Cellular Immunology 289 (2014) 7–14

Contents lists available at ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

Distinct molecular basis for endothelial differentiation: Gene expression profiles of human mesenchymal stem cells versus umbilical vein endothelial cells Dandan Liu a,⇑, Yuezeng Wang b,1, Yilu Ye a, Guoli Yin a, Liqiong Chen c a b c

Department of Pathology, Zhejiang Medical College, 481 Bin Wen Road, Bin Jiang District, Hangzhou 310053, China Department of Pathology, Norman Bethune College of Medicine, Jilin University, Changchun, China Department of Paediatrics, Hangzhou First People’s Hospital, 261 Huan Sha Road, Hangzhou 310006, China

a r t i c l e

i n f o

Article history: Received 29 June 2013 Accepted 24 January 2014 Available online 2 February 2014 Keywords: Mesenchymal stem cell Endothelial cell Gene expression Endothelial differentiation

a b s t r a c t The capacity for endothelial differentiation has been described in mesenchymal stem cells (MSC) from human bone marrow. To identify genes associated with the endothelial differentiation potential of this cell-type, and search for the optimal regulatory factors, the expression profile of MSC was compared with cDNA from primary human umbilical vein endothelial cells as controls, using cDNA chips with 4096 genes. The data were corroborated by quantitative PCR, Western blotting, and immunocytochemistry. Among the 3948 effective genes, 84% (3321) were co-expressed in both cell-types, and 627 were differentially expressed more than twofold in MSC versus EC. MSC highly expressed numerous stem-cell-like genes. Early development genes of endothelial cells, though not up-regulated, had a high expression in MSC, such as EDF1, MDG1, and EDG2. In contrast, mature endothelial growth and signal pathway genes, like VEGF, CXCR4, and CTNNB1, were down-regulated in MSC. In conclusion, human MSC have a distinct molecular basis for endothelial differentiation. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Endothelial cell injury or dysfunction plays a critical role in the pathogenesis of atherosclerosis and thrombosis [1]. Rapid reendothelialization of the injured arterial wall is a key step in preventing the development of atherothrombosis and vascular remodeling after injury. Accumulating evidence indicates that bone marrow-derived circulating endothelial cells and/or endothelial progenitor cells play important roles in the process of endothelialization of vascular grafts and angiogenesis [2]. Bone marrow mesenchymal stem cells (MSC) can differentiate into various kinds of cells, including endothelial cells, osteocytes, chondrocytes, adipocytes, and neurons. Because MSC have low immunogenicity and multi-lineage differentiation potential, they could be used for generating new tissue and repairing damaged tissues. MSC can differentiate into endothelial cells, resulting in increased vascularity and improved cardiac function in an ischemia ⇑ Corresponding author. Fax: +86 0571 87692775. E-mail addresses: [email protected] (D. Liu), [email protected] (Y. Wang), [email protected] (Y. Ye), [email protected] (G. Yin), [email protected] (L. Chen). 1 Address: Key Laboratory of Pathology, Ministry of Education, School of Basic Medical Sciences, Jilin University, Changchun 130021, China. http://dx.doi.org/10.1016/j.cellimm.2014.01.007 0008-8749/Ó 2014 Elsevier Inc. All rights reserved.

model [3]. It has been shown that MSC can differentiate into vascular endothelial cells following vein grafting in rats [4]. These MSC contribute to rapid re-endothelialization and inhibit neointimal formation and advanced vascular lesion formation [4]. The differentiation of MSC into vascular endothelial cells has been used for myocardial regeneration and neoangiogenesis. However, the molecular basis and mechanisms underlying MSC differentiation into endothelial cells are not fully understood. Microarray analysis is a useful screening technique for gene expression profiles. To identify the genes that might be involved in this process, we compared the gene expression pattern of MSC cDNA obtained from the human bone marrow of five healthy donors with that from human umbilical cord vein endothelial cells (HUVEC) as control. Using this technique, we attempted to identify the gene expression profiles of MSC that were associated with their capacity for endothelial differentiation. 2. Materials and methods 2.1. Mesenchymal stem cell preparation Human bone-marrow MSC were isolated and cultured using the standard procedures described by Pittenger [5] with minor

