Journal of Virological Methods, 38 (1992) 1 l-24 0 1992 Eisevier Science Publishers B.V. / All rights reserved / 01660934/92/$05.00

11

VIRMET 01327

Direct sequencing of large flavivirus PCR products for analysis of genome variation and molecular epidemiological investigations Joyce Grant

Lewis, Gwong-Jen Chang, Robert Dennis W. Trent

S. Lanciotti

and

Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control, Fort Collins, CO, U.S.A. (Accepted

10 December

1991)

Summary The polymerase chain reaction (PCR) was used to amplify viral cDNAs from selected regions of dengue genomic RNA by using appropriate ‘consensus’ primers. DNA amplicons containing the structural genes from all 4 dengue serotypes were prepared and directly sequenced using dengue-virus-specific primers. This method can characterize reliably flavivirus field isolates at the molecular level without extensive virus propagation and molecular cloning, and will be a valuable tool for molecular epidemiological studies. Dengue; Polymerase chain reaction (PCR); Sequencing

Introduction Flaviviruses have a single-strand plus-sense RNA genome of about I1 kb with a type 1 cap at the 5’ terminus and lack a poly (A) tract at the 3’ terminus (Wengler and Wengler, 1981). This genus includes many medically important viruses, including those that cause dengue, yellow fever, Japanese encephalitis and tick-borne encephalitis. For medical and epidemiological purposes, it is important to characterize flavivirus genetic variants and vaccine viruses at the nucleotide level. Primer-directed dideoxy chain termination (Sanger et al., Correspondence to: J.G. Lewis, Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control, P.O. Box 2087, Fort Collins, Colorado 80522, U.S.A.

12

1977) sequencing of the RNA genome (Blok et al., 1989; Gibson et al., 1990; Rico-Hesse, 1990) and chemical mapping (Cotton and Wright, 1989) have been used to detect point mutations. Nucleotide sequences of both the structural and nonstructural genes of several flaviviruses have also been obtained through molecular cloning (Rice et al., 1985; Deubel et al., 1986; Zhao et al., 1986; Mason et al., 1987; Trent et al., 1987; Nitayaphan et al., 1990; Osatomi and Sumiyoshi, 1990). However, molecular cloning may result in the selection of a variant in the viral population or the introduction of cloning artifacts. To exclude such errors, more than one cDNA clone needs to be sequenced. Primer extension sequencing of virion RNA excludes such errors but requires that large amounts of viral RNA be available. Development of the polymerase chain reaction (PCR) technology using thermostable Thermus aquaticus (Tuq) DNA polymerase has provided new methods for amplification of specific DNA sequences and, for some purposes, can replace molecular cloning and recombinant techniques (Saiki et al., 1988). A rapid and reliable method has been developed for synthesizing viral DNA from the flavivirus RNA genome and amplification of a 2.4-kb DNA fragment (amplicon) containing the pre-membrane (Pr-M), membrane (M), and envelope (E) structural genes. Single-stranded templates were prepared from the 2.4-kb amplicon using biotin-streptavidin conjugated magnetic beads as a solid support (Hultman et al., 1989). One of the two amplification primers (amplimers) was biotinylated and selectively incorporated into one strand of the target DNA during amplification. The double-stranded DNA, immobilized on magnetic beads by biotin-streptavidin interaction, was separated and sequenced using virus-specific primers. Using this technique, we characterized the following virus isolates: 8 dengue type 2, 3 dengue type 3, one dengue type I, and one dengue type 4. The fidelity of this method was demonstrated by comparing the nucleotide sequence to published sequence data for the envelope genes of dengue 2 Jamaica 1409 (Deubel et al., 1986), dengue 2 Thailand 16681 (Blok et al., 1989) and dengue 3 H-87 prototype (Osatomi and Sumiyoshi, 1990).

