http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–10 ! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.855897

ORIGINAL ARTICLE

DNA barcoding of commercially important catfishes in the Philippines Jonas P. Quilang and Shiny Cathlynne S. Yu

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Molecular Population Genetics Laboratory, Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City, Philippines Abstract

Keywords

Many species of catfish are important resources for human consumption, for sport fishing and for use in aquarium industry. In the Philippines, some species are cultivated and some are caught in the wild for food and a few introduced species have become invasive. In this study, DNA barcoding using the mitochondrial cytochrome c oxidase I (COI) gene was done on commercially and economically important Philippine catfishes. A total of 75 specimens belonging to 11 species and 5 families were DNA barcoded. The genetic distances were computed and Neighbor-Joining (NJ) trees were constructed based on the Kimura 2-Parameter (K2P) method. The average K2P distances within species, genus, family and order were 0.2, 8.2, 12.7 and 21.9%, respectively. COI sequences clustered according to their species designation for 7 of the 11 catfishes. DNA barcoding was not able to discriminate between Arius dispar and A. manillensis and between Pterygoplichthys disjunctivus and P. pardalis. The morphological characters that are used to distinguish between these species do not complement molecular identification through DNA barcoding. DNA barcoding also showed that Clarias batrachus from the Philippines is different from the species found in India and Thailand, which supports earlier suggestions based on morphology that those found in India should be designated as C. magur and those in mainland Southeast Asia as C. aff. batrachus ‘‘Indochina’’. This study has shown that DNA barcoding can be used for species delineation and for tagging some species for further taxonomic investigation, which has implications on proper management and conservation strategies.

Catfish, COI, DNA barcoding, Siluriformes

Introduction Catfishes are primarily freshwater fishes that belong to the Order Siluriformes. This order consists of 3088 valid species distributed among 477 genera and 36 families (Ferraris, 2007). Catfishes are found in all continents and in many countries catfishes are valued as food items, sport fish and tropical aquarium fish (Nelson, 2006). In the Philippines, FishBase lists 31 species of catfish, 18 of which are native, four are endemic, seven are introduced, and two are of questionable status (Froese & Pauly, 2013). This list, however, needs to be updated as the occurrence of some of the native and introduced species is being doubted. For example, the list includes Clarias fuscus, which was reported in San Fernado, La Union and Vigan, Ilocos Sur (Fowler, 1941; Herre, 1953), but, Ng (1999) and Sudarto et al. (2004) claimed that this record in the Philippines is most likely a misidentification since C. fuscus is a Chinese taxon. The FishBase list also includes Clarias meladerma, which was reported in Laguna de Bay, the largest lake in the Philippines, but Herre (1953) doubted its occurrence in the Philippines. An introduced species, Hypostomus plecostomus, was also reported in Laguna de Bay (Palma et al., 2005), but this was later found to be a misidentification (Chavez et al., 2006). Among the six species of catfishes belonging to the genus Clarias reported in the Philippines, C. macrocephalus, C. batrachus and C. gariepinus are the most abundant and are

Correspondence: Jonas P. Quilang, Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City, Philippines. Tel: þ 63 2 920 5471. Fax: þ 63 2 920 5471. E-mail: [email protected]

History Received 4 August 2013 Revised 2 October 2013 Accepted 5 October 2013 Published online 22 November 2013

economically important. These Clarias species are important food fishes not only in the Philippines, but also in other Southeast and South Asian countries like Thailand, Malaysia, Indonesia, Bangladesh and India. In the Philippines, Clarias batrachus and C. gariepinus are being farmed while efforts are being undertaken by government agencies and research institutions to cultivate the dwindling C. macrocephalus. Clarias macrocephalus is popularly known as the native hito (Conlu, 1986). It was reported in Laguna de Bay (Conlu, 1986; Fowler, 1941; Herre, 1953), Lake Taal (Mercene, 1997), Lake Manguao, Palawan (Matillano, 2003), and in Cuyapo, Nueva Ecija (Froese & Pauly, 2013); however, Herre (1953) doubted its occurrence in the Philippines. In a survey of fishes of Laguna de Bay, Vallejo (1985) did not find C. macrocephalus in the lake. An earlier survey made by Delmendo & Bustillo (1968) did not list C. macrocephalus among the fishes found in Laguna de Bay. Also, Herre (1927) did not include C. macrocephalus among the fishes found in Lake Taal, the third largest lake in the Philippines. Teugels et al. (1999), citing Conlu (1986), claimed that C. macrocephalus was introduced into the Philippines for fish culture purposes, but Conlu (1986) did not make such statement. On the contrary, Conlu (1986) claimed that C. macrocephalus is an endemic species, but, this is also an erroneous claim. Since there is no record of introduction of this species into the Philippines, C. macrocephalus is thus a species native to this country as reported by Herre (1953) and by Fowler (1941). It is also a native species in Thailand, Laos, Cambodia and Vietnam (Teugels et al., 1999). Clarias batrachus is widely believed to be an introduced species in the Philippines (Froese & Pauly, 2013; Vallejo, 1985). Although individuals of C. batrachus might have been introduced

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

2

J. P. Quilang & S. C. S. Yu

from Thailand to the Philippines for aquaculture purposes in 1972 (Juliano et al., 1989), this species was reported to be widespread in the Philippines even before 1972 (Fowler, 1941; Herre, 1924, 1926, 1953). It was reported in Laguna de Bay (Delmendo & Bustillo, 1968; Herre, 1953) and in Taal Lake (Herre, 1927) and in many other places in the Philippines (Herre, 1953). Clarias batrachus is thus a native species in the Philippines and is considered one of the true freshwater fishes of the country (Herre, 1924). It is claimed that C. batrachus had become a dominant species since its supposed introduction and that it had displaced C. macrocephalus (Juliano et al., 1989), but a review of literature would show that C. batrachus was already widespread in the Philippines and that C. macrocephalus had a limited distribution even before additional individuals of C. batrachus were imported from Thailand. Clarias gariepinus is unquestionably an introduced species in the Philippines. It was imported from Taiwan for aquaculture purposes in 1985 (Juliano et al., 1989). As this species grows bigger than either C. batrachus or C. macrocephalus, it is being preferred for farming in many places in the country. There are fears, however, that this exotic species might escape into the lakes and displace indigenous species. Already, C. gariepinus had been reported in Laguna de Bay (Palma et al., 2005), but its effect to the native ichthyofauna in the lake has yet to be seen. Another introduced catfish which is being cultured throughout the Philippines is the Striped catfish Pangasianodon hypophthalmus. This catfish was introduced to the Philippines from Thailand in 1978 (Juliano et al., 1989) and then reintroduced in 1982. This species is artificially bred in ponds and reservoirs (Juliano et al., 1989), but samples have been caught in natural water bodies such as in Laguna de Bay (Aquino et al., 2011). Two other introduced species which are not commonly consumed for food, but are nonetheless of great concern because of their negative impact to the environment are the suckermouth armored catfishes Pterygoplichthys disjunctivus and Pterygoplichthys pardalis. These two South American catfishes have invaded major lakes, rivers and water basins in the Philippines and have caused problems such as displacement of indigenous species, damage to fish nets and other aquaculture structure, and they contribute to the deterioration of water quality by increasing turbidity when they create deep burrows at the bottom of shallow lakes and water basins. Of the native and endemic Philippine catfishes, those that are commonly sold in wet markets in many areas include the endemic species Arius manillensis and Plicofollis magatensis and the native species Arius dispar, Paraplotosus albilabris and Plotosus lineatus. Among these five species, the most abundant are the sea catfishes Arius manillensis and A. dispar. These two species are caught in large quantities in Laguna de Bay, Manila Bay and in rivers and dams in Central Luzon. Among the aforementioned commercially and economically important catfishes in the Philippines, DNA barcoding has been done on Arius manillensis and A. dispar (Santos & Quilang, 2011) and on Pterygoplichthys disjunctivus and P. pardalis (Jumawan et al., 2011). DNA barcoding is a powerful molecular tool for the rapid and accurate identification of fishes (Costa & Carvalho, 2007), for discovery of new species (Asgharian et al., 2011; Smith et al., 2011; Ward et al., 2008a) for detecting market substitutions and mislabeling of fish products (Barbuto et al., 2010; Cawthorn et al., 2012; Wong & Hanner, 2008), for regulation of illegally traded fishes (Ardura et al., 2010) and for tagging species for further taxonomic investigation (Lara et al., 2009; Ward et al., 2008b). DNA barcoding is thus a useful approach in the study of catfishes. In fishes and other vertebrates, this technique makes use of the partial sequence of the mitochondrial cytochrome c oxidase I (COI ) gene as a global bioidentification system (Hebert et al.,