8

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

modifications. Briefly, bone marrow aspirates were obtained from healthy donors (n = 5) with informed consent using the guidelines approved by the Institutional Ethics Committee. Two to ten milliliters of heparinized bone marrow were mixed with an equal volume of low-glucose Dulbecco;s modified Eagle’s medium (L-DMEM) (Gibco, Carlsbad, CA). The resuspended cells were layered over 1.073 g/ml Percoll (Pharmacia, Little Chalfont, UK) and centrifuged at 2500 rpm for 30 min at room temperature. The mononuclear cells were collected at the interface, and then resuspended in L-DMEM supplemented with 10% heat-inactivated fetal bovine serum (Hyclone, Minneapolis, MN), 100 U/ml penicillin G, and 100 mg/ml streptomycin. The cells were plated at 1  107 cells per 25-cm2 flask (Corning, Tewksbury, MA) and incubated with 5% CO2 at 37 °C. The medium was changed after 48 h [adherent cells defined as passage zero (P0)] and then every three days. When primary cultures had grown to 80–90% confluence, the cells were recovered by the addition of 0.25% trypsin–EDTA (Invitrogen, Grand Island, NY) and replated in three new flasks. The cells from P3–P5 were collected for further use. 2.2. Endothelial cell culture Human umbilical cords (n = 16) were obtained from healthy mothers in the Obstetrics Department of Hangzhou First People’s Hospital. All mothers gave written informed consent and the protocol was approved by the local Ethics Committee. After washing the cord in phosphate-buffered saline (PBS), the vein was filled with 0.25% trypsin and 0.1% collagenase (Gibco, Grand Island, NY) and incubated for 10–15 min in a humidified atmosphere at 37 °C under 5% CO2 for isolation of HUVEC. Collected cells were cultured in plastic flasks with Medium 200 (Cascadebio, Portland, Oregon) supplemented with 2% fetal bovine serum, 1 mg/mL hydrocortisone, 10 ng/ml human epidermal growth factor, 3 ng/ mL basic fibroblast growth factor, and 10 mg/ml heparin at 37 °C in a 5% CO2 atmosphere. The medium was changed after 12 h and then every other day. Non-adherent cells were removed. At confluence, the cells were trypsinized and divided into three portions for three new culture flasks. HUVEC was harvested at P2 for microarray experiments and FACS analysis.

substrate kit (Maxin). Hematoxylin was used to co-stain the cells. As for the CD44 and FVIIIAg antibodies (rabbit anti-human IgG; Santa Cruz Biotechnology), indirect immunofluorescence staining was performed by incubation of the primary antibody for 20 min at 4 °C, two washes, and staining for 10 min with the goat antirabbit FITC secondary antibodies; then the samples were evaluated by laser scanning confocal microscopy (Leica, Wetzlar, Germany). Targeted proteins displayed green fluorescence after excitation at 488 nm. 2.5. cDNA microarray Total RNA was extracted from cells with TRIzol reagent (Invitrogen, Grand Island, NY) and samples were stored at 20 °C. Microarray analysis was performed with three BioStarH-40S genome arrays (BioStar Corp., Shanghai, China), each containing 4096 genes (3948 effective genes and 148 control ones) of various functional classes. Following the manufacturer’s instructions, RNA was amplified and cDNA synthesized from generated antisense RNA in the presence of the fluorescent dyes Cy3 and Cy5. After purification and denaturation, the labeled targets were hybridized to the microarrays at 45 °C overnight, and then the arrays were washed under stringent conditions to remove non-specific target binding and air-dried. Fluorescence signals were detected using a Scan Array 4000 scanner with Image software version 3.0. The differential expression level was calculated according to the ratio of signal intensities (Cy5/Cy3). 2.6. Data preprocessing and analysis

Trypsinized cells (106/ml) were washed with PBS, stained with the primary antibody (1:30 dilution) and the fluorescent isothiocyanate (FITC)-conjugated secondary antibody in darkness for 30 min each. Then the cells were resuspended in PBS and immediately submitted to FACS analysis (BD, San Jose, CA). Dead cells were excluded by propidium iodide staining. The human monoclonal antibodies were as follows: CD44 (Santa Cruz Biotechnology, Santa Cruz, CA), CD14, CD31, CD34, CD45, and FVIIIAg antibody (Boster, Wuhan, China).

The mean signal and background intensities for both channels were obtained for each spot. To account for spot differences, the background-corrected ratio of the two channels was calculated. The raw data were also standardized in order to balance the fluorescence intensities of the two dyes as well as to allow the comparison of expression levels across experiments. To correct for inherent and random bias on each chip, 148 control genes were set in each array: 16 vacuity control genes for eliminating background signal intensity and judging cross-contamination among samples, 16 negative control genes for detecting the existence of ectogenic contamination during hybridization, 20 internal parameter genes for calibrating the signal intensity of labeled fluorescence, and 96 housekeeping genes designed to balance the Cy5 and Cy3 values as well as to assess the reliability of hybridization results. Meanwhile, global standardization was applied. The spots with signal intensities of Cy3 and Cy5 both P200 or either P800 were regarded as effective genes. The normalization coefficient, ND = EXP[ln(cy5/cy3)], was 0.974. Since three arrays were analyzed, means were calculated for each gene. A cutoff of twofold expression in the mean was chosen to identify candidate genes showing differential expression.

