Neuroscience Letters, 133 (1991) 45-48 © 1991 Elsevier Scientific Publishers Ireland Ltd. All rights reserved 0304-3940/91/$ 03.50
45
NSL 08189
Distribution of the GABAA receptor and ,2-subunit mRNAs in chick brain Thora A. Glencorse, Alan N. Bateson, Stephen P. H u n t and M a r k G. Darlison MRC Molecular Neurobiology Unit, MRC Centre, Cambridge (U.K.) (Received 19 July 1991; Revised version received 14 August 1991; Accepted 14 August 1991)
Key words: y-Aminobutyric acidA receptor; Chick brain; Gene expression; In situ hybridisation; Ligand-gated ion channel; mRNA localisation; Receptor subtype composition We have used sequence-specific oligonucleotide probes and in situ hybridisation histochemistry to examine the distributions of the GABAA receptor • 1- and 72-subunit mRNAs in serial sections of i-day-old chick brain. Both transcripts are present together, at high levels, in many brain regions. Differences are found, however, in the relative amounts of these mRNAs in two isthmic nuclei of the optic lobe, the deep cerebellar nuclei, and the dorsal thalamus. We therefore conclude that while the ~1 and 72 subunits predominantly occur together in the same receptor complex, they may also be found separately in other GABAA receptor subtypes.
7-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the vertebrate brain. GABA mediates its effects there through binding to the GABAA receptor, a hetero-oligomeric complex that is a member of a ligand-gated ion-channel superfamily [1]. Cloning of complementary DNAs (cDNAs) has revealed the existence of a multiplicity of receptor subunits (0t, fl, y, 6 and p) and subunit isoforms (ctl-~6, fll-fl4, ~1-73) and, thus, a heterogeneous population of GABAA receptors [ref. 2 and refs. cited therein, 3, 5, 9, 17, 19]. While heterologous expression studies have shown that certain combinations of these subunits can form functional receptors that display a range of pharmacologies [reviewed in ref. 10], the actual subunit composition of any in vivo GABAA receptor subtype is unknown. Several groups, including our own, have recently begun to address the question of subtype composition by using in situ hybridisation histoehemistry to localise GABAA receptor subunit mRNAs to distinct neuronal cell populations [2, 11, 13, 14, 18, 19]. Recently, a close correlation between the regional expression patterns of the ~t1- and V2-subunit genes in the rat central nervous system has been reported [11]. We previously described the cloning
of the chicken ~l-subunit eDNA and the preliminary loealisation of the corresponding mRNA [2]. This analysis has now been extended and we report here the regional and cellular distribution of the ~tl-subunit mRNA, and compare it with that found for the V2-subunit mRNA, in chick brain. In situ hybridisation with 35S-labelled 45-base antisense oligonucleotides specific for the 0tl- and V2-subunit mRNAs was performed, as described previously [18], on 12/~m serial sections of brains obtained from 1-day-old commercial Rhode Island chicks after decapitation (in accordance with Home Office Regulations). All experiments were standardised such that each contained 0.14 x 106 dpm of labelled probe/100 pl hybridisation buffer. Control hybridisations were performed in the presence of a 30-fold molar excess of unlabelled probe. Oligonueleotides were synthesised to correspond to DNA sequences that encode part of the proposed intracellular loop between membrane-spanning domains M3 and M4: ~1, complementary to nucleotides 1356-1400 [2], 5'-TTTCTGGCTTAACTTCTTTGGGCTCTATCGTTGCACTTTTAGCAA-3' and ~2, complementary to nucleotides 1820-1864 [6], 5'-CATTTGAAT-
AGTAGCTGATCGAGGTCGGATGTCAATTGTGCorrespondence: M.G. Darlison. Present address: Institut fiir Zellbiochemie und Klinische Neurobiologie, Universit~its-Krankenhaus Eppendorf, Universitfit Hamburg, Martinistrasse 52, 2000 Hamburg 20, F.R.G. Fax: (49) 40-468-4541.