Mitochondrial DNA, Early Online: 1–10

2003). Santos & Quilang (2011) DNA barcoded 22 specimens of A. manillensis and A. dispar obtained from only one area in the Philippines, which was in Laguna de Bay. DNA barcoding was not able to discriminate between the two Arius species. Jumawan et al. (2011) DNA barcoded 36 specimens of Pterygoplichthys disjunctivus and P. pardalis collected from Marikina River in Metro Manila and seven specimens from Agusan Marsh in Southern Philippines. DNA barcoding was not also able to discriminate between the two Pterygoplichthys species. In other countries, to date, only two studies have applied DNA barcoding on some species of catfish (Bhattacharjee et al., 2012; Wong et al., 2011). Wong et al. (2011) DNA barcoded a total of 173 specimens of nine domestic and imported catfish species and one Ictalurid hybrid in the United States of America (USA). Wong et al. (2011) developed consensus barcode sequences for each species and used these for validation tests in blind studies and for the identification of fresh and frozen catfish samples purchased from grocery stores and oriental markets in the USA. Wong et al. (2011) found that DNA barcoding was effective in differentiating between the catfish species included in their study. Bhattacharjee et al. (2012) DNA barcoded 75 specimens belonging to 25 catfish species collected from Northeast India. DNA barcoding was able to delineate 21 of the 25 species of catfish from Northeast India: the remaining four of the 25 species showed high conspecific divergence. This study aimed to develop DNA barcodes for 11 commercially and economically important catfishes in the Philippines, namely: Clarias macrocephalus Gunther, 1864; C. batrachus (Linnaeus, 1758); C. gariepinus (Burchell, 1822); Arius manillensis Valenciennes, 1840; A. dispar Herre, 1926; Pangasianodon hypophthalmus (Sauvage, 1878), Plicofollis magatensis (Herre, 1926); Paraplotosus albilabris (Valenciennes, 1840); Plotosus lineatus (Thunberg, 1787); Pterygoplichthys disjunctivus (Weber, 1991), and Pterygoplichthys pardalis (Castelnau, 1855). The specific objectives of this study were as follows: (1) to determine if DNA barcoding can differentiate one species of catfish from the other species; (2) to determine the relationships of three Clarias species found in the Philippines with those from Thailand and India; and (3) to obtain additional DNA barcodes for Arius manillensis, A. dispar, Pterygoplichthys disjunctivus, and Pterygoplichthys pardalis from other areas in the Philippines and to verify previous DNA barcoding results on these species.

Materials and methods Sample collection and identification A total of 75 specimens of 11 commercially and economically important catfishes in the Philippines were collected (Table 1). These included 10 specimens of Arius dispar, 7 Arius manillensis, 10 Clarias batrachus, 11 Clarias gariepinus, 6 Clarias macrocephalus, 5 Paraplotosus albilabris, 10 Plotosus lineatus, 7 Pangasianodon hypophthalmus, 10 Pterygoplichthys disjunctivus, 7 Pterygoplichthys pardalis and 5 Plicofollis magatensis. The specimens were initially identified based on their morphologies. Herre (1926), Kailola (1999), Marceniuk & Menezes (2007) were used for the identification of Arius dispar, Arius manillensis, and Plicofollis magatensis. Roberts & Vidthayanon (1991) was used for the identification of Pangasianodon hypophthalmus. Conlu (1986), Teugels et al. (1999), Sudarto & Pouyaud (2005) and Ng & Kottelat (2008) were used for the identification of the three Clarias species. Armbruster (2002) and Wu et al. (2011) were used for the differentiation between Pterygoplichthys pardalis and P. disjunctivus. Herre (1926), Allen (1998) and Ferraris (1999) were referred for the identification of Paraplotosus albilabris and Plotosus lineatus. GPS coordinates of

DNA barcoding of Philippine catfishes

DOI: 10.3109/19401736.2013.855897

3

Table 1. Summary of catfishes barcoded in this study.

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Species

Family

Status

No. of specimens

Arius dispar

Ariidae

Native

Arius manillensis

Ariidae

Endemic

Clarias batrachus

Clariidae

Introduced/ Native*

12

Clarias gariepinus Clarias macrocephalus Pangasianodon hypophthalmus Paraplotosus albilabris Plicofollis magatensis Plotosus lineatus

Clariidae Introduced Clariidae Native Pangasiidae Introduced

5 5 5

Plotosidae Ariidae Plotosidae

5 7 7

Pterygoplichthys disjunctivus

Loricariidae Introduced

7

Pterygoplichthys pardalis

Loricariidae Introduced

5

Native Endemic Native

10

7

Collection site Angat River, Bulacan; Laguna de Bay; Pampanga River, Candaba Paran˜aque Fish Port, Manila Bay; Pampanga River, Candaba; Tanza, Cavite, Manila Bay Aparri, Cagayan; Lake Bato, Camarines Sur; Lake Buhi Camarines Sur; Lake Manapao, Camarines Sur Bustos, Bulacan Aparri, Cagayan Cabaritan, Bay town, Laguna Dumangas, Iloilo Camalaniugan, Cagayan Alaminos, Pangasinan; Pagbilao, Quezon Province Pampanga River, Candaba; Tanay, Rizal, Laguna de Bay Pampanga River, Candaba; Tanay, Rizal, Laguna de Bay

BOLD process ID

GenBank accession number

BPC001-13; BPC003-13 to BPC008-13; BPC010-13 to BPC012-13 BPC002-13; BPC009-13; BPC013-13 to BPC017-13

KF604628 to KF604637

BPC057-13 to BPC068-13

KF604645 to KF604656

BPC030-13 to BPC034-13 BPC052-13 to BPC056-13 BPC047-13 to BPC051-13

KF604657 to KF604661 KF604662 to KF604666 KF604667 to KF604671

BPC042-13 to BPC046-13 BPC069-13 to BPC075-13 BPC035-13 to BPC041-13

KF604672 to KF604676 KF604677 to KF604683 KF604684 to KF604690

BPC018-13 to BPC024-13

KF604691 to KF604697

BPC025-13 to BPC029-13

KF604698 to KF604702

KF604638 to KF604644

*FishBase (Froese & Pauly, 2013) and Juliano et al. (1989) list this species as introduced, but earlier reports (Herre, 1924, 1926) showed that it is native to the Philippines.