2.4. Immunocytochemistry

2.7. Real-time RT-PCR

The expression of CD29, CD54, VCAM1, fibronectin, laminin, collagen I, collagen IV, BDNF and Flk-1 were assessed by immunocytochemistry. The MSC were fixed with 4% para- formaldehyde in PBS, pH 7.4, for 1 h at room temperature. The fixed cells were washed in 3% hydrogen peroxide in methanol for 20 min at room temperature and blocked in PBS containing 3% BSA for 30 min. Then the cells were incubated overnight at 4 °C with the primary monoclonal antibodies CD29, CD54, VCAM1, fibronectin, laminin, collagen I, collagen IV, or Flk-1 (Maxin, Fuzhou, China), diluted 1:50. The secondary antibody, IgG antibody conjugated to biotin (Santa Cruz Biotechnology, diluted 1:500), was used for the reaction at room temperature for 60 min and stained using the DAB

For selected genes, quantitative expression analysis was used. Total RNA was extracted from MSC and HUVEC with an RNA isolation kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. DNA contamination was eliminated by two sequential steps of DNase treatment (Invitrogen, Carlsbad, CA). From the same RNA previously used for pre-amplification and array hybridization, 1 lg RNA was taken for cDNA synthesis using a reverse transcription kit (Promega, Madison, Wisconsin). Real-time RT-PCR was performed using a SYBR Premix EX Taq kit (TaKaRa) with b-actin as a reference control. Reactions were carried out with the following amplification conditions: 45 cycles of three-step PCR; 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 34 s. The primers used for

2.3. Flow cytometry

9

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

real-time RT-PCR are listed in Table 1. The level of each gene was normalized to the housekeeping gene b-actin. 2.8. Western Blot analysis To ensure that the given genes were important for particular cellular process, Western blotting was performed. Briefly, cells were harvested and 20 lg of each cell lysate was separated on 12% (wt/vol) Tris–glycine SDS/PAGE gels (Invitrogen). Western blotting was performed with rabbit anti-EDF1 monoclonal antibody (Santa Cruz Biotechnology), rabbit anti-EDF2 monoclonal antibody (Abcam), mouse anti-MDG1 monoclonal antibody (Raybiotech, Norcross, GA), and mouse anti-b-actin antibody (Santa Cruz Biotechnology). 3. Results 3.1. MSC assessment To obtain purified MSC, we isolated human MSC from bone marrow by combined density gradient centrifugation and differential adhesion to tissue-culture plastic. With this technique, contamination by hematopoietic stem cells (CD34 and CD45), macrophages (CD14 and CD45), or endothelial cells (CD31 and CD34) was effectively avoided as confirmed by flow cytometric antigen expression analysis (Fig. 1). But the MSC expressed several early markers of endothelial development, such as VCAM1, Flk-1, and ICAM1 (Table 2). CD29 (b1-integrin) and CD44 (PgP-1) were both characteristic surface antigens of primary MSC. The former might play an important role in cell differentiation (Fig. 2), and the latter might participate in cell–cell adhesion responses, modulate cell migration and cell morphology, and promote lymphocyte homing. They were highly expressed in primary human bone marrow MSC as demonstrated by flow cytometry (Fig. 1) and immunocytochemistry (Fig. 2). The MSC were positive for vimentin, a surface marker for stromal cells, and for brain-derived neurotropic factor (BDNF), an important factor participating in the development of the central nervous system. MSC also secreted numerous extracellular matrix components like fibronectin, laminin, and collagens I and IV (Table 2). The phenotype of cells at P0 was heterogeneous (spindle-, irregular-, clubbed-, and flat-shaped cells) (Fig. 3). After P2, the cells showed a homogeneous spindle-shaped fibroblast-like morphology, and the growth cycle was greatly shortened. They took 4–5 days to reach confluence and could be cultured for >30 passages without differentiation.