GGTGC-3'. Note that two forms of the y2 subunit, which are encoded by alternatively-spliced mRNAs, exist in mammals [8, 16] and in the chicken [unpublished data]. The V2-subunit-specific oligonueleotide used in this study recognises both of these mRNAs. The specifi-
46
!
city o f the ctl-subunit probe has previously been d e m o n strated [2]; the ),2-subunit oligonucleotide probe used here detects two transcripts o f ~ 3.4 kb and ,-, 4.3 kb on N o r t h e r n blots o f 1-day-old chick whole brain poly(A) + R N A (data not shown). Fig. 1 shows the regional distribution o f G A B A A receptor ~1- and y2-subunit transcripts in serial sections o f 1-day-old chick brains. The signals on parallel control sections were competed out by unlabelled oligonucleotide (Fig. 1G,H), thus confirming the specificity o f both probe hybridisations. The in situ hybridisation results show that the expression o f both the cd- and y2-subunit genes occurs predominantly in the same brain regions; the hyperstriatum accessorium, the ectostriatum, the paleostriatum primitivum, the nucleus mesencephalicus lateralis pars dorsalis, the nuclei isthmi, the fasciculus longitudinalis medialis, the cerebellum and certain layers o f the optic tectum all contain relatively high levels o f
A
B
C
D
r i
Fig. 1. Regional distribution of ~tl- and y2-subtmit mRNAs in chick brain. Horizontal sections of 1-day-old chick whole brains were hybridised with 35S-labelled45-base antisense ctl- (A, C and E) and ~,2(B, D and F) subunit-specific oligonucleotide probes. Controls (G; ~tl and H; y2) were performed as described in the text. Exposure was for 10 days on Kodak XAR-5 film. Cbm, cerebellum; DCN, deep cerebellar nuclei; DT, dorsal thalamus; E, ectostriatum; FLM, fasciculus longitudinalis medialis; HA, hyperstriatum accessorium; Imc, nucleus isthmi, pars magnocellularis; Ipc, nucleus isthmi, pars parvoceUularis; MLd, nucleus mesencephalicus lateralis, pars dorsalis; PA, paleostriaturn augmentatum; PP, paleostriatum primitivum; TeO, optic tectum. Bar = 0.49 cm.
Fig. 2. Distribution of ctl- and y2-subunit mRNAs in chick optic tectam. After autoradiography, sections were dipped in Ilford K5 emulsion, exposed for 50 days at 4°C and developed as previously described [18]. Note that photomicrographs A (c~l)and C (y2) are the dark-field complements of the Nissl-stained sections, B and D, respectively. SAC, stratum album centrale; SGC, stratum griseum centrale; SGFS, stratum griseum et fibrosum superficiale; SO, stratum opticum, Both the numerical system of Cajal, and the system of Cowan et al., for labelling the layers [7], is used. Bar = 309/am.
47
C
O
Fig. 3. Distribution of ~tl- and ?2-subunit mRNAs in the chick cerebellum. Sections were processed as in Fig. 2. Photomicrographs A (ctl) and C (?2) are the dark-field complements of the Nissl-stained sections B and D, respectively. G, granule cell layer; M, molecular layer; P, Purkinje cell layer; WM, white matter. Bar = 309 #m.