collection sites and other metadata were recorded. Each specimen was photographed on the dorsal and left side views using Nikon D90 SLR camera. A piece of white muscle tissue was excised from the right body side of each specimen. The tissue was placed in a 2-mL microfuge tube containing absolute ethanol and stored in the freezer until further use. DNA extraction and PCR amplification Approximately 20 mg of muscle tissue was subjected to DNA extraction using Promega WizardÕ Genomic DNA purification kit (Madison, WI) following the manufacturer’s protocol. Combinations of the following forward (FishF) and reverse (FishR) primers were used for the amplification of approximately 655 bp of the mitochondrial cytochrome c oxidase I (COI) gene (Ward et al., 2005): FishF1 (50 TCAACCAACCACAAAGACATTGGCAC30 ) FishF2 (50 TCGACTAATCATAAAGATATCGGCAC30 ) FishR1 (50 TAGACTTCTGGGTGGCCAAAGAATCA30 ) FishR2 (50 ACTTCAGGGTGACCGAAGAATCAGAA30 ) Polymerase chain reactions (PCR) were done in 50-mL volumes. The PCR mix consisted of 1.0 mL of dNTP (0.05 mM), 2.5 mL of each primer (0.1 mM), 5.0 mL of 1  PCR buffer, 0.5 mL of (1.25 U) Taq polymerase (Roche Taq dNTPack), 34.5 mL of ultrapure water and 4.0 mL of DNA template. The PCR conditions were as follows (Ward et al., 2005): initiation for 2 min at 95  C followed by 35 cycles of denaturation for 0.5 min at 94  C, primer annealing for 0.5 min at 54  C, and primer extension for 1 min at 72  C. A final extension step at 72  C for 10 min completed the reaction. The PCR products were visualized on 1% agarose gels with ethidium bromide. Approximately 650 bp sized bands were excised from the gel. These were then purified with QIAquickÕ Gel Extraction Kit (QIAGEN, Valencia, CA) following manufacturer’s protocol. The purified DNA products were sent to 1st

BASE in Selangor Darul Ehsan, Malaysia for bidirectional sequencing. DNA sequence analysis The consensus COI sequence of each specimen was obtained by aligning the sequences generated using forward and reverse primers using Staden Package v4.10 (Staden et al., 2000). The consensus sequences were aligned and analyzed using BioEdit sequence alignment version 7.0.5.3 (Hall, 1999). Additional sequences were downloaded from BOLD (Barcode of Life Data Systems, www.boldsystems.org) and GenBank for validation and for some analyses (Table 2). Pairwise genetic distances within species, genus and family and between species were calculated using the Kimura 2-Parameter method (K2P) (Kimura, 1980). Neighbor-Joining (NJ) trees at 1000 pseudoreplicates (Saitou & Nei, 1987) were constructed using the K2P model. K2P genetic distances and NJ trees were produced using the MEGA version 5 software (Tamura et al., 2011). All sequences, digital images and other metadata were submitted to the Barcoding of Life Data Systems (BOLD). All 75 COI sequences were also submitted to GenBank, with accession numbers KF604628 to KF604702.

Results All in all, 75 COI sequences were generated from 11 commercially and economically important catfishes in the Philippines. The COI sequences ranged from 621 to 652 bp with an average of 649 bp. The 75 sequences were clustered using Neighbor-Joining (NJ) tree as shown in Figure 1. COI sequences of each species clustered together according to their species designation with 99% bootstrap support for each cluster, except for Arius dispar, A. manillensis, Pterygoplichthys disjunctivus and P. pardalis. COI sequences of A. dispar and A. manillensis formed one cluster while P. disjunctivus and P. pardalis formed another, distinct from

4

J. P. Quilang & S. C. S. Yu

Mitochondrial DNA, Early Online: 1–10

Table 2. List of additional sequences obtained from GenBank and from Barcoding of Life Data Systems (BOLD). Species Arius dispar Arius manillensis Arius subrostratus

BOLD/GenBank accession number HQ682606–HQ682609, HQ682612 HQ682615–HQ682617, HQ682619–HQ682626 EU148555–EU148556, WL-M686–WL-M687

Arius arius

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Source

EU148548–EU148549, EU148551–EU148552, WL-M663–WL-M667 Netuma thalassina JN242652–JN242656, FSCS1023-11 Clarias batrachus HQ682679–HQ682681, HQ654701 JF292297–JF292309 JN628880, JN628924 GQ466399–GQ466403 JQ699207–JQ699208 Clarias macrocephalus JF292321–JF292337 Clarias gariepinus JF292310–JF292320 JQ699199, JQ699201, JQ699203 Pterygoplichthys disjunctivus JF498719–JF498724, JF769355–JF769356 Pterygoplichthys pardalis JF769358, JF769360–JF769362 JQ667566–JQ667567 Pterygoplichthys etentaculatus HM405207–HM405210, HM404959 Hypostomus strigaticeps JX443492–JX443496

the other clusters, each cluster having a 99% bootstrap support. The 11 species also grouped according to their familes. Arius manillensis, A. dispar and Plicofollis magatensis of the family Ariidae clustered together with 99% bootstrap support. Clarias gariepinus, C. macrocephalus, and C. batrachus of the family Clariidae formed a clade with 86% bootstrap support. The two species of the family Loricariidae, namely, Pterygoplichthys disjunctivus and P. pardalis also formed a single cluster with 99% bootstrap support. Paraplotosus albilabris and Plotosus lineatus of the family Plotosidae also grouped together with 76% bootstrap support. The COI sequences of the only species included in the study belonging to family Pangasiidae, Pangasionodon hypophthalmus, also formed a cluster distinct from the other groups. The minimum, maximum, and average percent K2P genetic distances are summarized in Table 3. The average K2P genetic distances were found to be 0.2, 8.2, 12.7 and 21.9% within species, genus, family and order, respectively. Since COI sequences of Arius dispar and A. manillensis cannot discriminate between the two species, additional COI sequences were downloaded from GenBank and BOLD (Table 2). A total of 52 COI sequences from four Arius species and Netuma thallasina (outgroup) were analyzed. The NJ tree (Figure 2) showed that the 17 COI sequences of Arius dispar and A. manillensis from this study and the 16 COI sequences from GenBank and BOLD clustered together with 90% bootstrap support. The COI sequences of Arius subrostratus, A. arius, and Netuma thallasina each formed a separate cluster with 100, 100 and 96% bootstrap support, respectively. Within each species of A. dispar and A. manillensis, the intra-specific percent K2P genetic distances ranged from 0 to 1.3% with an average of 0.6% (Table 4). These are also the values for the percent K2P genetic distances between the two species. Additional COI sequences were also acquired from GenBank and BOLD for four species of the Family Loricariidae, namely, Perygoplichthys disjunctivus (n ¼ 8) P. pardalis (n ¼ 6), P. etentaculatus (n ¼ 5) and Hypostomus strigaticeps (n ¼ 5, Table 2). A total of 36 COI sequences were analyzed. An NJ tree was constructed using H. strigaticeps as an outgroup (Figure 3). The tree revealed two clusters containing both P. pardalis and P. disjunctivus having 87 and 95% bootstrap support. The mean percent K2P genetic distance between the two clusters is 0.6%. Five unique haplotypes (H1–H5) were found for the cluster containing 9 P. pardalis and 10 P. disjunctivus COI