Table 1 Primer sequences for RT-PCR. Gene name

Forward

Reverse

CXCR4 VEGF BDNF b-actin

GAAGTGGGGTC TGGAGACTAT AGGAGGAGGGCAGAATCA CCCATCCTGTCTGTTCAT CATCCGTAAAGACCTCTATGCCAAC

TTGCCGACTATGCCAGTCAAG TCTATCTTTCTTTGGTCTGCATT TGCTTATCCCTCACCCTA ATGGAGCCACCGATCCACA

genes encoding vimentin, different collagens, laminins, stromal cell-derived factor 1, and fibronectin (Table 3), and some were confirmed by immunocytochemistry (Table 2). In accord with this finding, genes that occur in the development of mesoderm-derived tissues like bone (TGFB1, BMP6, BMPR 2, and OSF2), cartilage (CRTAP and GDF5), fat (ADFP), muscle (ACTA1, LMOD1, and ATP2A2) and hematopoiesis (SDF1 and MIF) were all up-regulated. In addition, we found that GAD1, PGAM1, BDNF, and CDH2, which have all been detected in developing neural tissue, were expressed in high amounts in MSC (Table 3). All the above gene expression signatures lay a solid molecular foundation for the multipotential differentiation of MSC. Our data showed that some important molecular markers associated with endothelial differentiation were also expressed in MSC, although they were not up-regulated (Table 3), such as endothelial differentiation-related factor 1, microvascular endothelial differentiation gene 1, endothelial differentiation, and lysophosphatidic acid G-protein-coupled receptor 2. In line with the results of other studies, vascular cell adhesion molecule 1, intercellular adhesion molecule 1, and kinase insert domain receptor, were also expressed in MSC, as confirmed by immunocystochemistry (Table 2). On the contrary, genes associated with growth (VEGF, PDGFB, and CXCR4) and signal transduction (CTNNB1 and EDG1) were significantly down-regulated in mature endothelial cells (Table 3). 3.4. Quantitative PCR and Western Blot analysis For the several genes among those differentially expressed, real-time quantitative PCR and Western blot analysis revealed a good correlation with the gene expression measured by the gene array system. Quantitative PCR analysis was performed for the three representative genes BDNF, VEGF, and CXCR4. The expression level ratios of MSC to HUVEC were 3.2, 0.20 and 0.31, which demonstrated an equal expression level of these genes. Thus, the array data were confirmed and demonstrated to be specific and sensitive without over-estimating expression differences. Western blotting showed that up-regulated genes, such as MDG1, EDF1, and EDG2, were much more significantly expressed in MSC than in EC (Fig. 5).

3.2. HUVEC characterization 4. Discussion HUVEC showed a typical monolayer slabstone arrangement, grew rapidly, and reached 90% confluence after 1 week. To ensure the purity of these cells, FVIIIAg antibody indirect immunofluorescence staining and flow cytometric analysis (Fig. 4) were performed. 3.3. Specific gene expression signature of MSC In the cDNA microarray experiments, no significant differential expression between MSC and EC was found in 84% (3321) of the 3921 effective genes. Compared with mature HUVEC, 283 genes were up-regulated and 344 were down-regulated. Genes with a more than twofold difference in the expression level were considered to be differentially expressed. Genes and signaling pathways conferring stem-cell properties often had higher copy numbers in MSC than in HUVEC, such as

MSC transplantation offers a great opportunity for angiogenesis in vascular regenerative medicine. Our preliminary results provide a molecular explanation for endothelial specification in human bone marrow MSC. Endothelial development genes, such as ICAM 1, VCAM 1, and Flk1, were expressed in MSC to different extent; they are known to be required for the commitment of precursors to differentiate into functional endothelial cells [6]. Previous studies have characterized a critical role of Flk1 in activation of the MAPK/ERK pathway in cell proliferation and survival [7]. By inducing VCAM-1, NF-jB activity regulates MSC accumulation in tumors and thereby its interaction with tumor vessel endothelial cells [8]. In this research, we showed for the first time that primary human bone marrow MSC expressed the endothelial cell developmental genes, EDG2, EDF1 and MDG1, although they were not

10

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

Fig. 1. FACS analysis histograms showed that human MSC were positive for CD44, but negative for CD14 (marker of mononuclear/macrophage cell system), CD31 and CD34 (marker of hematopoietic system) and CD45 (surface marker of leukocytes).

Table 2 Immunophenotype of cultured MSC. Antigen

Reactivity

Antigen

Reactivity

CD29 VEGF VCAM1 Flk-1 CD54

+ – + + +

Collagen I, IV BDNF Fibronectin Laminin Vimentin

+ + + + +

Note: ‘‘–’’, no cells stained; ‘‘+’’, most cells stained.

up-regulated. The integral membrane protein encoded by EDG2 is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Used by LPA for cell signaling, EDG receptors mediate diverse biological functions, including proliferation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, and chemotaxis. The ATX-LPA-LPAR axis is a critical regulator of embryonic vascular development that is conserved in vertebrates [9]. EDF1 encodes a protein that may regulate endothelial cell differentiation [10]. It has been postulated that this protein

functions as a bridging molecule that interconnects regulatory proteins and the basal transcriptional machinery, thereby modulating the transcription of genes involved in endothelial differentiation. This protein also acts as a transcriptional co-activator by interconnecting the general transcription factor TATA element-binding protein and gene-specific activators. Mdg1 is expressed in endothelial and epithelial cells in adult human tissue. The data suggest that Mdg1 is involved in the control of cell-cycle arrest taking place during terminal cell differentiation and under stress conditions [11]. Therefore, there is a distinct genetic basis for the endothelial differentiation of MSC. We also detected several endothelial differentiation-related transcription factors with the gene chips, such as Foxc2, KLF4, and RUNX1, but there was no significant difference between MSC and HUVEC. So part of our ongoing work involves the comparison of gene and protein expression between primary MSC and those treated with inducers, to search for decisive transcription factors during endothelial differentiation and blood-vessel formation. In the study, our data revealed up-regulated genes in MSC that might play an important role in neuroectodermal development: glutamate decarboxylase 1, phosphoglycerate mutase 1, BDNF,

Fig. 2. Immunocytochemistry showed positive expression of CD44-FITC (A) and CD29- HRP (B) in MSC, the former showed green fluorescence, and the latter showed brown particles. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

11

Fig. 3. The morphology of MSC at passage 0 was heterogeneous: spindle (A), irregular (B), clubbed (C) and flat (D). MSC in A, B and C are of stronger proliferation ability than those in D.

