prompted by demonstrations of the occurrence of PCD during the development of seed tissues such as the integuments, nucellus and endosperm [9,13], together with the knowledge that KDEL-CysEPs and VPEs mediate PCD in several other plant tissues [6,9,13,27–29]. This lead us to investigate the expression of KDEL-CysEP and VPE genes in the inner integument and endosperm of developing seeds of J. curcas, so that we could evaluate the involvement of these peptidases in PCD as well as in the maturation of storage proteins. Since the involvement of cysteine peptidases in PCD in R. communis has been extensively studied [8,9,13], and considering the close phylogenetic relationship between this species and J. curcas, we found it necessary to ascertain whether the architectures of the seeds from these species are similar, so that we could better correlate our results with the aforementioned studies. In this regard, our results (Fig. 1A–E) demonstrate important differences in developmental features of seeds of these two species, such as the relatively rapid degradation of the nucellus (within ten days after fertilization, corresponding

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

33

Fig. 2. Phylogenetic trees of cysteine proteinase KDEL-tailed (A) and VPEs (B) from Arabidopsis thaliana, Manihot esculenta, Ricinus cummunis, Jatropha curcas and other species. Horizontal distances are proportional to evolutionary distances according to the scale shown at the bottom. The trees were obtained by the Neighbor-joining method [36] with bootstrap values (from 1000 replicates) using the MEGA 5 program [37].

Fig. 3. Relative expression profiles of Jc-CysEP1 (A) and Jc-CysEP2 (B) in inner integument (Stages I–VI) and endosperm (Stages IV–VII) during seed development of J. curcas. Error bars are ±SD values of four RT-PCR reactions from one set of total RNA.

Fig. 4. Relative expression profiles of Jc-ˇVPE (A) and Jc-VPE (B) genes in inner integument (Stages I–VI) and endosperm (Stages IV–VII) during seed development of J. curcas. Error bars are ±SD values of four RT-PCR reactions from one set of total RNA.

34

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

Table 1 Primer sequences of reference and target genes used for gene expression analysis in integument and endosperm of J. curcas developing seeds. Gene

Access code (GenBank)

Primer sequences (5 –3 )

ACT11

GT981647

T˛2

GT973596.1

EF-1˛

GT97112.1

PP2A2

GT981067

PUB3

GT982408.1

GAPDH

GT982081

Jc-CysEP1 (Jcr4S01104) Jc-CysEP2 (Jcr4S00066) Jc-ˇVPE (Jcr4S00409) Jc-VPE (Jcr4S00087) Jc-ıVPE (Jcr4S00049)

EZ413967

F 5 CTAAAGGCTAATGGGGAAAC 3 R 5 CAACCACTTGATTAGAAGCC 3 F 5 TTCACTGTCTATCCATCTCC 3 R 5 ATGAGGAAATCAACCTGAGAG 3 F 5 TGCTGTGCTCATTATTGAC 3 R 5 GCATCCATCTTGTTGCAG 3 F 5 AATATGGAAATGCCAACGTC 3 R 5 GTAAGCAGAAGACCTGACTC 3 F 5 GATAGAAGTCCTCCAGAAGCA 3 R 5 CAATAGTGTCTGAGCTTTC 3 F 5 TGGTTGATCTCACTGTTAGG 3 R 5 AGACTCCTCTTTGATAGCAG 3 F 5 TACTCAGAGGGCGTATTTACTG 3 R 5 CTTCACAATCCAATATTTGGTTCC 3 F 5 AAATTGATGGATACGAAATGGTG 3 R 5 TCTCCAGTGAATATTGCCTC 3 F 5 ATATAGGACGGTAAAGGAGAGG 3 R 5 CTTGAATTTCCATATTCCATCAC 3 F 5 AATATTTATGCAACCACAGCAG 3 R 5 ATTGTGTACATCGCTGTCCT 3 F1 5 GAGTTCCCAAGGATTACACTG 3 R1 5 TTGCCACTACCTCCATTGAG 3 F2 5 GGAGTTCCCAAGGATTACAC 3 R2 5 ACGACTTTGCCACTACCTC 3