Santos & Quilang (2011) Santos & Quilang (2011) Lakra et al. (2011), National Bureau of Fish Genetic Resources, India Lakra et al. (2011), National Bureau of Fish Genetic Resources, India Zhang & Hanner (2012) Aquino et al. (2011), Aquilino et al. (2011) Wong et al. (2011) Bhattacharjee et al. (2012) Barman et al. unpublished Aneesha et al. unpublished Wong et al. (2011) Wong et al. (2011) Aneesha et al. unpublished Jumawan et al. (2011) Jumawan et al. (2011) Khedkar et al. unpublished de Carvalho et al. (2011) Pansonato-Alves et al. (2013)

sequences, while 3 unique haplotypes (H6–H8) were found for the cluster containing 2 P. pardalis and 5 P. disjunctivus COI sequences. Haplotype 5 (H5) was shared between 7 P. pardalis and 7 P. disjunctivus COI sequences. Haplotype 7 (H7) was shared between 1 P. pardalis and 3 P. disjunctivus COI sequences. The two clusters converged at one node with 99% bootstrap support. On the other hand, COI sequences of P. etentaculatus and H. strigaticeps clustered according to their species designation with 99 and 100% bootstrap support, respectively. Within each species of P. pardalis and P. disjunctivus, the intra-specific percent K2P genetic distances ranged from 0 to 0.7% with average values of 0.2% for P. pardalis and 0.4% for P. disjunctivus (Table 5). The percent K2P genetic distances between the two species ranged from 0 to 0.7% with an average of 0.3%. To determine the relationship of Clarias species from the Philippines with those from Thailand and India, additional sequences were also downloaded from GenBank and BOLD. A total of 22 Clarias macrocephalus COI sequences were analyzed (5 from the Philippines and 17 from Thailand), 39 C. batrachus sequences (16 from the Philippines, 10 from India, 13 from Thailand), and 19 C. gariepinus sequences (5 from the Philippines, 3 from India, 11 from Thailand). COI sequences clustered according to their species designation regardless of their country of origin with 100% bootstrap support each for C. macrocephalus and C. gariepinus, but only 57% support for C. batrachus (Figure 4). The COI sequences clustered according to their country of origin for C. batrachus and C. macrocephalus, but not for C. gariepinus. The 16 C. batrachus COI sequences from the Philippines clustered together with 88% bootstrap support; those from Thailand and India clustered according to country of origin, with each cluster having a 100% bootstrap support. The 5 C. macrocephalus COI sequences from the Philippines formed a cluster distinct from the three different clusters formed by COI sequences from Thailand, but the relationship of the four clusters is unresolved. As for C. gariepinus, the COI sequences did not group according to country of origin. The K2P genetic distances ranged from 0% to 1% with an average of 0.6% for C. macrocephalus, 0 to 12.5% with an average of 5.3% for C. batrachus, and 0 to 2.4% with an average of 0.5% for C. gariepinus (Table 6). The genetic distances of C. batrachus within and between the three Asian countries were also computed (Table 7). Within each country, the K2P

DNA barcoding of Philippine catfishes

DOI: 10.3109/19401736.2013.855897

Arius dispar 10 Arius manillensis 6 97 Arius dispar 9 Arius dispar 8 Arius dispar 1 87

Arius manillensis 1 Arius manillensis 2

90

99

Arius manillensis 3

63

Arius manillensis 5

Arius dispar 6 Arius manillensis 7

K2P genetic distance (%)

68 99 99 86 84 99

Within Within Within Within

species genus family order

245 250 154 2126

0 0 9.599 18.302

Mean

Maximum

Standard error

0.197 8.171 12.697 21.897

1.029 16.328 21.555 26.224

0.019 0.419 0.374 0.037

Data are from 75 COI sequences of 11 commercially important catfishes in the Philippines.

Arius dispar 5 Arius dispar 2 Arius dispar 3 Plicofollis magatensis (n=7)

Clarias gariepinus (n=5) 99 Clarias macrocephalus (n=5) 99 Clarias batrachus (n=12)

Pangasianodon hypophthalmus (n=5) Pterygoplichthys disjunctivus 1 Pterygoplichthys disjunctivus 2 Pterygoplichthys disjunctivus 3 Pterygoplichthys disjunctivus 4 Pterygoplichthys disjunctivus 5 99

Pterygoplichthys disjunctivus 6 Pterygoplichthys disjunctivus 7

Pterygoplichthys pardalis 1 Pterygoplichthys pardalis 2 Pterygoplichthys pardalis 3 Pterygoplichthys pardalis 4 99 99

76

No. of comparisons Minimum

Comparison

58 Arius manillensis 4 Arius dispar 7

99

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Table 3. Summary of percent genetic divergence within species, within genus, within family, and within order using Kimura 2-Parameter (K2P) method.

Arius dispar 4

60

5

Pterygoplichthys pardalis 5

Paraplotosus albilabris (n=5) Plotosus lineatus (n=7)

98

Arius dispar|HQ682612 Arius manillensis|HQ682620 Arius manillensis|HQ682624 Arius dispar|HQ682606 Arius dispar|HQ682608 67 Arius dispar 10 Arius dispar 9 Arius dispar 8 Arius dispar 4 85 Arius dispar 1 Arius manillensis|HQ682619 Arius manillensis|HQ682615 Arius manillensis 6 43 Arius manillensis|HQ682617 Arius dispar 6 Arius dispar 2 Arius dispar 5 73 Arius dispar 7 Arius dispar|HQ682609 Arius manillensis|HQ682626 Arius manillensis|HQ682625 90 Arius manillensis|HQ682623 Arius manillensis|HQ682622 Arius manillensis 4 Arius manillensis 7 Arius dispar 3 Arius manillensis|HQ682616 Arius manillensis|HQ682621 Arius manillensis 3 71 Arius manillensis 5 65 Arius dispar|HQ682607 Arius manillensis 1 63 Arius manillensis 2 Arius subrostratus|WL-M686 Arius subrostratus|WL-M687 Arius subrostratus|EU148555 Arius subrostratus|EU148556 Arius arius|EU148549 100 Arius arius|EU148548 Arius arius|WL-M663 Arius arius|WL-M664 Arius arius|WL-M665 Arius arius|EU148552 Arius arius|EU148551 66 Arius arius|WL-M666 Arius arius|WL-M667 100

0.02

99

Figure 1. Unrooted Neighbor-Joining (NJ) tree of 75 COI sequences from 11 species of catfish computed using the Kimura 2-parameter (K2P) method (Kimura, 1980). Bootstrap supports of 1000 replicates are shown. Values in parentheses correspond to the number (n) of COI sequences for the species in the cluster. The specimen number is indicated for each Arius and Pterygoplichthys COI sequence in the NJ tree. Analyses were conducted using MEGA 5 software (Tamura et al., 2011).

genetic distances ranged from 0 to 1.8%, with average values that are not more than 0.6%. However, between India and the two other countries, the K2P distances ranged from 10.8 to 12.5%; but, between Thailand and the Philippines, the K2P distance only ranged from 2.2 to 2.8% with an average of 2.6%.

Discussion DNA barcoding using the mitochondrial cytochrome c oxidase I (COI) gene clearly delineated seven of the 11 commercially and economically important catfishes in the Philippines. These seven species include Clarias batrachus, C. gariepinus, C. macrocephalus, Plicofollis magatensis, Paraplotosus

Netuma thalassina|JN242655 Netuma thalassina|JN242653 Netuma thalassina|JN242656 Netuma thalassina|JN242654 Netuma thalassina|JN242652 Netuma thalassina|FSCS1023 0.01

Figure 2. Neighbor-Joining (NJ) tree of 52 COI sequences from four Arius species and Netuma thallasina (outgroup taxon) computed using the Kimura 2-parameter (K2P) method (Kimura, 1980). Bootstrap supports of 1000 replicates are shown. Accession numbers of sequences from GenBank or Barcoding of Life Data Systems (BOLD) are shown. The specimen number is indicated in the NJ tree for each Arius COI sequence generated from this study. Analyses were conducted using MEGA 5 software (Tamura et al., 2011).

6

J. P. Quilang & S. C. S. Yu

Mitochondrial DNA, Early Online: 1–10

Table 4. Summary of percent genetic divergences within and between species using Kimura 2-Parameter (K2P) method.