Fig. 4. Immunofluorescence staining showed strongly positive expression of FVIIIAg in umbilical EC, cells showed green body. FACS analysis showed positivity of FVIIIAg was up to 98.6%. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

and cadherin 2, type 1, N-cadherin. From these data, we can conclude a neuronal precursor status of MSC, which has been confirmed by the finding of human MSC differentiating along the neuronal pathway in vitro [12,13]. Besides, genes that are abundantly expressed in the development of bone, cartilage, fat, muscle, and hematopoiesis were all highly expressed. The pronounced expression of developmental genes in MSC was corroborated by another group comparing gene expression in MSC versus fibroblasts [14] and indicates inherent plasticity and potential remodeling properties of MSC. Among the down-regulated genes, vascular endothelial growth factor is a multi-tasking cytokine that stimulates cell differentiation, survival, proliferation, and migration [9]. Stimulation of VEGF increases the expression of CXCR4 on endothelial cells, rendering them more responsive to stromal-derived factor 1, an angiogenic CXC chemokine and unique ligand for CXCR4. Genetic knockout of CXCR4 and SDF-1 has delineated their critical role during embryonic cardiogenesis, leukopoiesis, and vasculogenesis [15]. Priming with SDF1 up-regulates mesenchymal stem cell CXCR4 engraftment and bone mechanics in a mouse model of osteogenesis imperfecta [16]. The SDF-1a-CXCR4 axis has been well characterized as a pathway for stem-cell homing, including MSC [17]. As VEGF and CXCR4 are both hardly expressed in MSC, MSC homing to

injury sites is restrained. Some investigators have used genetic modification or altered culture conditions to induce high cell-surface expression of CXCR4 to enhanced MSC homing to ischemic myocardium following systemic administration [18,19]. b-catenin (CTNNB1) signaling plays a role in the regulation of angiogenesis in colon cancer. The gene promoter of human VEGF, or VEGF-A, contains seven consensus binding sites for b-catenin. Transfection of normal colon epithelial cells with activated b-catenin up-regulates the levels of VEGF-A mRNA and protein by 250–300% [20]. b-catenin and peroxisome proliferator-activated receptor delta coordinate dynamic chromatin loops for the transcription of the VEGF-A gene in colon cancer cells [21]. So VEGF regulates the expression of several genes associated with endothelial cells differentiation. The multi-functionality of VEGF at the cellular level results from its ability to initiate a diverse, complex, and integrated network of signaling pathways via Flk1/VEGFR2 that converge on the MAPK/ERK signaling pathway [22]. The ability of VEGF to stimulate endothelial cell-specific gene expression and to induce the differentiation of mouse MSC into endothelial cells is consistent with earlier observations from our laboratory and others using mouse and human MSC or multipotent adult progenitor cells [23]. Treatment with a cocktail containing endothelial inducers (BMP4, SCF, and VEGF) [24] induces human

12

D. Liu et al. / Cellular Immunology 289 (2014) 7–14 Table 3 Genes differentially expressed and co-expressed in human bone marrow MSC and HUVEC. Genebank- ID

Class*

Definition

Up-regulated genes NM_002402 NM_002026 NM_000089 NM_004369 NM_001851 NM_001854 NM_002291

14 14 5,11 11 5 15 15

Mesoderm-specific transcript homolog Fibronectin 1 Collagen type I alpha 2 Collagen type VI alpha 3 Collagen type IX alpha 1 Collagen type XI alpha 1 Laminin beta 1

8 11 13

Transforming growth factor beta-induced 68 KD Bone morphogenetic protein receptor type II Bone morphogenetic protein 6 Osteoblast-specific factor 2 (fasciclin I-like)

14 11,14

Cartilage-associated protein mRNA Growth-differentiation factor 5 (cartilage-derived morphogenetic protein-1) mRNA

Bone NM_000358 NM_001204 NM_001718 NM_006475 Cartilage NM_006371 NM_000557 Adipose NM_001122 Muscle NM_001100 NM_012134 NM_001681

14

Adipose differentiation-related protein

5 10 11

Actin alpha 1 skeletal muscle mRNA Leiomodin 1 (smooth muscle) mRNA ATPase Ca++ transport cardiac muscle slow twitch 2