Materials and Methods Viruses

Virus strains used in this study were obtained from the reference collection at the Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control, Fort Collins, CO 80522 (Table 1). Propagation

Dengue

of virus

viruses

were grown

in C6/36

Aedes

albopictus

cell monolayers

13 TABLE 1 Virus strains, serotype, origin, and year of isolation of dengue viruses used for amplification cDNA reverse transcribed from a selected region of genomic RNA Virus strain

Serotype

Hawaii D-81-081 16681 1409 1583 1592 IO s-44554 PR159 H-87 260698 D-84-3 I5 1036

Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue Dengue

I 2 2 2 2 2 2 2 2 3 3 3 4

Origin

Year of isolation

Hawaii Thailand Thailand Jamaica Sri Lanka Sri Lanka Egypt Seychelles Puerto Rico Philippines Sri Lanka Thailand Indonesia

I964 1983 1985 1985 1984 1977 1969 1956 1989 1984 1976

of

infected at a multiplicity of 0.1 plaque-forming unit (pfu) per cell. Cell culture supernatants were harvested 24 h after all cells in the culture were observed to be positive for virus antigen by immunofluorescence (Henchal et al., 1982). Fetal calf serum was added to the supernatants to a final concentration of 10% and frozen at - 70°C. Virus titrations were performed on the supernatant tissue culture fluids using a BHK-21 assay (Morens et al., 1985). Extraction of viral RNA

RNA was extracted from 400 ,~l of cell culture supernatant using a buffer which contained 4 M guanidine isothiocyanate, 25 mM sodium citrate, 50 mM 2-mercaptoethanol, 0.5% sarkosyl and 0.5 pug/ml of yeast tRNA (Chomczynski and Sacchi, 1987). Extracted RNA was resuspended in 60 ~1 of sterile, nucleasefree water and frozen at -70°C. Ten ,~l of extracted RNA was used in each reverse transcriptase and polymerase chain reaction (RT/PCR) to generate large amplicons that were electrophoresed on a 1% Seakem GTG agarose gel (FMC, Rockland, ME 04841). DNA bands were visualized by using ethidium bromide staining, and the results were photographed. Primer design and synthesis

Amplimers and sequencing primers were designed based on published dengue virus sequences (Deubel et al., 1986; Zhao et al., 1986; Mason et al., 1987; Chu et al., 1989; Osatomi and Sumiyoshi, 1990). Amplimer sequences based on the dengue 2 Jamaica 1409 sequence (Deubel et al., 1986) were used in regions conserved among all 4 of the dengue serotypes (Table 2). Each amplimer was analyzed for secondary structure using the computer software program OLIGO (National Biosciences, Hamel, MN 55340), and annealing temperatures (T& were calculated as described (Rychlik et al., 1990).

14 TABLE 2 Nucleotide sequences, melting temperatures (T,) and % homology of amplimers and sequencing primers Amplimers/ sequencing primers

Oligonucleotide primer sequences (5’-3’)

T, (“C)

Homology” Range (%)

D2J-134 D2J-274 cD2J-616 cD2J-2504 D2J-616 D2J-1005 D2J- 1546 D2J-1863 D2J-2170 cD2J-1227 cD2J-1567 cD2J-1888 cD2J-2200

TCAATATGCTGAAACGCGAGAGAAACCG CCACCAACAGCAGGGATACTGAAAAGATGGGG TTGCACCAACAGTCAATGTCTTCAGG GGGGATTCTGGTTGGAACTTATATTGTTCTGTCC ACCAGAAGACATAGATTGTTGGTGC GTCTTAGAACATGGAAGTTGTGTGACGACGATGGC AAGCTTGGCTGGTGCACAGGCAATGGTT GAAGGAAATAGCAGAAACACAACATGG ATGGCCA-MTTAGGTGACACAGCCTGGGA CCACATCCATTTCCCCATCCTCTGTCT TGGTAACGGCAGGTCTAGGAACCATTG CCCTTCATATTGTACTCTGATAACTATTGTTCC TGTAAACACTCCTCCCAGGGATCCAAA

67.0 71.6 62.9 67.7 57.3 71.6 71.7 57.4 76.7 66.5 65.5 60.0 65.1

96.4100.0 75.0-93.7 89.7-96.6 81.8-96.6 84.(rlOO.O 77.0-100.0 80.0-100.0 73.3-100.0 82.7-100.0 88.8-100.0 70.0-100.0 66.6-100.0 66.6-100.0

“Nucleotide sequence homology range of the 4 dengue serotype viruses: dengue-1 Nauru Island (Mason et al., 1987) dengue-2 Jamaica (Deubel et al., 1986), dengue-3 H87 (Osatomi and Sumiyoshi, 1990) and dengue-4 Dominica (Zhao et al., 1986).