Pterygoplichthys pardalis|JF769362 Pterygoplichthys pardalis|JF769361 Pterygoplichthys pardalis|JQ667567

K2P genetic distance (%) Comparison Within species (All) Within Arius dispar Within Arius manillensis Between A. dispar and A. manillensis Between Arius and Netuma

Pterygoplichthys pardalis|JQ667566

No. of Standard Comparisons Minimum Mean Maximum error 311

0

0.468

1.318

0.022

105 141

0 0

0.453 0.620

0.985 1.318

0.034 0.032

282

0

0. 554

1.318

0.023

322

1.485

3.159

8.239

0.145

Pterygoplichthys disjunctivus 7 Pterygoplichthys disjunctivus 6 Pterygoplichthys disjunctivus 5 Pterygoplichthys disjunctivus 4 Pterygoplichthys disjunctivus 3 87

Pterygoplichthys disjunctivus 2 Pterygoplichthys disjunctivus 1 Pterygoplichthys disjunctivus|JF498721 Pterygoplichthys disjunctivus|JF498719 Pterygoplichthys disjunctivus|JF498720

Data are from 52 COI sequences of four Arius species and Netuma thalassima (outgroup taxon).

Pterygoplichthys pardalis 1 Pterygoplichthys pardalis 2

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

99

albilabris, Plotosus lineatus and Pangasianodon hypophthalmus. Two of the 11 species do not have previous COI records in GenBank. These two species are Paraplotosus albilabris and Plicofollis magatensis, a species found only in northern Philippines. DNA barcoding, however, was not able to discriminate between the native species Arius dispar and the endemic species A. manillensis and between the two introduced species Pterygoplichthys disjunctivus and P. pardalis. This confirms previous DNA barcoding studies which were not able to discriminate between the species (Jumawan et al., 2011; Santos & Quilang, 2011). Santos & Quilang (2011) collected A. dispar and A. manillensis specimens from only one area in the Philippines, that is, in Laguna de Bay. In this study, specimens were collected not just in Laguna de Bay, but also in other areas where the two species could be found such as in Manila Bay and in dams and rivers in Central Luzon. Jumawan et al. (2011) DNA barcoded specimens of Pterygoplichthys disjunctivus and P. pardalis collected from Marikina River in eastern Metro Manila and in Agusan Marsh in Mindanao. But even with the addition of new Pterygoplichthys specimens from other areas in the Philippines, the two species could not be differentiated from each other using DNA barcoding. The genetic distance using the Kimura 2-Parameter (K2P) method between the two Arius species ranged from 0 to 1.3% with an average of 0.6%. The K2P genetic distance between the two Pterygoplichthys species ranged from 0 to 0.7% with an average of 0.3%. In contrast, the average K2P distance of species belonging to the same genus was 8.11% for 546 Australian fishes (Ward et al., 2009), 6.6% for 115 marine fishes from India (Lakra et al., 2011), and 13.67% for 752 North American freshwater fishes (April et al., 2011). The K2P genetic distance between the two Arius species and between the two Pterygoplichthys species overlap with genetic distances of specimens within each species. It is possible that the two Arius species are one and the same species, likewise the two Pterygoplichthys species are one and the same species. The American Ichthyologist Albert Herre who studied much of the Philippine ichthyofauna erected A. dispar as a new species in 1926 based on the specimens he collected from Laguna de Bay, Pasig River, and from markets in Manila (Herre, 1926). Arius dispar and A. manillensis have overlapping morphologies. The only trait that can be reliably used to distinguish between the two species is the pattern of tooth patch on the palate in adult specimens: A. manillensis has two large ovate tooth patches on the palate, whereas A. dispar has two small widely separated tooth patches (Kailola, 1999). This trait may not be a good character to differentiate the two species. On the other hand, the two species of Pterygoplichthys are distinguished by the patterns of spots and

Pterygoplichthys pardalis 3 Pterygoplichthys pardalis 4 Pterygoplichthys pardalis 5 Pterygoplichthys disjunctivus|JF769356 Pterygoplichthys disjunctivus|JF769355 Pterygoplichthys disjunctivus|JF498723 Pterygoplichthys disjunctivus|JF498722 95

Pterygoplichthys disjunctivus|JF498724 Pterygoplichthys pardalis|JF769360 Pterygoplichthys pardalis|JF769358

Pterygoplichthys etentaculatus|HM405209 Pterygoplichthys etentaculatus|HM405207 99

Pterygoplichthys etentaculatus|HM405210 Pterygoplichthys etentaculatus|HM405208 Pterygoplichthys etentaculatus|HM404959 Hypostomus strigaticeps|JX443496 Hypostomus strigaticeps|JX443494 Hypostomus strigaticeps|JX443492 100

Hypostomus strigaticeps|JX443495 Hypostomus strigaticeps|JX443493

0.01

Figure 3. Neighbor-Joining (NJ) tree of 36 COI sequences from four species under Loricariidae family computed using the Kimura 2parameter (K2P) method (Kimura, 1980). Hypostomus strigaticeps is used as an outgroup taxon. Bootstrap supports of 1000 replicates are shown. Accession numbers of sequences from GenBank are shown. The specimen number is indicated in the NJ tree for each Pterygoplichthys COI sequence generated from this study. Analyses were conducted using MEGA 5 software (Tamura et al., 2011).

vermiculations on the abdomen: P. disjunctivus has typical dark abdominal vermiculations on a light background, whereas P. pardalis has dark spots on otherwise light background in the abdomen (Chavez et al., 2006). However, intermediate forms of the abdominal patterns have been observed (Chavez et al., 2006; Jumawan et al., 2011; Wu et al., 2011). The two species also have overlapping meristic and morphometric characters (Chavez et al., 2006). In this study, the K2P genetic distance between the two species ranged from 0 to 0.7% with an average of 0.3%. Using mitochondrial cytochrome b, Wu et al. (2011) found very low genetic divergence between the two species collected from Taiwan, thus they proposed that P. disjunctivus could be a synonym of P. pardalis. Jumawan et al. (2011) also found very low genetic distance between the two species. Thus, this study

DNA barcoding of Philippine catfishes

DOI: 10.3109/19401736.2013.855897

7

Table 5. Summary of percent genetic divergences within and between species using Kimura 2-Parameter (K2P) method. K2P genetic distance (%) Comparison Within species (All) Within P. pardalis Within P. disjunctivus Within P. etentaculus Between P. pardalis and P. disjunctivus Between P. pardalis and P. etentaculus Between P. disjunctivus and P. etentaculus

No. of comparisons

Minimum

Mean

Maximum

Standard error

465 55 105 10 165 55 75

0 0 0 0 0 3.038 3.038

1.062 0.244 0.355 0 0.293 3.038 3.038

3.038 0.745 0.745 0 0.745 3.038 3.038

0.059 0.048 0.037 0 0.028 0 0

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Data are from 31 COI sequences of three Pterygoplichthys species.