EZ409103 EZ418688 EZ411384 BABX01031884

to Stage I) which as a consequence brings the inner integument in close contact with the developing embryo and the endosperm. This suggests that the role of providing nitrogen and carbon sources for the development of the embryo and endosperm which in R. communis seems to be played by the nucellus, in J. curcas this role is played by the inner integument. In silico analyses revealed that two KDEL-CysEP (Jc-CysEP1 and Jc-CysEP2) and three VPE (Jc-␤VPE, Jc-␥VPE and Jc-␦VPE) genes were present in the J. curcas genome (Fig. 2; Supplementary Figs. 1 and 2). However, as we cannot disregard the possibility that other homologous genes may exist due to the fact that the J. curcas genome so far available covers ∼95% of the gene-containing regions [14], we performed searches in other J. curcas databases (nr, EST, TSA or SRA) in NCBI, with no avail. Thus, we can claim that we have probably retrieved all KDEL-CysEP and VPE genes in the J. curcas genome. In this context, searches in other Euphorbiaceae genomes (M. esculenta and R. communis) revealed that in these species the KDEL-CysEPs and VPEs are also encoded by similar gene families (Fig. 2; Supplementary Figs. 1 and 2). Studies performed in the A. thaliana genome also indicated that these peptidases are encoded by an equivalent number of genes (3 CysEP and 4 VPEs) [8,23,30,31]. Interestingly, the number of genes coding for KDEL-CysEPs and VPEs in J. curcas were more similar to those of R. communis than to other species analyzed, differing only in the absence of a ıVPE in R. communis. This observation is in agreement with the existence of a higher degree of microsynteny between J. curcas and R. communis genomes when compared to other available plant genomes [14]. Expression analyses of the inner integument (present in Stages I to VI) and the cellular endosperm (present in Stages IV to VII) during seed development, revealed that the cysteine peptidase genes were expressed mainly from Stage IV (Figs. 3 and 4). In effect, at this stage in the inner integument, the cell layers closer to the cellular endosperm are highly vacuolated and a layer of cell debris surrounds the cellular endosperm (Fig. 1C), suggesting the occurrence of PCD in these integument cells. Equally, in the cellular endosperm, cell layers closer to the embryo also are highly vacuolated and a layer of cell corpses surrounds the embryo (Fig. 1E), indicating that PCD is taking place. At this stage, the cellular endosperm is being filled with reserve proteins and therefore the presence of peptidases related to protein maturation and targeting may be expected.

Amplicon (bp)

Primer efficiency (%)

68

120

207

90

137

95

92

120

107

98

73

100

138

110

138

110

81

86

150

97

96

–

103

–

The KDEL-CysEP genes display different spatio-temporal patterns of expression. Jc-CysEP2 had the highest relative expression both in integument and endosperm, while the relative expression of Jc-CysEP1 was much lower than Jc-CysEP2 and its expression was confined essentially to the inner integument (Fig. 3). These results suggest that Jc-CysEP2 has a crucial role in protein digestion both in cellular endosperm and in the inner integument, while the role of Jc-CysEP1 is restricted to the inner integument. The Jc-ˇVPE and Jc-VPE genes also displayed different spatiotemporal expression patterns (Fig. 4), but our attempts to detect expression of the Jc-ıVPE failed and BLAST searches in NCBI transcript databases containing ESTs of J. curcas from different tissues and conditions did not reveal any evidence that this gene is functional. Similar analyses of transcript databases of R. communis and M. esculenta also failed to detect any EST of ı-VPE in these species. These findings, together with the fact that this gene is not even present in the R. communis genome, indicate that ı-VPE may be a pseudogene in a process of deletion. The Jc-ˇVPE and Jc-VPEs have opposing relative expression patterns in the cellular endosperm: while the relative expression of Jc-ˇVPE gradually increases from Stage IV to Stage VII, the relative expression of Jc-VPE is highest at Stage IV, decreasing gradually until Stage VII. This expression profile was similar to that observed for orthologous ˇ and -VPE genes in developing seeds of A. thaliana [24] where it was suggested that the ␤-VPE is essential for the processing of storage proteins, while ␥-VPE together with ␣-VPE and an aspartic peptidase would complement the ␤-VPE activity in this processing [24,25]. However, a role for -VPE in PCD events related to defense against pathogen attack [32] or in response to mycotoxin [28] was also evident. In this context, it should be noted that the decrease of Jc-VPE expression during endosperm development (Fig. 4B), is similar to that of Jc-CysEP2 (Fig. 3B) which encodes a KDEL-tailed cysteine peptidase widely recognized as mediating PCD [13]. Therefore we are compelled to suggest that the opposing behavior of Jc-ˇ and Jc-VPE expression in J. curcas endosperm indicates different roles for these genes: Jc-ˇVPE would be related to the maturation of reserve proteins, while Jc-VPE would be involved in PCD. In the inner integument, Jc-VPE is expressed in all developmental stages, but relative expression is higher at stages IV to VI, while Jc-ˇVPE relative expression in early developmental stages