Hematopoiesis NM_000609 NM_002415

11 12

Stromal cell-derived factor 1 Macrophage migration inhibitory factor (glycosylation-inhibiting factor)

Neuron NM_000817 NM_002629 NM_001709 NM_001792

5 11 11,3

Glutamate decarboxylase 1 (brain, 67 kD) transcript variant GAD67 Phosphoglycerate mutase 1 (brain) Brain-derived neurotrophic factor Cadherin 2 type 1 N-cadherin (neuronal)

Co-expressed genes NM_000527 NM_012328 NM_033641 NM_003792 NM_003383 NM_001078 NM_057159 NM_000201 NM_002253

12 15 5 14 9 11 11 9 9,15

Low-density lipoprotein receptor Microvascular endothelial differentiation gene 1 Collagen type IV alpha 6 transcript variant B Endothelial differentiation-related factor 1 Very-low-density lipoprotein receptor Vascular cell-adhesion molecule 1 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 2 Intercellular adhesion molecule 1 (CD54) Kinase insert domain receptor

Down-regulated genes NM_000552 NM_003467 AF022375 NM_002608 NM_001400 NM_001955 NM_001904

13 14 14 14 11 9,8 10,11

Von Willebrand factor Chemokine (C-X-C motif) receptor 4 (fusin) Vascular endothelial growth factor Platelet-derived growth factor beta polypeptide Endothelial differentiation sphingolipid G-protein-coupled receptor 1 Endothelin 1 Catenin (cadherin-associated protein) beta 1

*

Classification: (1) Proto-oncogene and anti-oncogene; (2) ionic channel and traffic protein-related genes; (3) cell-cycle-related proteins; (4) alien pressure-responsive protein; (5) cytoskeleton and motion proteins; (6) apoptosis-related proteins; (7) DNA synthesis, repair, and recombination proteins; (8) DNA binding, transcription, and transcription factors; (9) cell receptor-related genes; (10) immunity-related genes; (11) cell signal and transmission-related genes; (12) metabolism-related genes; (13) protein translation and synthesis-related genes; (14) growth-related genes; (15) others.

bone marrow MSC-derived induced pluripotent stem cells into efficient CD34 + progenitor cells [25], or induces human induced pluripotent stem cells into functional endothelial cells [26]. Secreted frizzled-related protein-1, a modulator of the Wnt/Fz pathway, enhances MSC function in angiogenesis and contributes to neovessel maturation [27]. MSC and tumor cells cooperate in breast cancer vasculogenesis, and tumor-derived VEGF modulates their recruitment into sites of pathological vasculogenesis [28]. But miR-16 inhibits the proliferation and angiogenesis-regulating potential of MSC in severe pre-eclampsia. Levels of cyclin E1 and VEGF-A are negatively correlated with the level of miR-16 expression in decidua-derived MSC from patients with severe pre-eclampsia [29]. We found that MSC transfected with VEGF165 show a consistent but slow up-regulation of endothelial cell-specific genes. In contrast, a

sharp decline was found in the expression of CD44, an MSCspecific marker that is highly expressed in MSC. Xu et al. [30] showed that MSC lose their identity upon stimulation with VEGF and this is associated with sustained activation of MAPK/ERK during the course of differentiation into endothelial cells. ‘Loss of identity’ may be a key step in the commitment of MSC to follow different paths. Therefore, VEGF on one hand stimulates the expression of endothelial cell-specific genes and on the other hand downregulates the expression of MSC-specific genes. These observations, although preliminary, provide a rationale for the use of VEGF in addition to other cytokines for the commitment of bone marrow stem cells to endothelial cells. As well as VEGF, the microenvironment provided by endothelial cells is also important for MSC differentiation. A co-culture system of human MSC with

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

[5]

[6]

[7]

[8]

[9]

[10]

[11]

Fig. 5. MDG1, EDF1 and EDG2 were significantly expressed in MSC, but hardly expressed in EC.

[12]

[13]

HUVEC modulates the phenotype and proliferation of harvested MSC via activation of p38 [31]. Activation of p38 MAPK in endothelial cells is responsible for the regulation of their adhesiveness for MSC, while the activation of caspases potentiates the MSC adhesion [32]. These may be the main mechanism for MSC homing and participation in the treatment of ischemia in vivo. In conclusion, our study revealed numerous developmental genes of endothelial cells expressed in MSC, but no single study can confidently identify all related genes. The cross-validation of gene array results generated independently by different investigators remains crucial. VEGF modulates the expression of several other developmental genes, and their synergistic effect may play a decisive role in inducing MSC differentiation into EC. Future studies may reveal more details in the signaling pathways responsible for the respective differentiation processes. 5. Disclosure statement The authors declare that they have no competing interests to disclose.