Amplimers were given designations indicating the first nucleotide position in the published sequence of dengue 2 Jamaica (Deubel et al., 1986). Positivesense amplimers were designated D2J- and negative-sense amplimers cD2J(e.g., primer D2J-134 begins at position 134 of the dengue 2 Jamaica sequence). Oligonucleotides synthesized using standard phosphoramidite chemistry on an Applied Biosystems DNA synthesizer 380A were purified on OPC cartridges (Applied Biosystems Foster City, CA 94404). For direct sequencing, amplimer D2J-134 was biotinylated using an Eppendorf Biobind kit (Eppendorf, Fremont, CA 94538). Biotin residues were attached to the amino group of the modified oligomers and purified on a 16% acrylamide gel. The biotinylated amplimer was excised from the gel and desalted on an OPC cartridge prior to use. Reverse

transcriptase

and polymerase

chain reaction

(RTIPCR)

The reverse transcriptase and polymerase chain reaction (RT/PCR) used to convert dengue single-stranded RNA to cDNA and amplified to obtain doublestranded DNA was performed as previously described (Lanciotti et al., 1991) and modified to facilitate amplification of a large 2.4-kb amplicon. RT/PCR reactions were performed in loo-p1 vols containing the following components: 10 mM Tris-HCl, pH 8.5, 1.5 mM MgClz, 50 mM KCl, 0.01% gelatin, 200 PM each of the 4 deoxynucleotide triphosphates, 5 mM dithiothreitol, 100 pmol each of the two amplimers, 0.15 units of RAV-2 reverse transcriptase (Amersham, Arlington Heights, IL 60005) and 2.5 units of Amplitaq polymerase (Perkin-Elmer, Norwalk, CT 06859). RT reactions were incubated

1.5

56°C for 1 h, and the initial denaturation of cDNA and viral RNA was at 94°C for 4 min. Twenty-five cycles of denaturation at 94°C for 1 min, primer annealing at 65°C for 1 min, and primer extension at 72°C for 10 min were employed, with a final long extension step at 72°C for 20 min.

at

Quantitation of virus titer with yield of amplicons

Dengue virus in infected tissue culture cell fluids was titrated on BHK cells (Morens et al., 1985). RNA was extracted from virus and reverse transcribed to make cDNA and amplified by PCR. After synthesis, using varying amounts of template RNA, the amplicons were electrophoresed on 1% agarose gels, and the DNA yield was estimated by the intensity of ethidium bromide staining. To ascertain the initial RNA copy number needed to visualize the amplicon on a 1% agarose gel, a 510-bp amplicon was amplified using known amounts of dengue RNA from purified virus. Preparation and direct sequencing of single-stranded template from ampliJied DNA

PCR-

The strategy for cDNA synthesis and sequencing of the dengue genes is shown in Fig. 1. The RNA genome was reverse transcribed at a selected region RNA Target Sequence 5

3

amplimers

.-

cD2J-2504

D2J-134

1

1) Reverse Transcriptase 2) PCR

u

2370 bp DNA 111111111

.-jlllllllt

1

z;zra& Separation

Immobilized (+) strand +c616

+ cl 227

4~1567

*cl 888

*c2200

seque?cing primers Free (-1 strand 616-w

1005+

1546+

1863-w

2170-w

Fig. 1. Strategy for dengue-based cDNA synthesis and sequencing. cDNA was reverse transcribed from a selected region of dengue type I, 2, 3, and 4 genomic RNA and amplified in the PCR. Amplimers and sequencing primers have been described in Table 2. The biotinylated double-stranded DNA was subjected to strand separation and elution (Huhman et al., 1989). Each strand was sequenced with [y-‘*P]dATPlabeled dengue-specific primers using Sanger sequencing with TaqDNA polymerase.