the corresponding mRNAs. These results are in agreement with those reported previously [2] for ~l-subunit transcripts in chick brain. There are significant differences, however, in the relative amounts of the ~tl- and ?2-subunit mRNAs in certain other regions of the chick brain. Most notably there is an inverse correlation between the levels of these transcripts in two isthmic nuclei of the optic lobe. The ctlsubunit mRNA is more abundant in the nucleus isthmi, pars magnocellularis than in the nucleus isthmi, pars parvocellularis (Fig. 1A,C); the converse is true for the y2-subunit mRNA (Fig. 1B,D). The deep cerebellar nuclei appear to contain similar levels of ctl-subunit transcript to that seen in the granule cell layer. In contrast, the ?2-subunit mRNA appears less abundant in the deep cerebellar nuclei than in the granule cell layer (Fig. 1AD). In addition, the ?2-subunit mRNA is found in the dorsal thalamus which has no detectable levels of ~lsubunit mRNA (Fig. 1C,D). Cellular resolution of the hybridisation was examined in two brain regions (optic tectum and cerebellum) that exhibit similar patterns of expression for the two genes.
Fig. 2 shows the localisation of ~1- and ?2-subunit mRNAs in the optic tectum. Both are present in layers c, g and i (layers 4, 8 and 10 of Cajal) of the stratum griscum et fibrosum superficiale and in some large cells of the stratum griseum centrale (layer 13 of Cajal). In the cerebellum (Fig. 3A-D), the ~1- and ?2-subunit transcripts are found predominantly in the granule and Purkinje cell layers. No differences are apparent between the expression patterns of these two genes, in the optic rectum and the cerebellum, at the cellular level (Figs. 2 and 3). Under high-power magnification only moderate labelling of some of the Purkinje cells is found (data not shown). In contrast, it has been reported [12] that all Purkinje cells in the rat cerebellum contain high levels of the ?2-subunit mRNA; the ~t1-subunit gene is also highly expressed in these neurones [13]. Our results may reflect the developmental phenomenon of transient heterogeneity of Purkinje cells [15] in the immature chicken cerebellar cortex. The data presented here demonstrate that, as in the mammalian brain, the GABAA receptor ~tl- and ?2subunit transcripts are predominantly found in the same regions and cell types of the chick brain. These results strongly suggest that the ~1 and ?2 subunits frequently occur together in GABAA receptor subtypes. We have, however, also found region-specific variations in the apparent levels of these subunit mRNAs. A discrepancy between ?2-subunit immunoreactivity and ?2-subunit mRNA levels has recently been noted [4] for the islands of Calleja in the rat brain. Although no explanation was provided by these workers, this anomaly may be due to differences in mRNA stability between cell types. While such a possibility cannot be ruled out here, we believe that our data indicate that there is a non-exclusive association of ~ 1 and ?2 subunits in certain subtypes of the GABAA receptor. T.A.G. is supported by an MRC Research Studentship. We thank Robert Jenkins for help with in situ hybridisation, Betty Ochotny for technical support and Professor Eric A. Barnard for his interest in this work.
1 Barnard, E.A., Darlison, M.G. and Seeburg, P., Molecular biology of the GABAA receptor: the receptor/channel superfamily, Trends Neurosci., 10 (1987) 502-509. 2 Bateson, A.N., Harvey, R.J., Wisden, W., Glencorse, T.A., Hicks, A.A., Hunt, S.P., Barnard, E.A. and Darlison, M.G., The chicken GABAA receptor ~l subunit: eDNA sequence and localization of the corresponding mRNA, Mol. Brain Res., 9 (1991) 333-339. 3 Bateson, A.N., Lasham, A. and Darlison, M.G., ?-Aminobutyric acidA receptor heterogeneity is increased by alternative splicing of a novel fl-subunit gene transcript, J. Neurochem., 56 (1991) 14371440.