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

was fairly low when compared to Stages IV to VI, showing highest relative expression at Stage VI (Fig. 4). In A. thaliana seeds, the inner and outer integuments differentiate into the seed coat [1,33,34], in a process involving PCD, in which a VPE, specifically a ␦-VPE have a defining role [35]. Taken together, our results imply that ␤ and ␥-VPE play complementary roles in PCD of the inner integument and that ␥-VPE acts from the early stages of seed development. In conclusion, Jc-CysEP2 seems to play a crucial role in the development of the inner integument and endosperm, not only in the processing of proteins, but also in PCD, while the role of Jc-CysEP1 seems to be restricted to PCD events in the inner integument. Regarding the VPEs, it is evident that Jc-␥VPE acts in PCD events both in the endosperm and inner integuments, while Jc␤VPE appears to act in PCD events as well as in protein processing. A more detailed picture of the involvement of these peptidases in particular events in these tissues will have to wait until transcriptomic and proteomic studies are performed in specific cell layers from these tissues.

4. Materials and methods 4.1. Identification of cysteine peptidase genes in J. curcas databases

35

VPE (NP 910213); R. cummunis Rc-␤VPE (XM 002509531), Rc␥VPE (XM 002516426); S. lycopersicum LeVPE1(CAB51545). The multiple sequence alignment was carried out using the Clustal X [38]. All proteins used in alignments and phylogenetic trees are available in the supplementary data (CysEP proteins.txt and VPE proteins.txt files). 4.3. PCR primer design Six housekeeping genes [actin-11 (ACT11), tubulin alpha-2 (T␣2), elongation factor 1-alpha (EF1-␣), protein phosphatase 2A-2 (PP2A2), polyubiquitin-3 (PUB3) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used to obtain the more stable reference genes to be used in the RT-qPCR normalization, and the corresponding sequences were retrieved from a seed EST database of J. curcas [16]. The gene sequences of the VPE and KDEL-CysEP were obtained as previously described. The primers were designed in the exon/exon junction using Perl Primer v1.1.19 software [39] with melting temperatures (Tm) of 58–60◦ C, primer length of 19–24 bp and amplicon size of 68 to 207 bp (Table 1). 4.4. Seed harvest, tissue isolation and histological studies

The sequences coding for VPEs and KDEL-CysEPs were retrieved from the genome of J. curcas (www.kazusa.or.jp/jatropha/) using homologous cysteine endopeptidase from A. thaliana through a tBLASTn search. Additional BLAST searches were also carried out in NCBI databases: nr, WGS, EST, TSA and SRA (transcript and genomic libraries). The DNA sequences obtained from BLAST results were manually annotated to find the corresponding cDNAs which were then translated into putative proteins sequence using the translate tool of EXPASY web server (http://web.expasy.org/translate). Genes of VPEs and KDEL-CysEPs were also retrieved from the genomes of two Euphorbiaceae species (R. communis and M. esculenta) and from A. thaliana, available in the phytozome database (http://www.phytozome.net), in order to estimate/confirm the gene number in these species as well as to establish a phylogenetic analysis.