support the claim of Wu et al. (2011) that the two species, both South American in origin, are probably one and the same and that P. disjunctivus could just be a synonym of P. pardalis. Another important and significant finding in this study is the elucidation of the status of Clarias batrachus in the Philippines and its relationship to C. batrachus from Thailand and India. There has been some confusion on this species in two previous DNA barcoding studies of catfishes (Bhattacharjee et al., 2012; Wong et al., 2011). Bhattacharjee et al. (2012) noted a wide barcoding gap between C. batrachus they collected from NorthEast India and the C. batrachus in GenBank (Accession number HQ654701), which was from the Philippines. Due to the large genetic distance, Bhattacharjee et al. (2012) thought that the C. batrachus from the Philippines was mislabeled. In barcoding C. batrachus from Thailand, Wong et al. (2011) also thought that COI sequences of C. batrachus in GenBank came from misidentified specimens. Indeed, as shown in Figure 4, C. batrachus from the Philippines, Thailand and India clustered according to their country of origin. Within each country, the minimum, maximum and average K2P genetic distances were 0, 1.8 and 0.6%, respectively for India; 0, 0.4 and 0.1%, respectively for Thailand; and 0, 0.2 and 0.1%, respectively for the Philippines (Table 7). However, the minimum, maximum and average K2P genetic distances between C. batrachus from India and those from the Philippines were 10.8, 11.7 and 11.3%, respectively; between India and Thailand, the values were 11.5, 12.5 and 12%, respectively; and, between Thailand and the Philippines, the values were 2.2, 2.8 and 2.6%, respectively. It is clear from these genetic distances that C. batrachus from India are very different from those in the Philippines and Thailand. These values are characteristic of genetic distances for two different species obtained in fish DNA barcoding studies. Indeed, Ng & Kottelat (2008) suggested that what is currently recognized as C. batrachus consist of four different species. Ng & Kottelat (2008) claimed that what is considered as C. batrachus from North-Eastern India should be called C. magur as the Indian species has a head shape and pectoral spine serration different from those found in Southeast Asia. Moreover, karyological evidence also showed that C. batrachus from India is different from that in Thailand. It has been found that the diploid chromosome number (2 n) and arm number (FN) of C. batrachus from India were 50–54 and 58–88, respectively, while 2 n and FN for C. batrachus from Thailand were 100 and 108, respectively (Ng & Kottelat, 2008). Ng & Kottelat (2008) chose to retain C. batrachus for the species found in Java, Indonesia as they have designated a neotype from that type locality. The species found in mainland Southeast Asia, which includes Thailand, is designated as C. aff. batrachus ‘‘Indochina’’ while the species found in the rest of Sundaic Southeast Asia is designated as C. aff. batrachus ‘‘Sundaland’’. Ng & Kottelat (2008) noted that C. batrachus has

also been recorded in the Philippines but were unable to examine specimens from the Philippines. In this study, the average K2P distance between C. batrachus from Thailand and those from the Philippines was found to be 2.6%. The average K2P intra-specific genetic distance was 0.35% for 546 Australian fishes (Ward et al., 2009), 0.3% for 115 marine fishes from India (Lakra et al., 2011), and 0.73% for 752 North American freshwater fishes (April et al., 2011). Moreover, Hebert et al. (2004) proposed that when specimens show a genetic distance that is at least 10-fold higher than the average intra-specific distance of the group under study, these specimens may be considered provisional new species. In this study, the average intra-specific genetic distance is 0.2%. Hence, the genetic distance between C. batrachus specimens from the Philippines and Thailand is 13-fold higher than the average intra-specific distance. Thus, in support of Ng & Kottelat (2008), it is possible that the C. batrachus from Thailand is different from that in the Philippines. Although the genetic distance of 2.6% is much lower compared to the average congeneric distance of 8.11% in Ward et al. (2009), 6.6% in Lakra et al. (2011) and 13.67% in April et al. (2011), analysis of COI divergences of 1088 fish species, however, showed that at 2% K2P genetic distance, the probability of conspecificity is only 3% (Ward, 2009). It is thus more likely that specimens from the Philippines belong to a different species and that it is probably endemic to this country. Assuming C. batrachus from the Philippines and Thailand are the same species, the genetic distance of 2.6% as well as the clear separation of specimens from the two countries as shown in the NJ tree (Figure 4) suggest geographic differentiation. This supports earlier reports that C. batrachus is a native species in the Philippines (Herre, 1924, 1926), contrary to what is being widely believed that it is an introduced species (Froese & Pauly, 2013; Vallejo, 1985). Although an introduction of C. batrachus from Thailand to the Philippines was recorded in 1972 (Juliano et al., 1989), genetic mixing was not detected in this study as shown by the separation of Thai and Philippine specimens in the NJ tree and the genetic distance of 2.6%. In contrast, the African catfish C. gariepinus, which is an introduced species in the three Asian countries, did not show geographic differentiation. Although the five specimens of C. macrocephalus from the Philippines grouped together and separated from the other clusters formed by the specimens from Thailand, the genetic distances between them are very small and consistent with them being the same species.

Conclusions DNA barcoding was able to delineate seven of the 11 commercially and economically important Philippine catfishes. These include the endemic species Plicofollis magatensis, the native species Clarias batrachus, C. macrocephalus, Paraplotosus

Clarias batrachus|HQ682681 Clarias batrachus|HQ682679 Clarias batrachus|HQ682680 Clarias batrachus|HQ654701 Clarias batrachus 8 64 Clarias batrachus 7 Clarias batrachus 6 Clarias batrachus 5 Philippines Clarias batrachus 4 88 Clarias batrachus 3 Clarias batrachus 1 Clarias batrachus 2 Clarias batrachus 9 Clarias batrachus 10 100 63 Clarias batrachus 11 Clarias batrachus 12 Clarias batrachus|JF292298 Clarias batrachus|JF292301 Clarias batrachus|JF292297 100 Clarias batrachus|JF292308 Clarias batrachus|JF292306 Clarias batrachus|JF292304 Clarias batrachus|JF292299 Thailand 65 Clarias batrachus|JF292305 Clarias batrachus|JF292309 Clarias batrachus|JF292300 Clarias batrachus|JF292302 Clarias batrachus|JF292303 65 Clarias batrachus|JF292307 Clarias batrachus|JN628880 Clarias batrachus|GQ466400 100 Clarias batrachus|GQ466403 Clarias batrachus|GQ466402 69 Clarias batrachus|GQ466399 Clarias batrachus|GQ466401 India Clarias batrachus|JN628924 Clarias batrachus|JQ699208 Clarias batrachus|JQ699207 Clarias batrachus|JQ699205 Clarias macrocephalus|JF292326 Clarias macrocephalus|JF292324 84 Clarias macrocephalus|JF292330 Clarias macrocephalus|JF292323 Clarias macrocephalus|JF292333 Clarias macrocephalus|JF292337 Thailand Clarias macrocephalus|JF292328 100 Clarias macrocephalus|JF292322 83 Clarias macrocephalus|JF292332 Clarias macrocephalus|JF292325 Clarias macrocephalus|JF292327 69 Clarias macrocephalus 3 Clarias macrocephalus 4 Clarias macrocephalus 5 Philippines 90 Clarias macrocephalus 2 Clarias macrocephalus 1 Clarias macrocephalus|JF292331 Clarias macrocephalus|JF292329 75 Clarias macrocephalus|JF292335 Thailand Clarias macrocephalus|JF292321 66 Clarias macrocephalus|JF292336 Clarias macrocephalus|JF292334 100 Clarias gariepinus|JF292314 Thailand Clarias gariepinus|JF292311 100 Clarias gariepinus 1 Clarias gariepinus 2 92 Clarias gariepinus 3 Philippines 57 Clarias gariepinus 4 Clarias gariepinus 5 Clarias gariepinus|JF292310 Clarias gariepinus|JF292312 Clarias gariepinus|JF292316 Clarias gariepinus|JF292318 Clarias gariepinus|JF292320 Thailand 56 Clarias gariepinus|JF292315 Clarias gariepinus|JF292313 Clarias gariepinus|JF292317 Clarias gariepinus|JF292319 Clarias gariepinus|JQ699203 Clarias gariepinus|JQ699201 India Clarias gariepinus|JQ699199

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

57

0.01

Figure 4. Neighbor-Joining (NJ) tree of 80 COI sequences of three Clarias species from Thailand, India, and Philippines, computed using the Kimura 2-parameter (K2P) method (Kimura, 1980). Bootstrap supports of 1000 replicates are shown. Accession numbers of sequences from GenBank or Barcoding of Life Data Systems (BOLD) are shown. The specimen number is indicated in the NJ tree for each Clarias COI sequence generated from this study. Analyses were conducted using MEGA 5 software (Tamura et al., 2011).