48 4 Benke, D., Mertens, S., Trzeciak, A., Gillessen, D. and Mohler, H., GABAA receptors display association of y2-subunit with ctl- and fl2/3-subunits, J. Biol. Chem., 266 (1991) 4478~,483. 5 Cutting, G.R., Lu, L., O'Hara, B.F., Kasch, L.M., Montrose-Rafizadeh, C., Donovan, D.M., Shimada, S., Antonarakis, S.E., Guggino, W.B., Uhl, G.R. and Kazazian Jr, H.H., Cloning of the ~,aminobutyric acid (GABA) pl cDNA: a GABA receptor subunit highly expressed in the retina, Proc. Natl. Acad. Sci. U.S.A., 88 (1991) 2673-2677. 6 Glencorse, T.A., Bateson, A.N. and Darlison, M.G., Sequence of the chicken GABAA receptor 72-subunit cDNA, Nucleic Acids Res., 18 (1990) 7157. 7 Hunt, S.P. and Brecha, N., The avian optic tectum: a synthesis of morphology and biochemistry. In H. Vanegas (Ed.), Comparative Neurology of the Optic Tectum, Plenum, New York, 1984, pp. 619-648. 8 Kofuji, P., Wang, J.B., Moss, S.J., Huganir, R.L. and Burt, D.R., Generation of two forms of the 7-aminobutyric acidA receptor }'2subunit in mice by alternative splicing, J. Neurochem., 56 (1991) 713-715. 9 Liiddens, H., Pritchett, D.B., K6hler, M., Killisch, I., Kein~inen, K., Monyer, H., Sprengel, R. and Seeburg, P.H., Cerebellar GABAA receptor selective for a behavioural alcohol antagonist, Nature, 346 (1990) 648-65 I. 10 Liiddens, H. and Wisden, W., Function and pharmacology of multiple GABAA receptor subunits, Trends Pharmacol. Sci., 12 (1991) 49 51. I1 Malherbe, P., Sigel, E., Baur, R., Persohn, E., Richards, J.G. and Mohler, H., Functional characteristics and sites of gene expression of the cq, ill, ),2-isoform of the rat GABAA receptor, J. Neurosci., 10 (1990) 2330-2337. 12 Pritchett, D.B., Sontheimer, H., Shivers, B.D., Ymer, S., Ketten-
13
14
15
16
17
18
19
mann, H., Schofield, P.R. and Seeburg, P.H., Importance of a novel GABAA receptor subunit for benzodiazepine pharmacology, Nature, 338 (1989) 582-585. S6quier, J.M., Richards, J.G., Malherbe, P., Price, G.W., Mathews, S. and M6hler, H., Mapping of brain areas containing RNA homologous to cDNAs encoding the ~t and fl subunits of the rat GABAA 7-aminobutyrate receptor, Proc. Natl. Acad. Sci. U.S.A., 85 (1988) 7815-7819. Shivers, B.D., KiUisch, I., Sprengel, R., Sontheimer, H., K6hler, M., Schofield, P.R. and Seeburg, P.H., Two novel GABAA receptor subunits exist in distinct neuronal subpopulations, Neuron, 3 (1989) 327-337. Wassef, M., Zanetta, J.P., Brehier, A. and Sotelo, C., Transient biochemical compartmentalization of Purkinje cells during early cerebellar development, Dev. Biol., 111 (1985) 129--137. Whiting, P., McKernan, R.M. and Iversen, L.L., Another mechanism for creating diversity in ~,-aminobutyrate type A receptors: RNA splicing directs expression of two forms of y2 subunit, one of which contains a protein kinase C phosphorylation site, Proc. Natl. Acad. Sci. U.S.A., 87 (1990) 9966-9970. Wilson-Shaw, D., Robinson, M., Gambarana, C., Siegel, R.E. and Sikela, J.M., A novel 7 subunit of the GABAA receptor identified using the polymerase chain reaction, FEBS Lett., 284 (1991) 211 215. Wisden, W., Morris, B.J., Darlison, M.G., Hunt, S.P. and Barnard, E.A., Distinct GABAA receptor ct subunit mRNAs show differential patterns of expression in bovine brain, Neuron, 1 (1988) 937 947. Ymer, S., Draguhn, A., Wisden, W., Werner, P., Keiniinen, K., Schofield, P.R., Sprengel, R., Pritchett, D.B. and Seeburg, P.H., Structural and functional characterization of the h subunit of GABAA/benzodiazepine receptors, EMBO J., 9 (1990) 3261-3267.