Seeds of J. curcas were collected from plants grown at the Experimental Farm of the Federal University of Ceará. Female flowers were hand-pollinated and developing seeds were collected at 10, 15, 20, 25, 30 and 35 days after pollination (DAP) denominated Stages I–VI; mature seeds is Stage VII. The mesophyll of the inner integument and cellular endosperm were manually isolated from developing seeds with the help of a binocular microscope. Mesophyll of the inner integument was isolated from seeds at Stages I to VI, as at Stage VII it was completely consumed. Cellular endosperm was isolated from seeds at Stages IV, as in earlier developmental stages cellularization has not yet initiated. For histological studies, developing seeds were fixed in Karnovsky solution [40], dehydrated in ethanol series and slowly embedded in historesin Leica for at least 20 days. Thin sections of 5 ␮m were prepared in a rotatory microtome LEICA 2065, stained with toluidine blue and followed by basic fuchsin [41] and mounted in Tissue Mount for light microscopy.

4.2. Sequence and phylogenetic analysis

4.5. Extraction of total RNA and cDNA synthesis

Phylogenetic trees were constructed from the deduced amino acid sequences of VPEs and KDEL-CysEPs from J. curcas, R. communis, M. esculenta, A. thaliana and homologous annotated proteins from other species (obtained from GenBank (NCBI) by a NeighborJoining method [36] with bootstrap values (1000 replicates) using the MEGA 5 program [37]. The accession numbers for KDEL-CysEPs retrieved from databases were: A. thaliana AthCEP1 (NM 124405), AthCEP2 (Q9STL4), AthCEP3 (NM 114696); Glycine max CysP1 (AB092555), CysP2 (AB092557); Hemerocallis SEN102 (X74406), SEN11 (U12637); J. curcas Jc-CysEP1 (Jcr4S01104), JcCysEP2 (Jcr4S00066); M. esculenta Me-CysEP1(scaffold12794), MeCysEP2a (scaffold05474), Me-CysEP2b (scaffold04175); Nicotiana tabacum NtCP2 (AY881010), NtCP56 (EU429306); Phalaenopsis 0141 (U34747), R. communis Rc-CysEP1 (XM 002511231), RcCysEP2 (XM 002515002) and for VPEs they were: A. thaliana ␣-VPE (NM 128154), ␤-VPE (NM 104948), ␥-VPE (NM 119448), ␦-VPE (AF521661), ␦-VPE variant (AEE76348); J. curcas Jc␤VPE (Jcr4S00409), Jc-␥VPE (Jcr4S00087), Jc-␦VPE (Jcr4S00049); M. esculenta Me-␤VPE1a (scaffold07035), Me-␤VPE1b (scaffold11581), Me-␥VPE(scaffold12118), Me-␦VPE (scaffold06556); N. tabacum Nt-VPE1a (AB075947), Nt-VPE1b (AB075948), Nt-VPE2 (AB075949), Nt-VPE3 (AB075950), NtPB1 (CAB42650); O. sativa

Total RNA was extracted in two steps. First, approximately 300 mg of seed tissues obtained from a pool of 20 seeds were pulverized in liquid nitrogen and the total RNA was extracted using the Plant RNA Purification Reagent (Invitrogen® ) according to the manufacturer’s instructions. In order to improve RNA quality, the samples were subjected to further purification using the RNeasy Plant Mini Kit (Quiagen® ), according to the manufacturer’s instructions, which included an on-column DNase digestion to eliminate contamination with genomic DNA. The concentration of RNA in samples was determined using a Nanodrop 2000 spectrophotometer (Thermo Scientific) at 260 nm. The purity of total RNA was evaluated by 260/280 nm and 260/230 nm absorbance ratios [42]. To determine the integrity of total RNA, 0.5 ␮g of RNA was analyzed by electrophoresis on 1.2% agarose gel stained with ethidium bromide (0.5 ␮g mL−1 ). Synthesis of cDNA was performed using 2 ␮g of purified total RNA in the reverse transcription reaction. For each reaction, 1 ␮l of Oligo-DT12-18 0.5 ␮g ␮L−1 (Invitrogen® ), 1 ␮l of dNTP 10 mM (Quiagen® ), 2.4 ␮l of MgCl2 25 mM (Invitrogen® ), 4 ␮l of 5X reaction buffer (ImProm-IITM Reaction Buffer, Promega® ), ultrapure water (Milli-Q) autoclaved RNase-free and l ␮L of reserve transcriptase-IITM (Promega® ) were added to each sample,