Table 6. Summary of percent genetic divergences within species and genus of Clarias macrocephalus, C. batrachus, and C. gariepinus, using Kimura-2 Parameter (K2P) method. K2P genetic distance (%) No. of Standard comparisons Minimum Mean Maximum error

Comparison Within Clarias macrocephalus Within C. batrachus Within C. gariepinus Within species (All) Within genus (All)

231 741 171 1143 2017

0 0 0 0 12.521

0.625

0.979

0.021

5.321 0.522 3.654 14.143

12.465 2.373 12.465 15.970

0.188 0.057 0.140 0.021

Data are from 22 sequences of Clarias macrocephalus (5 from the Philippines, 17 from Thailand), 39 sequences of C. batrachus (16 from the Philippines, 10 from India, 13 from Thailand) and 19 Clarias gariepinus (5 from the Philippines, 3 from India, 11 from Thailand).

Table 7. Summary of percent genetic divergences using Kimura 2-Parameter (K2P) method of Clarias batrachus specimens within and between countries. K2P genetic distance (%) Comparison Within all 3 countries Within India Within Thailand Within Philippines Between India and Philippines Between India and Thailand Between Thailand and Philippines

No. of Standard comparisons Minimum Mean Maximum error 741

0

5.321

12.465

0.188

45 78 120 160

0 0 0 10.807

0.577 0.144 0.078 11.262

1.767 0.389 0.194 11.740

0.062 0.014 0.009 0.018

130

11.520

12.006

12.465

0.020

208

2.179

2.566

2.790

0.011

COI sequences of C. batrachus from India (n ¼ 10) and Thailand (n ¼ 13) were downloaded from GenBank and those from the Philippines were generated in this study (n ¼ 12) and downloaded from GenBank (n ¼ 4).

albilabris and Plotosus lineatus, and the introduced species C. gariepinus and Pangasianodon hypophthalmus. DNA barcoding was not able to discriminate between the native species Arius dispar and the endemic species A. manillensis and between the two introduced species Pterygoplichthys disjunctivus and P. pardalis. It is possible that the morphological traits used to distinguish between species pairs are not reliable taxonomic characters and that these two species pairs are simply synonyms. DNA barcoding also showed that Clarias batrachus from the Philippines is different from those found in India and Thailand, which is consistent with the suggestion of Ng & Kottelat (2008) to assign the name C. magur for the species found in India and C. aff. batrachus ‘‘Indochina’’ for the species found in mainland Southeast Asia. This study also supports earlier claims that C. batrachus is a native species (Herre, 1926) and a true freshwater species in the Philippines (Herre, 1924) as considerable genetic differentiation from non-Philippines material was observed in our analyses. Genetic mixing between native populations of C. batrachus in the Philippines and those introduced from Thailand has not been observed at least from the sites in the Philippines where the specimens were collected in this study, namely, in Taal Lake and Laguna de Bay in Southern Luzon; Lake Bato, Lake Buhi, and Lake Manapao, in the Bicol Region; and, in irrigation water in Aparri, Cagayan,

DOI: 10.3109/19401736.2013.855897

Northern Philippines. This study affirms that DNA barcoding is an effective method in delineating species and in tagging species for further taxonomic studies which would result in accurate assessment of biodiversity and in the formulation of strategies to properly manage and conserve native, endemic, and introduced catfish species that are commercially and economically important.

Acknowledgements We would like to thank John Carlos del Pozo, Ambrocio Melvin Matias, Jose Timothy Martin Chua and Jordan Ferdin Halili for assisting in collecting samples.

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

Declaration of interest The authors report no conflict of interest. The authors alone are responsible for the content and writing of this article. We would like to thank the Office of the Chancellor of the University of the Philippines Diliman, in collaboration with the Office of the Vice Chancellor for Research and Development, for funding support through the PhD Incentive Awards (Project No 111105 PhDIA) given to J. P. Quilang.

References Allen GR. (1998). A review of the marine catfish genus Paraplotosus (Plotosidae) with the description of a new species from North-western Australia. Raffles B Zool 46:123–34. Armbruster J. (2002). Hypancistrus inspector: A new species of suckermouth armored catfishes (Loricariidae: Ancistrinae). Copeia 1: 86–92. April J, Mayden RL, Hanner R, Bernatchez L. (2011). Genetic calibration of species diversity among North America’s freshwater fishes. Proc Natl Acad Sci USA 108:10603–7. Aquilino SV, Tango JM, Fontanilla IKC, Pagulayan RC, Basiao ZU, Ong PS, Quilang JP. (2011). DNA barcoding of the ichthyofauna of Taal Lake, Philippines. Mol Ecol Resour 11:612–19. Aquino LMG, Tango JM, Canoy RC, Fontanilla IKC, Basiao ZU, Ong PS, Quilang JP. (2011). DNA barcoding of fishes of Laguna de Bay, Philippines. Mitochondrial DNA 22:143–53. Ardura A, Linde A, Moreira J, Garcia-Vazquez E. (2010). DNA barcoding for conservation and management of Amazonian commercial fish. Biol Conserv 143:1438–43. Asgharian H, Sahafi HH, Ardalan AA, Shekarriz S, Elahi E. (2011). Cytochrome c oxidase subunit 1 barcode data of fish of the Nayband National Park in the Persian Gulf and analysis using meta-data flag several cryptic species. Mol Ecol Resour 11:461–72. Barbuto M, Galimberti A, Ferri E, Labra M, Malandra R, Galli P, Casiraghi M. (2010). DNA barcoding reveals fraudulent substitutions in shark seafood products: The Italian case of ‘‘palombo’’ (Mustelus spp.). Food Res Int 43:376–81. Bhattacharjee M, Laskar B, Dhar B, Ghosh S. (2012). Identification and re-evaluation of freshwater catfish through DNA barcoding. PLoS One 7:e49950. Cawthorn D-M, Steinman HA, Witthuhn RC. (2012). DNA barcoding reveals a high incidence of fish species misrepresentation and substitution on the South African market. Food Res Int 46:30–40. Chavez JM, Dela Paz RM, Manohar SK, Pagulayan RC, Carandang VI JR, (2006). New Philippine record of South American sailfin catfishes (Pisces: Loricariidae). Zootaxa 1109:57–68. Conlu PV. (1986). Guide to Philippine flora and fauna. Vol. 9. Fishes. Quezon City: Natural Resources Management Center. Costa F, Carvalho G. (2007). The Barcode of Life Initiative: Synopsis and prospective societal impacts of DNA barcoding of fish. Gen Soc Pol 3: 29–40. de Carvalho DC, Oliveira DA, Pompeu PS, Leal CG, Oliveira C, Hanner R. (2011). Deep barcode divergence in Brazilian freshwater fishes: The case of the Sao Francisco River basin. Mitochondrial DNA 1:80–6. Delmendo MN, Bustillo RN. (1968). Studies on fish population of Laguna de Bay. FAO Occas. Pap. 69/12, IFPC/C68/Technical 30. Ferraris C. (1999). Plotosidae. In: Carpenter KE, Niem VH, editors. FAO species identification guides for fishery purposes: The living marine resources of the western central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes. Part 1. (Elopidae to Linophrynidae). Rome: FAO. p 1880–4.