45
NSL 08189
Distribution of the GABAA receptor and ,2-subunit mRNAs in chick brain Thora A. Glencorse, Alan N. Bateson, Stephen P. H u n t and M a r k G. Darlison MRC Molecular Neurobiology Unit, MRC Centre, Cambridge (U.K.) (Received 19 July 1991; Revised version received 14 August 1991; Accepted 14 August 1991)
Key words: y-Aminobutyric acidA receptor; Chick brain; Gene expression; In situ hybridisation; Ligand-gated ion channel; mRNA localisation; Receptor subtype composition We have used sequence-specific oligonucleotide probes and in situ hybridisation histochemistry to examine the distributions of the GABAA receptor • 1- and 72-subunit mRNAs in serial sections of i-day-old chick brain. Both transcripts are present together, at high levels, in many brain regions. Differences are found, however, in the relative amounts of these mRNAs in two isthmic nuclei of the optic lobe, the deep cerebellar nuclei, and the dorsal thalamus. We therefore conclude that while the ~1 and 72 subunits predominantly occur together in the same receptor complex, they may also be found separately in other GABAA receptor subtypes.
7-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the vertebrate brain. GABA mediates its effects there through binding to the GABAA receptor, a hetero-oligomeric complex that is a member of a ligand-gated ion-channel superfamily [1]. Cloning of complementary DNAs (cDNAs) has revealed the existence of a multiplicity of receptor subunits (0t, fl, y, 6 and p) and subunit isoforms (ctl-~6, fll-fl4, ~1-73) and, thus, a heterogeneous population of GABAA receptors [ref. 2 and refs. cited therein, 3, 5, 9, 17, 19]. While heterologous expression studies have shown that certain combinations of these subunits can form functional receptors that display a range of pharmacologies [reviewed in ref. 10], the actual subunit composition of any in vivo GABAA receptor subtype is unknown. Several groups, including our own, have recently begun to address the question of subtype composition by using in situ hybridisation histoehemistry to localise GABAA receptor subunit mRNAs to distinct neuronal cell populations [2, 11, 13, 14, 18, 19]. Recently, a close correlation between the regional expression patterns of the ~t1- and V2-subunit genes in the rat central nervous system has been reported [11]. We previously described the cloning
of the chicken ~l-subunit eDNA and the preliminary loealisation of the corresponding mRNA [2]. This analysis has now been extended and we report here the regional and cellular distribution of the ~tl-subunit mRNA, and compare it with that found for the V2-subunit mRNA, in chick brain. In situ hybridisation with 35S-labelled 45-base antisense oligonucleotides specific for the 0tl- and V2-subunit mRNAs was performed, as described previously [18], on 12/~m serial sections of brains obtained from 1-day-old commercial Rhode Island chicks after decapitation (in accordance with Home Office Regulations). All experiments were standardised such that each contained 0.14 x 106 dpm of labelled probe/100 pl hybridisation buffer. Control hybridisations were performed in the presence of a 30-fold molar excess of unlabelled probe. Oligonueleotides were synthesised to correspond to DNA sequences that encode part of the proposed intracellular loop between membrane-spanning domains M3 and M4: ~1, complementary to nucleotides 1356-1400 [2], 5'-TTTCTGGCTTAACTTCTTTGGGCTCTATCGTTGCACTTTTAGCAA-3' and ~2, complementary to nucleotides 1820-1864 [6], 5'-CATTTGAAT-
AGTAGCTGATCGAGGTCGGATGTCAATTGTGCorrespondence: M.G. Darlison. Present address: Institut fiir Zellbiochemie und Klinische Neurobiologie, Universit~its-Krankenhaus Eppendorf, Universitfit Hamburg, Martinistrasse 52, 2000 Hamburg 20, F.R.G. Fax: (49) 40-468-4541.