[14]

[15]

[16]

[17] [18]

[19]

[20]

[21]

Acknowledgments TCM of Zhejiang Province (2011ZA018). The authors are grateful to Hangzhou First People’s Hospital for assistance with sample collection, to Zhao Donghai, and Guo Xin for assistance with experiments, and to Dr. I. C. Bruce and Wei Erqingfor critically reading and revising this manuscript.

[22] [23]

[24]

References [25] [1] M.A. Creager, M. Fukumoto, H. Hikita, J.C Fang, A.P. Selwyn, P. Ganz, Endothelium-derived nitric oxide regulates arterial elasticity in human arteries in vivo, Hypertension 38 (2001) 1049–1053. [2] T. Asahara, T. Murohara, A. Sullivan, M. Silver, R. van der Zee, T. Li, B. Witzenbichler, G. Schatteman, J.M. Isner, Isolation of putative progenitor endothelial cells for angiogenesis, Science 275 (1997) 964–967. [3] G.V. Silva, S. Litovsky, J.A. Assad, A.L. Sousa, B.J. Martin, D. Vela, S.C. Coulter, J. Lin, J. Ober, W.K. Vaughn, R.V. Branco, E.M. Oliveira, R. He, Y.J. Geng, J.T. Willerson, E.C. Perin, Mesenchymal stem cells differentiate into an endothelial phenotype, enhance vascular density, and improve heart function in a canine chronic ischemia model, Circulation 111 (2005) 150–156. [4] W.M. Yue, W. Liu, Y.W. Bi, X.P. He, W.Y. Sun, X.Y. Pang, X.H. Gu, X.P. Wang, Mesenchymal stem cells differentiate into an endothelial phenotype, reduce

[26]

[27]

[28]