36

A.J. Rocha et al. / Plant Science 213 (2013) 30–37

completing a reaction volume to 20 ␮l. The cDNA obtained was stored at −20 ◦ C until used. 4.6. Real-time RT-qPCR The RT-qPCR was performed using the Mastercycler® ep realplex (Eppendorf AG, Hamburg) in a reaction plate of 96 wells and the assays were conducted as indicated by Power SYBR Green PCR Master Mix (Applied Biosystems). Each reaction contained 0.4 ␮l of each primer (400 ␩moles), 1 ␮l cDNA (100 ␩g), 10 ␮l 1X Power SYBR Green PCR Master Mix and 8.2 ␮L of Milli-Q water in a final volume reaction of 20 ␮l. Aliquots of the same cDNA sample were used in all sets of primers in each experiment. The PCR assays were performed in quadruplicate. Reactions were run using the following parameters: 10 min at 95 ◦ C for activation of the enzyme, followed by 40 cycles of denaturation at 95 ◦ C for 15 s, annealing at 55 ◦ C for 20 s, and extension at 60 ◦ C for 20 s. After amplification was complete, a melting curve in which fluorescence (F) was plotted against temperature (T), was obtained by holding at 95 ◦ C for 15 s and then at 60 ◦ C for 15 s, followed by heating slowly at 0.03 ◦ C s−1 to 95 ◦ C. 4.7. Data analyses The analysis of relative expression was carried out by the 2−CT method [43]. Calculation of normalized relative expression levels was done using the qbasePLUS software version 1.5 (Biogazelle) [44]. Normalization was performed using four reference genes (GAPDH, PP2A2, EF1-˛ and T˛2) chosen from 6 tested genes (ACT11, PUB3, GAPDH, PP2A2, EF1-˛ and T˛2) and validated using the genormPLUS [45] module in qbasePLUS . All qPCR reactions were performed in quadruplicate and Ct values were averaged. Primer efficiency was determined by the dilution method, as well as by performing a temperature gradient reaction from 50 to 65 ◦ C. Reaction products were analyzed by melting curves in order to verify the absence of unspecific products and/or primer/dimer formation. Acknowledgements The financial support of PETROBRAS, CNPq, CAPES, FUNCAP and Banco do Nordeste is gratefully acknowledged. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.plantsci.2004. 08.011. References [1] T. Beeckman, R. De Rycke, R. Viane, D. Inzé, Histological study of seed coat development in Arabidopsis thaliana, J. Plant Res. 113 (2000) 139–148. [2] H. Jiang, C. Kohler, Evolution, function, and regulation of genomic imprinting in plant seed development, J. Exp. Bot. 63 (2012) 4713–4722. [3] L. Reale, A. Ricci, F. Ferranti, R. Torricelli, R. Venanzoni, M. Falcinelli, Cytohistological analysis and mobilization of reserves in Jatropha curcas L. seed, Crop Sci. 52 (2012) 830–835. [4] R.P. Singh, Structure and development of seeds in Euphorbiaceae: Ricinus communis L., Phytomorphology 4 (1954) 118–123. [5] A.M. Jones, Programmed cell death in development and defense, Plant Physiol. 125 (2001) 94–97. [6] J.S. Greenwood, M. Helm, C. Gietl, Ricinosomes and endosperm transfer cell structure in programmed cell death of the nucellus during Ricinus seed development, Proc. Natl. Acad. Sci. (USA) 102 (2005) 2238–2243. [7] L. Lombardi, S. Casani, N. Ceccarelli, L. Galleschi, P. Picciarelli, R. Lorenzi, Programmed cell death of the nucellus during Sechium edule Sw. seed development is associated with activation of caspase-like proteases, J. Exp. Bot. 58 (2007) 2949–2958.