GGTGC-3'. Note that two forms of the y2 subunit, which are encoded by alternatively-spliced mRNAs, exist in mammals [8, 16] and in the chicken [unpublished data]. The V2-subunit-specific oligonueleotide used in this study recognises both of these mRNAs. The specifi-
46
!
city o f the ctl-subunit probe has previously been d e m o n strated [2]; the ),2-subunit oligonucleotide probe used here detects two transcripts o f ~ 3.4 kb and ,-, 4.3 kb on N o r t h e r n blots o f 1-day-old chick whole brain poly(A) + R N A (data not shown). Fig. 1 shows the regional distribution o f G A B A A receptor ~1- and y2-subunit transcripts in serial sections o f 1-day-old chick brains. The signals on parallel control sections were competed out by unlabelled oligonucleotide (Fig. 1G,H), thus confirming the specificity o f both probe hybridisations. The in situ hybridisation results show that the expression o f both the cd- and y2-subunit genes occurs predominantly in the same brain regions; the hyperstriatum accessorium, the ectostriatum, the paleostriatum primitivum, the nucleus mesencephalicus lateralis pars dorsalis, the nuclei isthmi, the fasciculus longitudinalis medialis, the cerebellum and certain layers o f the optic tectum all contain relatively high levels o f
A
B
C
D
r i
Fig. 1. Regional distribution of ~tl- and y2-subtmit mRNAs in chick brain. Horizontal sections of 1-day-old chick whole brains were hybridised with 35S-labelled45-base antisense ctl- (A, C and E) and ~,2(B, D and F) subunit-specific oligonucleotide probes. Controls (G; ~tl and H; y2) were performed as described in the text. Exposure was for 10 days on Kodak XAR-5 film. Cbm, cerebellum; DCN, deep cerebellar nuclei; DT, dorsal thalamus; E, ectostriatum; FLM, fasciculus longitudinalis medialis; HA, hyperstriatum accessorium; Imc, nucleus isthmi, pars magnocellularis; Ipc, nucleus isthmi, pars parvoceUularis; MLd, nucleus mesencephalicus lateralis, pars dorsalis; PA, paleostriaturn augmentatum; PP, paleostriatum primitivum; TeO, optic tectum. Bar = 0.49 cm.
Fig. 2. Distribution of ctl- and y2-subunit mRNAs in chick optic tectam. After autoradiography, sections were dipped in Ilford K5 emulsion, exposed for 50 days at 4°C and developed as previously described [18]. Note that photomicrographs A (c~l)and C (y2) are the dark-field complements of the Nissl-stained sections, B and D, respectively. SAC, stratum album centrale; SGC, stratum griseum centrale; SGFS, stratum griseum et fibrosum superficiale; SO, stratum opticum, Both the numerical system of Cajal, and the system of Cowan et al., for labelling the layers [7], is used. Bar = 309/am.
47
C
O
Fig. 3. Distribution of ~tl- and ?2-subunit mRNAs in the chick cerebellum. Sections were processed as in Fig. 2. Photomicrographs A (ctl) and C (?2) are the dark-field complements of the Nissl-stained sections B and D, respectively. G, granule cell layer; M, molecular layer; P, Purkinje cell layer; WM, white matter. Bar = 309 #m.
the corresponding mRNAs. These results are in agreement with those reported previously [2] for ~l-subunit transcripts in chick brain. There are significant differences, however, in the relative amounts of the ~tl- and ?2-subunit mRNAs in certain other regions of the chick brain. Most notably there is an inverse correlation between the levels of these transcripts in two isthmic nuclei of the optic lobe. The ctlsubunit mRNA is more abundant in the nucleus isthmi, pars magnocellularis than in the nucleus isthmi, pars parvocellularis (Fig. 1A,C); the converse is true for the y2-subunit mRNA (Fig. 1B,D). The deep cerebellar nuclei appear to contain similar levels of ctl-subunit transcript to that seen in the granule cell layer. In contrast, the ?2-subunit mRNA appears less abundant in the deep cerebellar nuclei than in the granule cell layer (Fig. 1AD). In addition, the ?2-subunit mRNA is found in the dorsal thalamus which has no detectable levels of ~lsubunit mRNA (Fig. 1C,D). Cellular resolution of the hybridisation was examined in two brain regions (optic tectum and cerebellum) that exhibit similar patterns of expression for the two genes.