16

and amplified to obtain the biotinylated 2.4-kb amplicon using Biotin-D2J-134 and cD2J-2504 amplimers. The oligonucleotide sequences of the amplimers and sequencing primers are given in Table 2. The biotinylated amplicon was purified as follows: the PCR reaction mixture was diluted with 2 ml of water and was centrifuged through a Centricon 100 microconcentrator (Amicon Division W.R. Grace & Co., Beverly, MA 01915) in an SS-34 Sorval rotor at 1000 x g for 25 min twice to remove residual salts, amplimers, and dNTPs from the PCR reaction. To recover the retained DNA, the microconcentrator was inverted and centrifuged at 750 rpm for 2 min; then the retentate was collected. One pmol of purified amplicon was strand-separated and eluted for each set of sequencing reactions.Magnetic beads containing covalently coupled streptavidin, Dynabeads M-280 Streptavidin (Dynal, Inc.) were used as solid support. A magnetic microconcentrator (Dynal, Inc., Great Neck, NY 11021) was used to sediment beads in microfuge tubes during washing procedures. Three hundred ,ug of Dynabeads that had been washed in 2 M NaCl were mixed with 2 pmol of the biotinylated double-stranded DNA in a final volume of 100 ~1 containing 2 M NaCl in TE buffer (10 mM Tris, pH 7.2, 1 mM EDTA) and incubated for 20 min at room temperature. The magnetic beads with immobilized template DNA were subsequently washed twice with 100 ~1 of TNE buffer (10 mM Tris, pH 7.2, 1 mM EDTA, 150 mM NaCl), and DNA strands were separated by incubating them with 100 ~1 of 0.15 M NaOH for 5 min at room temperature. The NaOH wash, containing the free strand of DNA, was removed, neutralized with 0.6 vol of 5 M ammonium acetate, and precipitated with two vols of 100% ethanol at -20°C overnight. The immobilized biotinylated single-strand DNA was subsequently washed two times with 200 ~1 of TNE buffer and two times with 100 ~1 of water. Sequencing reactions were performed using Tuq DNA polymerase (Promega, Madison, WI 53711) with [5’ y-P32]dATP-labeled sequencing primers. One pmol of immobilized template DNA or free template DNA was mixed with 2 pmol of the labeled sequencing primer, 5 ~1 of 5 x Tuq buffer (250 mM Tris-HCl, pH 9.0, 250 mM NaCl, 50 mM MgC12), and water was added to a final volume of 27 ~1. The annealing mixture was heated to 75°C for 5 min and allowed to cool to room temperature. Four deoxy/dideoxy stop mixes contained 250 PM of nonterminating dNTPs (dATP, dCTP, dTTP, and c7 deaza dGTP), 25 PM of terminating dNTP and either 25 PM ddGTP, 350 PM ddATP, 300 PM ddTTP, or 160 PM ddCTP. One ~1 of each stop mix was added to 4 0.5-ml microfuge tubes. Six ~1 of the annealing mix was placed in each tube with 2 units of Tuq DNA polymerase and incubated at 72°C for 12 min. Reactions were terminated by adding 5 ,ul of formamide-NaOH dye mix, heated to 90°C and quick chilled on ice. Three ~1 of each of the sequencing mixes was loaded onto a 6% sequencing polyacrylamide g,el and electrophoresed. Sequencing was also performed by incorporating [a- 2P]dCTP (Arlington Heights, IL 66005) into the DNA chain and extending it with DNA polymerase I Klenow fragment (Promega), as described previously (Messing, 1983).

17

Electrophoresis was carried out in 40 x 66 cm 6% polyacrylamide gels, 0.5 mm thick. Three ~1 of each sequencing reaction was loaded onto two sequencing gels and run at 30 W until the bromophenol blue band reached the base of the gel (4-5 h). To obtain extended sequences, sequencing reactions were subject to electrophoresis for 16-20 h, depending on the length of the fragment sequenced. Gels were dried at 80°C for 30 min and autoradiographs were exposed to Kodak X-Omat film. Results

Amplimers used to amplify selected sequences from dengue genomic RNA included the following pairs: D2J-134/cD2J-2504, D2J-616/cD2J-1567, D2J134/cD2J-616, D2J-274/cD2J-2504, which amplified 2370-, 951-, 510-, and 2230-bp products, respectively. These amplimers were based on the dengue 2 Jamaica sequence (Deubel et al., 1986) in regions conserved among all 4 dengue serotypes (Table 2). D2J-134 and D2J-274 were used with cD2J-2504 to generate DNAs from the following dengue type 2 topotypes: Thailand (two -

Fig. 2. Agarose gel electrophoresis analysis of RT/PCR amplicons from dengue-based RNA extracted from 200 ~1 of tissue culture supematant (20% of RNA used in RT/PCR). Double-stranded amplicons were amplified in the PCR from cDNA reverse transcribed from RNA that was extracted from dengue virus strains representing the 4 serotypes. Dengue serotype is listed first, followed by abbreviations for country of isolation, and strain designation for more than one isolate from the same country (see Table I). Shown is the ethidium-bromide stained I % agarose gel.