13

neointimal formation, and enhance endothelial function in a rat vein grafting model, Stem Cells Dev. 17 (2008) 785–793. M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak, Multilineage potential of adult human mesenchymal stem cells, Science 284 (1999) 143–147. X. Li, D. Edholm, F. Lanner, G. Breier, F. Farnebo, A. Dimberg, L. Claesson-Welsh, Lentiviral rescue of VEGFR-2 expression in flk1-/- ES cells shows early priming of endothelial precursors, Stem Cells 25 (2007) 2987–2995. T. Hashimoto, X.M. Zhang, B.Y. Chen, X.J. Yang, VEGF activates divergent intracellular signaling components to regulate retinal progenitor cell proliferation and neuronal differentiation, Development 133 (2006) 2201– 2210. R. Uchibori, T. Tsukahara, H. Mizuguchi, Y. Saga, M. Urabe, H. Mizukami, A. Kume, K. Ozawa, NF-jB activity regulates mesenchymal stem cell accumulation at tumor sites, Cancer Res. 73 (2013) 364–372. H. Yukiura, K. Hama, K. Nakanaga, et al., Autotaxin regulates vascular development via multiple lysophosphatidic acid (LPA) receptors in zebrafish, J. Biol. Chem. 286 (2011) 43972–43983. I. Dragoni, M. Mariotti, G.G. Consalez, M.R. Soria, J.A. Maier, EDF-1, a novel gene product down- regulated in human endothelial cell differentiation, J. Biol. Chem. 273 (1998) 31119–31124. F. Pröls, M.P. Mayer, O. Renner, P.G. Czarnecki, M. Ast, C. Gässler, J. Wilting, H. Kurz, B. Christ, Upregulation of the cochaperone Mdg1 in endothelial cells is induced by stress and during in vitro angiogenesis, Exp. Cell Res. 269 (2001) 42–53. Y.S. Levy, D. Merims, H. Panet, Y. Barhum, E. Melamed, D. Offen, Induction of neuron-specific promoter and neuronal markers in differentiated mouse bone marrow stromal cells, J. Mol. Neurosci. 21 (2003) 121–132. L. Qian, W.M. Saltzman, Improving the expansion and neuronal differentiation of mesenchymal stem cells through culture surface modification, Biomaterials 25 (2004) 1331–1337. C. Brendel, L. Kuklick, O. Hartmann, T.D. Kim, U. Boudriot, D. Schwell, A. Neubauer, Distinct gene expression profile of human mesenchymal stem cells in comparison to skin fibroblasts employing cDNA microarray analysis of 9600 genes, Gene Expr. 12 (2005) 245–257. Y.R. Zou, A.H. Kottmann, M. Kuroda, I. Taniuchi, D.R. Littman, Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development, Nature 393 (2007) 595–599. G.N. Jones, D. Moschidou, K. Lay, H. Abdulrazzak, M. Vanleene, S.J. Shefelbine, J. Polak, P. de Coppi, N.M. Fisk, P.V. Guillot, Upregulating CXCR4 in human fetal mesenchymal stem cells enhances engraftment and bone mechanics in a mouse model of osteogenesis imperfecta, Stem Cells Transl. Med. 1 (2012) 70– 78. J.M. Karp, G.S. Leng, Mesenchymal stem cell homing: the devil is in the details, Cell Stem Cell. 4 (2009) 206–216. Z. Cheng, L. Ou, X. Zhou, F. Li, X. Jia, Y. Zhang, X. Liu, Y. Li, C.A. Ward, L.G. Melo, D. Kong, Targeted migration of mesenchymal stem cells modified with CXCR4 gene to infracted myocardium improves cardiac performance, Mol Ther. 16 (2008) 571–579. M. Shi, J. Li, L. Liao, B. Chen, B. Li, L. Chen, H. Jia, R.C. Zhao, Regulation of CXCR4 expression in human mesenchymal stem cells by cytokine treatment: role in homing efficiency in NOD/SCID mice, Haematologica 92 (2007) 897–904. V. Easwaran, S.H. Lee, L. Inge, L. Guo, C. Goldbeck, E. Garrett, M. Wiesmann, P.D. Garcia, J.H. Fuller, V. Chan, F. Randazzo, R. Gundel, R.S. Warren RS, J. Escobedo, S.L. Aukerman, R.N. Taylor, W.J. Fantl, Beta-Catenin regulates vascular endothelial growth factor expression in colon cancer, Cancer Res. 63 (2003) 3145–3153. I. Hwang, J. Kim, S. Jeong, Beta-catenin and peroxisome proliferator-activated receptor-delta coordinate dynamic chromatin loops for the transcription of vascular endothelial growth factor A gene in colon cancer cells, J. Biol. Chem. 287 (2012) 41364–41373. I. Zachary, VEGF signalling: integration and multi-tasking in endothelial cell biology, Biochem. Soc. Trans. 31 (2003) 1171–1177. Z. Liu, Y. Jiang, H. Hao, K. Gupta, J. Xu, L. Chu, E. McFalls, J. Zweier, C. Verfaillie, R.J. Bache, Endothelial nitric oxide synthase is dynamically expressed during bone marrow stem cell differentiation into endothelial cells, Am. J. Physiol. Heart Circ. Physiol. 293 (2007) H1760–H1765. M. Pick, L. Azzola, A. Mossman, E.G. Stanley, A.G. Elefanty, Differentiation of human embryonic stem cells in serum free medium reveals distinct roles for BMP4, VEGF, SCF and FGF2 in hematopoiesis, Stem Cells 25 (2007) 2206– 2214. Y. Xu, L. Liu, L. Zhang, S. Fu, Y. Hu, Y. Wang, H. Fu, K. Wu, H. Xiao, S. Liu, X. Yu, W. Zheng, B. Feng, H. Huang, Efficient commitment to functional CD34+ progenitor cells from human bone marrow mesenchymal stem-cell-derived induced pluripotent stem cells, PLoS One 7 (2012) e34321. Z. Li, S. Hu, Z. Ghosh, Z. Han, J.C. Wu, Functional characterization and expression profiling of human induced pluripotent stem cell- and embryonic stem cell-derived endothelial cells, Stem Cells Dev. 20 (2011) 1701–1710. P. Dufourcq, B. Descamps, N.F. Tojais, L. Leroux, P. Oses, D. Daret, C. Moreau, J.M. Lamazière, T. Couffinhal, C. Duplàa, Secreted frizzled-related protein-1 enhances mesenchymal stem cell function in angiogenesis and contributes to neovessel maturation, Stem Cells 26 (11) (2008) 2991–3001. S. Comsßa, F. Ciuculescu, M. Raica, Mesenchymal stem cell-tumor cell cooperation in breast cancer vasculogenesis, Mol. Med. Rep. 5 (5) (2012) 1175–1180.

14

D. Liu et al. / Cellular Immunology 289 (2014) 7–14

[29] Y. Wang, H. Fan, G. Zhao, D. Liu, L. Du, Z. Wang, Y. Hu, Y. Hou, MiR-16 inhibits the proliferation and angiogenesis-regulating potential of mesenchymal stem cells in severe pre-eclampsia, FEBS J. 279 (24) (2012) 4510–4524. [30] J. Xu, X. Liu, Y. Jiang, L. Chu, H. Hao, Z. Liua, C. Verfaillie, J. Zweier, K. Gupta, Z. Liu, MAPK/ERK signalling mediates VEGF-induced bone marrow stem cell differentiation into endothelial cell, J. Cell. Mol. Med. 12 (2008) 2395–2406.

[31] S.J. Bidarra, C.C. Barrias, M.A. Barbosa, R. Soares, J. Amédée, P.L. Granja, Phenotypic and proliferative modulation of human mesenchymal stem cells via crosstalk with endothelial cells, Stem Cell Res. 7 (3) (2011) 186–197. [32] I.A. Potapova, I.S. Cohen, S.V. Doronin, Caspases and p38 MAPK regulate endothelial cell adhesiveness for mesenchymal stem cells, PLoS One 8 (9) (2013) e73929. 12.