Fig. 2 shows the localisation of ~1- and ?2-subunit mRNAs in the optic tectum. Both are present in layers c, g and i (layers 4, 8 and 10 of Cajal) of the stratum griscum et fibrosum superficiale and in some large cells of the stratum griseum centrale (layer 13 of Cajal). In the cerebellum (Fig. 3A-D), the ~1- and ?2-subunit transcripts are found predominantly in the granule and Purkinje cell layers. No differences are apparent between the expression patterns of these two genes, in the optic rectum and the cerebellum, at the cellular level (Figs. 2 and 3). Under high-power magnification only moderate labelling of some of the Purkinje cells is found (data not shown). In contrast, it has been reported [12] that all Purkinje cells in the rat cerebellum contain high levels of the ?2-subunit mRNA; the ~t1-subunit gene is also highly expressed in these neurones [13]. Our results may reflect the developmental phenomenon of transient heterogeneity of Purkinje cells [15] in the immature chicken cerebellar cortex. The data presented here demonstrate that, as in the mammalian brain, the GABAA receptor ~tl- and ?2subunit transcripts are predominantly found in the same regions and cell types of the chick brain. These results strongly suggest that the ~1 and ?2 subunits frequently occur together in GABAA receptor subtypes. We have, however, also found region-specific variations in the apparent levels of these subunit mRNAs. A discrepancy between ?2-subunit immunoreactivity and ?2-subunit mRNA levels has recently been noted [4] for the islands of Calleja in the rat brain. Although no explanation was provided by these workers, this anomaly may be due to differences in mRNA stability between cell types. While such a possibility cannot be ruled out here, we believe that our data indicate that there is a non-exclusive association of ~ 1 and ?2 subunits in certain subtypes of the GABAA receptor. T.A.G. is supported by an MRC Research Studentship. We thank Robert Jenkins for help with in situ hybridisation, Betty Ochotny for technical support and Professor Eric A. Barnard for his interest in this work.
1 Barnard, E.A., Darlison, M.G. and Seeburg, P., Molecular biology of the GABAA receptor: the receptor/channel superfamily, Trends Neurosci., 10 (1987) 502-509. 2 Bateson, A.N., Harvey, R.J., Wisden, W., Glencorse, T.A., Hicks, A.A., Hunt, S.P., Barnard, E.A. and Darlison, M.G., The chicken GABAA receptor ~l subunit: eDNA sequence and localization of the corresponding mRNA, Mol. Brain Res., 9 (1991) 333-339. 3 Bateson, A.N., Lasham, A. and Darlison, M.G., ?-Aminobutyric acidA receptor heterogeneity is increased by alternative splicing of a novel fl-subunit gene transcript, J. Neurochem., 56 (1991) 14371440.