[8] M. Helm, M. Schmid, G. Hierl, K. Terneus, L. Tan, F. Lottspeich, M.J. Kieliszewski, C. Gietl, KDEL-tailed cysteine endopeptidases involved in programmed cell death, intercalation of new cells, and dismantling of extensin scaffolds, Am. J. Bot. 95 (2008) 1049–1062. [9] F.C. Nogueira, G. Palmisano, E.L. Soares, M. Shah, A.A. Soares, P. Roepstorff, F.A. Campos, G.B. Domont, Proteomic profile of the nucellus of castor bean (Ricinus communis L.) seeds during development, J. Proteomics 75 (2012) 1933–1939. [10] J. Kacprzyk, C.T. Daly, P.F. McCabe, The botanical dance of death: programmed cell death in plants, Adv. Bot. Res. 60 (2011) 169–261. [11] F. Dominguez, J. Moreno, F.J. Cejudo, The nucellus degenerates by a process of programmed cell death during the early stages of wheat grain development, Planta 213 (2001) 352–360. [12] A.L. Tan-Wilson, K.A. Wilson, Mobilization of seed protein reserves, Physiol. Plant. 145 (2012) 140–153. [13] G. Hierl, U. Vothknecht, C. Gietl, Programmed cell death in Ricinus and Arabidopsis: the function of KDEL cysteine peptidases in development, Physiol. Plant. 145 (2012) 103–113. [14] S. Sato, H. Hirakawa, S. Isobe, E. Fukai, A. Watanabe, M. Kato, K. Kawashima, C. Minami, A. Muraki, N. Nakazaki, C. Takahashi, S. Nakayama, Y. Kishida, M. Kohara, M. Yamada, H. Tsuruoka, S. Sasamoto, S. Tabata, T. Aizu, A. Toyoda, T. Shin-i, Y. Minakuchi, Y. Kohara, A. Fujiyama, S. Tsuchimoto, S. Kajiyama, E. Makigano, N. Ohmido, N. Shibagaki, J.A. Cartagena, N. Wada, T. Kohinata, A. Atefeh, S. Yuasa, S. Matsunaga, K. Fukui, Sequence analysis of the genome of an oil-bearing tree, Jatropha curcas L., DNA Res. 18 (2011) 65–76. [15] H. Hirakawa, S. Tsuchimoto, H. Sakai, S. Nakayama, T. Fujishiro, Y. Kishida, M. Kohara, A. Watanabe, M. Yamada, T. Aizu, A. Toyoda, A. Fujiyama, S. Tabata, K. Fukui, S. Sato, Upgraded genomic information of Jatropha curcas L., Plant Biotechnol. 29 (2012) 123–130. [16] G.G.L. Costa, K.C. Cardoso, L.E.V. Del Bem, A.C. Lima, M.A.S. Cunha, L. de CamposLeite, R. Vicentini, F. Papes, R.C. Moreira, J.A. Yunes, F.A.P. Campos, M.J. Da Silva, Transcriptome analysis of the oil-rich seed of the bioenergy crop Jatropha curcas L., BMC Genomics 11 (2010) 462–480. [17] P. Natarajan, D. Kanagasabapathy, G. Gunadayalan, J. Panchalingam, N. Shree, P.A. Sugantham, K.K. Singh, P. Madasamy, Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds, BMC Genomics 11 (2010) 606–619. [18] H.K. Yadav, A. Ranjan, M.H. Asif, S. Mantri, S.V. Sawant, R. Tuli, EST-derived SSR markers in Jatropha curcas L.: development, characterization, polymorphism, and transferability across the species/genera, Tree Genet. Genomes 7 (2011) 207–219. [19] A.J. King, Y. Li, I.A. Graham, Profiling the developing Jatropha curcas L. seed transcriptome by pyrosequencing, Bioenerg. Res. 4 (2011) 211–221. [20] H. Liu, Z. Yang, M. Yang, S. Shen, The differential proteome of endosperm and embryo from mature seed of Jatropha curcas, Plant Sci. 181 (2011) 660–666. [21] S. Popluechai, M. Froissard, P. Jolivet, D. Breviario, A.M. Gatehouse, A.G. O’Donnell, T. Chardot, A. Kohli, Jatropha curcas oil body proteome and oleosins: L-form JcOle3 as a potential phylogenetic marker, Plant Physiol. Biochem. 49 (2011) 352–356. [22] T. Kinoshita, K. Yamada, N. Hiraiwa, M. Kondo, M. Nishimura, I. Hara-Nishimura, Vacuolar processing enzyme is up-regulated in the lytic vacuoles of vegetative tissues during senescence and under various stressed conditions, Plant J. 19 (1999) 43–53. [23] D.F. Gruis, D.A. Selinger, J.M. Curran, R. Jung, Redundant proteolytic mechanisms process seed storage proteins in the absence of seed-type members of the vacuolar processing enzyme family of cysteine proteases, Plant Cell 14 (2002) 2863–2882. [24] D. Gruis, J. Schulze, R. Jung, Storage protein accumulation in the absence of the vacuolar processing enzyme family of cysteine proteases, Plant Cell 16 (2004) 270–290. [25] T. Shimada, K. Yamada, M. Kataoka, S. Nakaune, Y. Koumoto, M. Kuroyanagi, S. Tabata, T. Kato, K. Shinozaki, M. Seki, M. Kobayashi, M. Kondo, M. Nishimura, I. Hara-Nishimura, Vacuolar processing enzymes are essential for proper processing of seed storage proteins in Arabidopsis thaliana, J. Biol. Chem. 278 (2003) 32292–32299. [26] Z. Li, H. Yue, D. Xing, MAP Kinase 6-mediated activation of vacuolar processing enzyme modulates heat shock-induced programmed cell death in Arabidopsis, New Phytol. 195 (2012) 85–96. [27] C. Guerrero, M. de la Calle, M.S. Reid, V. Valpuesta, Analysis of the expression of two thiolprotease genes from daylily (Hemerocallis spp.) during flower senescence, Plant Mol. Biol. 36 (1998) 565–571. [28] I. Hara-Nishimura, N. Hatsugai, S. Nakaune, M. Kuroyanagi, M. Nishimura, Vacuolar processing enzyme: an executor of plant cell death, Curr. Opin. Plant Biol. (8) (2005) 404–408. [29] H. Zhang, X. Zheng, Z. Zhang, The role of vacuolar processing enzymes in plant immunity, Plant Signal Behav. 5 (2010) 1565–1567. [30] T. Kinoshita, M. Nishimura, I. Hara-Nishimura, Homologues of a vacuolar processing enzyme that are expressed in different organs in Arabidopsis thaliana, Plant Mol. Biol. 29 (1995) 81–89. [31] T. Kinoshita, M. Nishimura, I. Hara-Nishimura, The sequence and expression of the gamma-VPE gene, one member of a family of three genes for vacuolar processing enzymes in Arabidopsis thaliana, Plant Cell Physiol. 36 (1995) 1555–1562. [32] E. Rojo, R. Martin, C. Carter, J. Zouhar, S. Pan, J. Plotnikova, H. Jin, M. Paneque, J.J. Sanchez-Serrano, B. Baker, F.M. Ausubel, N.V. Raikhel, VPEgamma exhibits a caspase-like activity that contributes to defense against pathogens, Curr. Biol. 14 (2004) 1897–1906.

