Human Molecular Genetics, Vol. 1, No. 7 549
Dinucleotide repeat polymorphism at the D9SI47E locus
Hong Xiao, Carl R.Merril and Mihael H.Polymeropoulos* National Institute of Mental Health Neuroscience Center, St Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA
Mihael H.Polymeropoulos*, Hong Xiao and Carl R.Merril National Institute of Mental Health Neuroscience Center, St Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA
Source/Description: The (AC)n dinucleotide repeat sequence was isolated from a large insert phage human genomic library by hybridization with a synthetic poly (dC-dA) • (dG-dT) sequence (1). The genomic insert containing the dinucleotide repeat was subcloned into a pUC18 plasmid vector and sequenced using the dideoxy method. The predicted length of the amplified fragment was 203 bp (GenBank accession no. M98788).
Source/Description: The (AQ n dinucleotide repeat sequence was isolated from a human fetal retinal cDNA library by hybridization with a synthetic poly (dC-dA) • (dG-dT) sequence (1). The insert containing the dinucleotide repeat was sequenced using the dideoxy method. The predicted length of the amplified fragment was 198 bp (GenBank accession no. M98789).
Primer Sequences:
5' CTCAGTTTTATCAGCTGTGA 3' (GT strand); 5' TTAGCTTGTGGTCTCTACTC 3' (AC strand). Frequency: Estimated from 60 chromosomes of unrelated individuals. Heterozygosity index 0.79. Allele (bp) Al 210 A2 208 A3 206 A4 204 A5 202 A6 200
Frequency 0.02 0.03 0.10 0.35 0.25 0.03
Allele (bp) A7 198 A8 1% A9 194 A10 192 All 190 A12 186
Frequency 0.09 0.02 0.03 0.03 0.03 0.02
Reference CEPH genotypes: 1333-01 204/206 1333-02 202/204
Primer Sequences:
5' AGTGTTCACCCTAATAAGCC 3' (GT strand); 5' CTCCCTGCACCCTTCCATAA 3' (AC strand). Frequency: Estimated from 72 chromosomes of unrelated individuals. Heterozygosity index 0.78. Allele (bp) Al 201 A2 199 A3 197 A4 195 A5 193 A6 191 A7 189
Frequency 0.01 0.15
Dinucleotide repeat polymorphism at the D9SI47E locus
Hong Xiao, Carl R.Merril and Mihael H.Polymeropoulos* National Institute of Mental Health Neuroscience Center, St Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA
Mihael H.Polymeropoulos*, Hong Xiao and Carl R.Merril National Institute of Mental Health Neuroscience Center, St Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA
Source/Description: The (AC)n dinucleotide repeat sequence was isolated from a large insert phage human genomic library by hybridization with a synthetic poly (dC-dA) • (dG-dT) sequence (1). The genomic insert containing the dinucleotide repeat was subcloned into a pUC18 plasmid vector and sequenced using the dideoxy method. The predicted length of the amplified fragment was 203 bp (GenBank accession no. M98788).
Source/Description: The (AQ n dinucleotide repeat sequence was isolated from a human fetal retinal cDNA library by hybridization with a synthetic poly (dC-dA) • (dG-dT) sequence (1). The insert containing the dinucleotide repeat was sequenced using the dideoxy method. The predicted length of the amplified fragment was 198 bp (GenBank accession no. M98789).
Primer Sequences:
5' CTCAGTTTTATCAGCTGTGA 3' (GT strand); 5' TTAGCTTGTGGTCTCTACTC 3' (AC strand). Frequency: Estimated from 60 chromosomes of unrelated individuals. Heterozygosity index 0.79. Allele (bp) Al 210 A2 208 A3 206 A4 204 A5 202 A6 200
Frequency 0.02 0.03 0.10 0.35 0.25 0.03
Allele (bp) A7 198 A8 1% A9 194 A10 192 All 190 A12 186
Frequency 0.09 0.02 0.03 0.03 0.03 0.02
Reference CEPH genotypes: 1333-01 204/206 1333-02 202/204
Primer Sequences:
5' AGTGTTCACCCTAATAAGCC 3' (GT strand); 5' CTCCCTGCACCCTTCCATAA 3' (AC strand). Frequency: Estimated from 72 chromosomes of unrelated individuals. Heterozygosity index 0.78. Allele (bp) Al 201 A2 199 A3 197 A4 195 A5 193 A6 191 A7 189
Frequency 0.01 0.15