18

E

RNA

COPY

NO

45 110

bp

Fig. 3. Agarose gel electrophoresis analysis of RT/PCR amplicon yield by varying input RNA copy number from dengue type 2 purified virions. Ten ~1of each PCR reaction (100 ~1)was analyzed and shown on an ethidium-bromide stained 1% agarose gel.

strains), Sri Lanka (two strains), Egypt (one strain), Seychelles (one strain), Puerto Rico (one strain), Jamaica (one strain). In addition, a 2.4-kb amplicon was amplified from 3 strains of dengue type 3 and one strain each from dengue type 1 and 4 (Table 1 and Fig. 2). The 3’ amplimer D2J-274 has a nucleotide sequence homology of 75% with dengue type 3 and 81.2% with dengue type 1 sequences, but efficiently amplified a 2.4-kb amplicon when used with 5’ amplimer cD2J-2504. The 5’ amplimer D2J-616, together with cD2J-1567, amplified a 951-bp product from dengue type 2 Puerto Rico, dengue type 3 Sri Lanka, and dengue type 1 Hawaii. However, these two primers failed to amplify the genome of a dengue type 4 virus from Indonesia under standard conditions. Amplicon yield as a function

of input RNA copy number and amplicon size

The yield of amplicon varied as a function of size and initial input RNA copy number from reaction to reaction. Therefore, it was essential to standardize the initial RNA copy number used in the RT/PCR. Dengue 2 Jamaica RNA from

19

42

m

4510

Fig. 4. Agarose gel electrophoresis analysis of RT/PCR amplicons virus-infected tissue culture supernatant. Ten ~1 of each PCR reaction an ethidium-bromide stained 1% agarose gel. (A) 2370-bp amplicon virus and (B) 510-bp amplicon yield as a function of

from (100 yield input

bp

dengue RNA extracted from ~1) was analyzed and shown on as a function of input pfu’s of pfu’s of virus.

purified virions was used in the RT/PCR reaction with D2J-134 and cD2J-616 amplimers to produce a 510-bp amplicon (Fig. 3). One thousand copies of genomic RNA from purified virions, or 0.1 pfu of virus from infected cell culture supernatants was needed for synthesis of 5 pg of 510-bp amplicon with the D2J-134/cD2J-616 amplimer pair (Figs. 3 and 4B). However, with D2J- 134/ cD2J-2504 amplimers, RNA extracted from 10 000 pfu’s was needed to obtain 2 pg of the 2370-bp amplicon (Fig. 4A). This confirmed our observations that more input RNA is needed in the RT/PCR reaction to amplify large target sequences from genomic RNA. Characterization of the 2370-bp amplicon by direct sequencing andfidelity nucleotide sequence

of the

Double-stranded DNA products amplified from dengue RNA by the RT/ PCR reaction were sequenced directly. Figure 1 illustrates this approach to sequencing the pre-membrane (prM), membrane (M), and envelope glycoprotein (E) genes of the dengue 2 Jamaica 1409 and dengue 2 Thailand 16681 viruses. Direct sequencing of the amplicon encoding the structural genes of Jamaica 1409 and Thailand 16681 dengue 2 viruses confirmed the identity of the 2370 bp amplicon. Sequencing of the other biotinylated dengue DNAs using cD2J-1227, a specific dengue primer, confirmed the identity of the 2370bp amplicon from 6 other dengue type 2 virus strains, 3 dengue type 3 virus

20

A

Ii+

Dl-NAURU' Ol-HAWAII

1010 AUGCGCUGCGUGGGAAUAtGCMCAGAtACUUCGU~~CUGUCA~GCUACGUGGG~GA~ffiGUACUGGAGCAU~~GUUGCGUCACUACCA A.........................................C.... .._........._........_.....____.

Dl-NAURU Dl-HAWAII

WjCCMMGACMACCMCACUGGAUUUtMtUCUCU~GACGGAGG~AC~CCCU~CG~C~GC~CUG~CAU~GC~UA~~ . . . . . . . . ..u.........u.................................................u.............................

1110

Dl-NAURU 01-HAUAII

CACCACCACCGAUUCGAGAUGUCCAACACAAGGAGAAGCCACGCUGGKG ...............A.................G........A.......