A.J. Rocha et al. / Plant Science 213 (2013) 30–37 [33] T.L. Western, D.J. Skinner, G.W. Haughn, Differentiation of mucilage secretory cells of the Arabidopsis seed coat, Plant Physiol. 122 (2000) 345–356. [34] J.B. Windsor, V.V. Symonds, J. Mendenhall, A.M. Lloyd, Arabidopsis seed coat development: morphological differentiation of the outer integument, Plant J. 22 (2000) 483–493. [35] S. Nakaune, K. Yamada, M. Kondo, T. Kato, S. Tabata, M. Nishimura, I. HaraNishimura, A vacuolar processing enzyme, deltaVPE, is involved in seed coat formation at the early stage of seed development, Plant Cell 17 (2005) 876–887. [36] N. Saitou, M. Nei, The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406–425. [37] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 2731–2739. [38] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson, T.J. Gibson, D.G. Higgins, Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007) 2947–2948.

37

[39] O.J. Marshall, PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR, Bioinformatics 20 (2004) 2471–2472. [40] M.J. Karnovsky, A formaldehyde-glutaraldehyde fixative of high osmolality for use in electron microscopy, J. Cell Biol. 27 (1965) 137–138. [41] C.U. Junqueira, O uso de cortes finos de tecidos na Medicina e Biologia, Meios e Métodos 66 (1990) 167–171. [42] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, a Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [43] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method, Methods 25 (2001) 402–408. [44] J. Hellemans, G. Mortier, A. De Paepe, F. Speleman, J. Vandesompele, qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data, Genome Biol. 8 (2007) R19. [45] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002), RESEARCH0034.