48 4 Benke, D., Mertens, S., Trzeciak, A., Gillessen, D. and Mohler, H., GABAA receptors display association of y2-subunit with ctl- and fl2/3-subunits, J. Biol. Chem., 266 (1991) 4478~,483. 5 Cutting, G.R., Lu, L., O'Hara, B.F., Kasch, L.M., Montrose-Rafizadeh, C., Donovan, D.M., Shimada, S., Antonarakis, S.E., Guggino, W.B., Uhl, G.R. and Kazazian Jr, H.H., Cloning of the ~,aminobutyric acid (GABA) pl cDNA: a GABA receptor subunit highly expressed in the retina, Proc. Natl. Acad. Sci. U.S.A., 88 (1991) 2673-2677. 6 Glencorse, T.A., Bateson, A.N. and Darlison, M.G., Sequence of the chicken GABAA receptor 72-subunit cDNA, Nucleic Acids Res., 18 (1990) 7157. 7 Hunt, S.P. and Brecha, N., The avian optic tectum: a synthesis of morphology and biochemistry. In H. Vanegas (Ed.), Comparative Neurology of the Optic Tectum, Plenum, New York, 1984, pp. 619-648. 8 Kofuji, P., Wang, J.B., Moss, S.J., Huganir, R.L. and Burt, D.R., Generation of two forms of the 7-aminobutyric acidA receptor }'2subunit in mice by alternative splicing, J. Neurochem., 56 (1991) 713-715. 9 Liiddens, H., Pritchett, D.B., K6hler, M., Killisch, I., Kein~inen, K., Monyer, H., Sprengel, R. and Seeburg, P.H., Cerebellar GABAA receptor selective for a behavioural alcohol antagonist, Nature, 346 (1990) 648-65 I. 10 Liiddens, H. and Wisden, W., Function and pharmacology of multiple GABAA receptor subunits, Trends Pharmacol. Sci., 12 (1991) 49 51. I1 Malherbe, P., Sigel, E., Baur, R., Persohn, E., Richards, J.G. and Mohler, H., Functional characteristics and sites of gene expression of the cq, ill, ),2-isoform of the rat GABAA receptor, J. Neurosci., 10 (1990) 2330-2337. 12 Pritchett, D.B., Sontheimer, H., Shivers, B.D., Ymer, S., Ketten-
13
14
15
16
17
18
19
mann, H., Schofield, P.R. and Seeburg, P.H., Importance of a novel GABAA receptor subunit for benzodiazepine pharmacology, Nature, 338 (1989) 582-585. S6quier, J.M., Richards, J.G., Malherbe, P., Price, G.W., Mathews, S. and M6hler, H., Mapping of brain areas containing RNA homologous to cDNAs encoding the ~t and fl subunits of the rat GABAA 7-aminobutyrate receptor, Proc. Natl. Acad. Sci. U.S.A., 85 (1988) 7815-7819. Shivers, B.D., KiUisch, I., Sprengel, R., Sontheimer, H., K6hler, M., Schofield, P.R. and Seeburg, P.H., Two novel GABAA receptor subunits exist in distinct neuronal subpopulations, Neuron, 3 (1989) 327-337. Wassef, M., Zanetta, J.P., Brehier, A. and Sotelo, C., Transient biochemical compartmentalization of Purkinje cells during early cerebellar development, Dev. Biol., 111 (1985) 129--137. Whiting, P., McKernan, R.M. and Iversen, L.L., Another mechanism for creating diversity in ~,-aminobutyrate type A receptors: RNA splicing directs expression of two forms of y2 subunit, one of which contains a protein kinase C phosphorylation site, Proc. Natl. Acad. Sci. U.S.A., 87 (1990) 9966-9970. Wilson-Shaw, D., Robinson, M., Gambarana, C., Siegel, R.E. and Sikela, J.M., A novel 7 subunit of the GABAA receptor identified using the polymerase chain reaction, FEBS Lett., 284 (1991) 211 215. Wisden, W., Morris, B.J., Darlison, M.G., Hunt, S.P. and Barnard, E.A., Distinct GABAA receptor ct subunit mRNAs show differential patterns of expression in bovine brain, Neuron, 1 (1988) 937 947. Ymer, S., Draguhn, A., Wisden, W., Werner, P., Keiniinen, K., Schofield, P.R., Sprengel, R., Pritchett, D.B. and Seeburg, P.H., Structural and functional characterization of the h subunit of GABAA/benzodiazepine receptors, EMBO J., 9 (1990) 3261-3267.