1160

B

E*

W-THAI(081) AUGCGUUGCAUAGWUUAUC~UAGAGACUUUGUGA ..G...................... DZ-EGYPT ........U..........................G ...................................... ..A.... ........U....................U..C..G ....................................................... DP-SEYCH. ..A.... C ................................. ...... ..U....................U..C..G ................... DZ-S.L.(1583] ..A.... .....................C................................. DZ-S.L.(1592) ........U....................U..C..G ............. .....C....................G........G.....A..G........G..U..............U..............U DP-P.R.

1037

DZ-THAI(DB1) UGGcAAAMACMACCAACAUffiGAUUUUGAACUGAU~CAG~GCC~CAGCCCGCCACCCU~GG~GUACUGUA~GAGGC~~U~CCM ..... .........U.................G DZ-EGYPT ..........U.....G......................................A........U. G.....U........................ ..C.....G..... .................................................. DP-SEYCH. ..... G.....U.............................C.....G DP-S.L.(1583) .................................................... ..... ..G... .U.............................C.....G DZ-S.L.(1592) ................................................ ..U..A..G ..... ..A.........U ................... ........ ..U.........C .. .C .......................... DZ-P.R.

1137

DZ-THAI(061) CACAACAACAGAAUCUCGCUGCCCAACACAGGGGGAACCCAGCCUAAAUG DZ-EGYPT ...........C......U........ ..A.................. DZ-SEYCH. ...........C......U ..........A................... DZ-S.L.(15.33]....... ..C......U....... ..A................. .................. DZ-S.L.(15921 ...........C......U...........A ...U DZ-P.R. ...G..... ..C..G......... ..A..........C...G

1167

C DB-PHILIP.' 03-THAILAND D3-SRI LANKA

E*

1037 A~GAUGUGUWjWGUAGGAAACAGAGAUUU~~~GGCCUA~GG~~~CGUG~UUGACGUGGU~~~~ACGG~~~U~CUACCA A.................................................... . .. ... . .. . . . . .. . . . . . . . . A...................................G................

DB-PHILIP. D3-THAILAND DJ-SRI LANKA

1137 UGGCUAAGAACAAGCCCACGCUGGACAUAGAGCUUCAG . . U........C..........................U...........A.......................... U..............................................................G...........

D3-PHILIP. D3-THAILAND DS-SRI LANKA

CAUAACAACCGACUCAAGAUGLJCCCACCCAAGGGGAAGCGAUUUUACCLlG .G..... ..........G............................... .........U..U...........U...............G....G....

1187

D4-DDMINICA' DI-INWNESIA

AVGCGAUGCGUAGGAGUAGG~~~GACUUUGWjGMCW\CMC ,..................,,.......,._,......,,..............,.._..,,... U..G.......................U.....

1039

DI-DDHINICA DI-INDONESIA

1139 CAUGGCCCMGG~CCMCCUUUjAUUUUGAACUtACUAAU .........G........................................................................................

D4-DOIIINICA D4-INWNESIA

CAAACAUAACUACGGCMCAAGAUGLZCAACGCAAGG4GAGCCUUAUCUGM ..........C......................................A..

D

1189

Fig. 5. Comparison of the nucleotide sequence of the first 250 nucleotides of the envelope gene of dengue virus strains representing 4 serotypes: (A) sequence alignment of dengue type 1 Nauru’ (Mason et al., 1987) with dengue type 1 Hawaii; (B) sequence alignment of dengue type 2 virus strains from different geographical locations with dengue serotype listed first, followed by country of isolation and strain designation for more than one virus from the same country; (C) sequence alignment of dengue type 3 H87’ (Osatomi and Sumiyoshi, 1990) to dengue type 3 Thailand and dengue type 3 Sri Lanka; (D) sequence alignment of dengue type 4 Dominica (Zhao et al., 1986) to dengue type 4 Indonesia. Virus strains are listed in Table 1.