DNA barcoding of Philippine catfishes

9

Ferraris CJ. (2007). Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary types. Zootaxa 1418:1–628. Fowler HW. (1941). Contributions to the biology of the Philippine archipelago and adjacent regions: The fishes of the groups Elasmobranchii, Holocephali, Isospondyli, and Ostariophysi obtained by US Bureau of Fishing Steamer ALBATROSS in 1907 to 1910, chiefly in the Philippine Islands and adjacent seas. Bull US Natl Mus 100:1–879. Froese R, Pauly D, editors. (2013). FishBase. World Wide Web electronic publication. [Online] Available at: www.fishbase.org, version (02/2013) (Accessed on August 2013). Hall T. (1999). Bioedit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid Res 41:95–8. Hebert PDN, Cywinska A, Ball SL, Dewaard JR. (2003). Biological identification through DNA barcodes. Proc R Soc Lond B Biol Sci 270: 313–22. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM. (2004). Identification of birds through DNA barcodes. PloS Biol 2:1657–63. Herre AWCT. (1924). Distribution of the true freshwater fishes in the Philippines. II. Philippine Labyrinthici, Clariidae, and Siluridae. Philipp J Sci 24:683–709. Herre AW. (1926). A summary of the Philippine catfishes, order Nematognathi. Philipp J Sci 31:385–413. Herre AWCT. (1927). The fisheries of Lake Taal (Bombon), Luzon and Lake Naujan (Mindoro). Philipp J Sci 34:287–315. Herre AWCT. (1953). Check list of Philippine fishes. Washington, DC: United States Government Printing Office. Juliano RO, Guerrero III RD, Ronquillo I. (1989). The introduction of exotic aquatic species in the Philippines. In: De Silva SS, editor. Exotic aquatic organisms in Asia. Proceedings of the Workshop on Introduction of Exotic Aquatic Organisms in Asia. Asian Fish. Soc. Spec. Publ. 3. Manila, Philippines: Asian Fisheries Society. p 83–90. Jumawan J, Vallejo B, Herrera A, Buerano C, Fontanilla IK. (2011). DNA barcodes of the suckermouth sailfin catfishes Pterygoplichthys (Siluriformes: Loricariidae) in the Marikina River system, Philippines: Molecular perspective of an invasive alien fish species. Philipp Sci Lett 4:103–13. Kailola P. (1999). Ariidae. In: Carpenter KE, Niem VH, editors. FAO species identification guides for fishery purposes: The living marine resources of the western central Pacific. Vol. 3. Batoid fishes, chimaeras and bony fishes Part 1 (Elopidae to Linophrynidae). Rome: FAO. p 1827–79. Kimura M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16:111–20. Lakra W, Verma M, Goswami M, Lal K, Mohindra V, Punia P, Gopalakrishnan A, et al. (2011). DNA barcoding Indian marine fishes. Mol Ecol Res 11:60–71. Lara A, De Leon JLP, Rodriguez R, Casane D, Cote G, Bernatchez L, Garcia-Machado E. (2009). DNA barcoding of Cuban freshwater fishes: Evidence for cryptic species and taxonomic conflicts. Mol Ecol Res 10:421–30. Marceniuk A, Menezes N. (2007). Systematics of the family Ariidae (Ostariophysi, Siluriformes), with a redefinition of the genera. Zootaxa 1416:1–126. Matillano JD. (2003). The ichthyofauna of Lake Manguao, Taytay, Palawan, with special reference to endemic species. Proceedings of the First National Congress on Philippine Lakes, 25–28 November 2003, Tagaytay City, Philippines. Mercene EC. (1997). Freshwater fishes of the Philippines. In: Guerrero R III, Calpe A, Darvin L, editors. Aquatic Biology Research and Development in the Philippines. Proceedings of the First Nat’l Symposium-Workshop on Aquatic Biology R&D, November 28–29, 1995, Los Ban˜os, Laguna. PCAMRD Bk. Ser. 20. p 81–105. Nelson J. (2006). Fishes of the World. 4th ed. New Jersey, USA: Wiley Inc. Ng HH. (1999). Two new species of catfishes of the genus Clarias from Borneo (Teleostei: Clariidae). Raffles B Zool 47:17–32. Ng H, Kottelat M. (2008). The identity of Clarias batrachus (Linnaeus, 1758), with the designation of a neotype (Teleostei: Clariidae). Zool J Linn Soc-Lond 153:725–32. Palma AL, Mercene EC, Goss MR. (2005). Fish. In: Lasco RD, Espaldon MVO, editors. Ecosystems and People: The Philippine Millenium Ecosystem Assessment (MA) Sub-global Assessment.

Mitochondrial DNA Downloaded from informahealthcare.com by University of Laval on 07/07/14 For personal use only.

10

J. P. Quilang & S. C. S. Yu

Los Ban˜os: Environmental Forestry Programme, College of Forestry and Natural Resources, University of the Philippines. p 115–32. Pansonato-Alves JC, Serrano E, Utsunomia R, Scacchetti P, Oliveira C, Foresti F. (2013). Mapping Eve repetitive DNA classes in sympatric species of Hypostomus (Teleostei: Siluriformes: Loricariidae): Analysis of chromosomal variability. Rev Fish Biol Fisher. doi 10.1007/s11160-013-9303-0. Roberts T, Vidthayanon C. (1991). Systematic revision of the Asian catfishes Family Pangasiidae, with biological observations and descriptions of three new species. Proc Acad Nat Sci Philadelphia 143:97–143. Saitou N, Nei M. (1987). The neighbour-joining method: A new method forreconstructing evolutionary trees. Mol Biol Evol 4:406–25. Santos B, Quilang J. (2011). DNA barcoding of Arius species (Siluriformes: Ariidae) in Laguna de Bay, Philippines using the cytochrome c oxidase subunit I gene. Philipp Agric Sci 94:205–10. Smith PJ, Steinke D, McMillan PJ, Stewart AL, McVeagh SM, Diaz de Astarloa, Welsford D, Ward RD. (2011). DNA barcoding highlights a cryptic species of grenadier Macrourus in the Southern Ocean. J Fish Biol 78:355–65. Staden R, Beal KF, Bonfield JK. (2000). The Staden package, 1988. Methods Mol Biol 132:115–30. Sudarto, Pauyaud L. (2005). Identification key based on morphological characters of the Southeast Asian species of the Genus Clarias (Pisces: Clariidae). J Indonesia 5:39–47. Sudarto, Teugels G, Pouyaud L. (2004). Description of a new clariid catfish, Clarias pseudonieuhofii from West Borneo (Siluriformes: Clariidae). Zool Stud 43:8–19. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum

Mitochondrial DNA, Early Online: 1–10

likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–9. Teugels GG, Diego RC, Pouyaud L, Legendre M. (1999). Redescription of Clarias macrocephalus (Siluriformes: Clariidae) from South-East Asia. Cybium 23:285–95. Vallejo AN. (1985). Fishes of Laguna de Bay. Nat Appl Sci Bull 37: 285–346. Ward RD. (2009). DNA barcode divergence among species and genera of birds and fishes. Mol Ecol Resour 9:1077–85. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert P. (2005). DNA barcoding Australia’s fish species. Phil Trans R Soc London B 360: 1847–57. Ward RD, Holmes BH, Yearsley GK. (2008a). DNA barcoding reveals a likely second species of Asian sea bass (Barramundi) (Lates calcarifer). J Fish Biol 72:458–63. Ward RD, Holmes BH, White WT, Last PR. (2008b). DNA barcoding Australasian chondrichtyans: Results and potential uses in conservation. Mar Freshwater Res 59:57–71. Ward RD, Hanner R, Hebert PDN. (2009). The campaign to DNA barcode all fishes, FISH-BOL. J Fish Biol 74:329–56. Wong H-KE, Hanner RH. (2008). DNA barcoding detects market substitution in North American seafood. Food Res Int 41:828–37. Wong LL, Peatman E, Lu J, Kucuktas H, He S. (2011). DNA barcoding of catfishes: Species authentication and phylogenetic assessment. PLoS One 6:e17812. Wu LW, Liu CC, Lin SM. (2011). Identification of exotic sailfin catfish species (Pterygoplichthys, Loricariidae) in Taiwan based on morphology and mtDNA Sequences. Zool Stud 50:235–46. Zhang J, Hanner R. (2012). Molecular approach to the identification of fish in the South China Sea. PLoS One 7:e30621.