21

strains, and one each of dengue type 1 and 4 virus strains. A comparison of the nucleotide sequence of the first 250 nucleotides of the E gene of these dengue DNAs is presented (Fig. 5). The sequence for this region of the E gene of dengue type 3 prototype H-87 revealed 3 differences from the published sequence (Osatomi and Sumiyoshi, 1990). Changes were noted at positions 1078 (T to C), 1087 (T to C), and 1090 (G to A). Analysis and comparison of our sequence data with published data of the E gene of dengue 2 Jamaica 1409 and dengue 2 Thailand 1668 1 revealed complete agreement (Deubel et al., 1986; Blok et al., 1989). (Data not shown.) Comparison of sequencing cDNA’s using [JJ-~~P] dATP-labeled primers or incorporation of [a-32P]dCTP Sequencing dengue DNAs using [y-32P]dATP-labeled primers and the dideoxy chain termination method with Taq DNA polymerase was compared to sequencing the DNAs by incorporation of [cr-32P]dCTP label into the DNA chain and extension by DNA polymerase I Klenow fragment in the dideoxy chain termination method. Clear sequence ladders were obtained using labeled primers to sequence either the immobilized or free-strand cDNA. In contrast, an ambiguous sepencing ladder was seen when sequencing was attempted by incorporating [a- P]dCTP label into the DNA chain.

Discussion Our method proved to be reliable procedure for using RT/PCR with consensus amplimers to obtain large DNA fragments reverse transcribed from selected regions of dengue genomic RNA. Direct sequencing methods using a DNA template prepared by the solid support approach (Hultman et al., 1989) give reliable nucleotide sequence data for the dengue structural genes. Starting with RNA from 10 000 pfu’s of virus, a sufficient quantity of 2.4-kb amplicon can be obtained and sequenced in less than a week. Direct sequencing of the PCR amplicons is faster and more reliable than conventional cloning to generate sequencing templates (Deubel et al., 1990; Gyllenstein et al., 1988). Normally only a single sequence needs to be determined because direct sequencing produces a consensus sequence; sequencing errors due to misincorporation by Taq DNA polymerase during PCR will not be detected in the sequencing ladder (Tindall and Kunkel, 1988). In contrast, sequencing of several cloned PCR products is necessary to determine the true sequence (Scharf et al., 1986; Engelke et al., 1988). It is not necessary to gel-purify the PCR product if labeled primers are used for sequencing. Taq DNA polymerase gives excellent sequencing results (Innis et al., 1988). The ability of Taq DNA polymerase to extend at high temperatures (55-75’C) allows the enzyme to read through most secondary structures and with the concomitant use of 7-deaza-5’deoxyguanosine 5’-triphosphate (C7 deaza dGTP) yields sequence information from G + C-rich templates.

22

The availability of appropriate consensus amplimers makes it possible to apply this approach to analyze other flavivirus genes. One set of amplimers was used to produce DNA copies from selected regions of genomic RNA from all 4 dengue serotypes. Sequencing primers were used to sequence most of the structural genes of two dengue 2 topotype viruses. The sequence obtained for these two viruses was in complete agreement with published sequences of the envelope gene of the dengue 2 Jamaica 1409 and Thailand 16681 viruses (Deubel et al., 1986; Blok et al., 1989). DNA’s were characterized from 6 other dengue type 2 viruses, 3 dengue type 3 viruses, and one dengue type 1 and 4 virus by sequencing the first 250 nucleotides of the envelope gene. Amplification of cDNA reverse transcribed from selected regions of RNA (RT/PCR) and direct sequencing provides a rapid and reliable approach for flavivirus molecular epidemiological studies. Viruses can be characterized at the molecular level from field isolates without extensive virus propagation and molecular cloning. These methods avoid variant strain selection and mutations, which can be introduced through multiple tissue culture passage.

References Blok, J., Samuel, S., Gibbs, A.J. and Vitarana, U.T. (1989) Variation of the nucleotide and encoded amino acid sequences of the envelope gene from eight dengue 2 viruses. Arch. Virol. 105, 39-53. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156159. Chu, MC., O’Rourke, E.J. and Trent, D.W. (1989) Genetic relatedness among structural protein genes of dengue 1 virus strains. J. Gen. Virol. 70, 1701-1712. Cotton, R.G.H. and Wright, P.S. (1989) Rapid chemical mapping of dengue virus variability using RNA isolated directly from cells. J. Viral. Methods 26, 67-76. Deubel, V., Kinney, R.M. and Trent, D.W. (1986) Nucleotide sequence and deduced amino acid sequence of the structural proteins of dengue type 2 virus, Jamaica genotype. Virology 155,365377. Deubel, V., Laille, M., Hugnot, J.-P., Chungue, E., Guesdon, J.-L., Drouet, M.T., Bassot, S. and Chevrier, D. (1990) Identification of dengue sequences by genomic amplification: rapid diagnosis of dengue virus serotypes in peripheral blood. J. Virol. Methods 30, 41-54. Engelke, D.R., Hoener, D.A. and Collins, F.S. (1988) Direct sequencing of enzymatically amplified genomic DNA. Proc. Nat]. Acad. Sci. USA 85, 544548. Gibson, C.A., Dunster, L.M., Bouloy, M., Minor, P.D., Sanders, P.G. and Barrett, A.D.T. (1990) Primer extension dideoxy chain termination nucleotide sequencing of partially purified RNA virus genomes: a technique for investigating low titre viruses with extensive genome secondary structure. J. Virol. Methods 29, 167-176. Gyllenstein, U.B. and Erlich, H. (1988) Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc. Acad. Sci. USA 85, 7652-7656. Henchal, E.A., Gentry, M.K., McCown, J.M. and Brandt, W.E. (1982) Dengue virus-specific and flavivirus group determinants identified with monoclonal antibodies by indirect immunofluorescence. Am. J. Trop. Med. Hyg. 31, 83@-836. Huhman, T., Stahl, S., Hornes, E. and Uhlen, M. (1989) Direct solid-phase sequencing of genomic and plasmid DNA using magnetic beads and solid support. Nucleic Acids Res. 17, 49374946. Innis, M.A., Myambo, K.B., Geltand, D.H. and Brow, M.A.D. (1988) DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction-

23 amplifled DNA. Proc. Natl. Acad. Sci. USA 85, 94369440. Lanciotti, R.S., Calisher, C.H., Gubler, D.J. and Vorndam, A.V. (1991) Detecting and typing dengue viruses by genomic amplification in a reverse transcriptase polymerase chain reaction. J. Clin. Microbial., submitted. Mason, P.W., McAda, PC., Mason, T.W. and Fournier, M.J. (1987) Sequence of the dengue-1 virus genome in the region encoding the three structural proteins and the major nonstructural protein NSI. Virology 161, 262-267. Messing, J. (1983) New Ml3 vectors for cloning. Methods Enzymol. 101, 2c-79. Morens, D.M., Halstead, S.B., Repik, P.M., Putvatana, R. and Raybourne, N. (1985) Simplified plaque reduction neutralization assay for dengue viruses by semimicro-methods in BHK-21 cells: comparison of the BHK suspension test with standard plaque reduction neutralization. J. Chn. Microbial. 22, 25&254. Nitayaphan, S., Grant, J.A., Chang, G.-J.J. and Trent, D.W. (1990) Nucleotide sequence of the virulent SA-14 strain of Japanese encephalitis virus and its attenuated vaccine derivative, SA-1414-2. Virology 177, 541-552. Osatomi, K. and Sumiyoshi, H. (1990) Complete nucleotide sequence of dengue type 3 virus genome RNA. Virology 176, 643-647. Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L. and Strauss, J.H. (1985) Nucleotide sequence of yellow fever virus: Implications for flavivirus gene expression and evolution. Science 229, 726733. Rico-Hesse, R. (1990) Molecular evolution and distribution of dengue viruses type 1and 2 in nature. Virology 174, 479493. Rychhk, W., Spencer, W.S. and Rhoads, R.E. (1990) Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 64096412. Saiki, R.K., Gelfand, D.H., Stoffel, S., Schart, S.J., Higuchi, R., Horn, G.T. and Erhch, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487491. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 546335467. Scharf, S., Horn, G.T. and Erhch, H.A. (1986) Direct cloning and sequence analysis of enzymatically amplified genomic sequences. Science 233, 1076-1078. Tindall, K.R. and Kunkel, T.A. (1988) Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemistry 27, 6008-6013. Trent, D.W., Kinney, R.M., Johnson, B.J.B., Vorndam, A.V., Grant, J.A., Deubel, V., Rice, C.M. and Hahn, C. (1987) Partial nucleotide sequence of St. Louis encephalitis virus RNA: structural proteins, NSl, NS2a and NS2b. Virology 156, 293-304. Wengler, G. and Wengler, G. (1981) Terminal sequence of the genome and rephcative form RNA of the flavivirus West Nile virus: absence of poly (A) and possible role in RNA replication. Virology 113, 544555. Zhao, B., Mackow, E., Buckler-White, A., Markoff, L., Chanock, R.M., Lai, C.J. and Makino, Y. (1986) Cloning full-length dengue type 4 viral DNA sequences: Analysis of genes coding for structural proteins. Virology 155, 77-88.