146

Electrophoresis 1991,12, 146-152

S . D. J . Pena et al.

[61 Feinberg,A.P.andVogelstein,B.,Anal.Biochem. 1983,132.6-13. 171 Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor 1982, pp. 269-309. I81 Benton, W. D. and Davis, R. W., Scieizce 1977,196, 180. 191 Stover, C. K., Vodkin, M. H. and Oaks, E. V., Anal. Biochem. 1987, 163,398-407. [ l o ] Riley, L. K., Marshall, M. E. and Coleman, M. S., DNA 1986, 5 , 333-337. [111 Cook, A. F.,Vuocolo, E. and Brakel, C . L., NucleicAcids Res. 1988, 16,4077-4095.

’,

Skrgio D. J. Pena Andrea M. Macedo’ Nelder F. Gontijo’ Arnaldo M. Medeiros’ Julio Cesar C. Ribeiro’ ‘Department of Biochemistry, UniversidadeFederal de Minas Gerais 2Nucleode GenCtica Medica de Minas Gerais (GENE/MG), Belo Horizonte

[121 Jablonski, E., Moomaw, E. W., Tullis, R. H. andRuth, J. L. Nucleic AcidsRes. 1986,14,6115-6128. [131 Agrawal, S., Christodoulou, L. and Gait, M. J., Nucleic Acids Res. 1986,14,6227-6244. [ 141 Wong, Z., Wilson, V., Jeffreys, A. J. and Thein, S. L., Nucleic Acids Res. 1986,14,4605-4616. I151 Wong, Z., Wilson, V., Patel, I., Povey, S . and Jeffreys, A. J., Ann. Hum. Genet. 1987,51,269-288. [161 Pfeifer, G. P., Steigerwald, S . D., Mueller, P. R., Wold,B. and Riggs, A. D., Science 1989,246,810-813.

DNA bioprints: Simple nonisotopic DNA fingerprints with biotinylated probes The discovery of multilocal DNA fingerprinting represented a revolution in criminal identification and paternity testing. However, for routine use in clinical laboratories, the standard DNA fingerprint methodology is too complex. We have been successful in the development of a simplified DNA nonisotopic fingerprinting system using biotin-labeled probes which we have called DNA bioprints. To achieve this we explored three main technical features: utilization of biotinylated nonradioactive probes as a simpler substitute for 32P-labeledprobes, utilization of oligonucleotide probes as a simpler substitute for recombinant probes, and direct hybridization in the dried agarose gel as a simpler substitute for Southern blots. In this article we review our results in the development of DNA bioprints.

1 Introduction

ble of recognizing simultaneously several VNTRs in the human genome. On Southern blots, these “multilocal” proIn 1980 Wyman and White [ 11 described the first multiallelic, bes generated highly complex and individual-specific bandhighly polymorphic human DNA marker. Shortly after- ing patterns that were aptly called “DNA fingerprints” wards, similar hypervariable markers were discovered in the [131. A comparison of the sequences of these multiloregion 5’ to the insulin gene [2], 3‘ to the c-Ha-rasl oncogene cal probes showed that with minor variations, they shared [31 and three others around the a-globin gene cluster [4-71. In a common 11-16 base pair (bp) “core” sequence, 1982, Bell et al. [21 demonstrated that these highly poly- GGAGGTGGGCAGCARG, which proved to also be morphic regions were composed of tandem repetitions of homologous to the consensus repeat sequences of the 5’411short motifs and that their hypervariability was dueto diversi- sulin, 3-c-Ha-ras 1 and a-globin cluster minisatellites [91. Soon ty in the number of reiterations. Because of these structural other multilocal probes were discovered. Probes composed of features, these regions were subsequently called minisatellites 4-5 repeats of variations of the GATA/GACA motif [81, hypervariable regions (HRV) [91 or variable number of simultaneously recognized multiple variable regions in the tandem repeats (VNTR) [ 101. Dozens of these VNTRs have human genome, as demonstrated by Ali et al. 1141, using a been described and mapped in the human genome [lo-121. variety of oligonucleotides. The most informative of these Their total number is not known, but may exceed 1500 [91. oligonucleotide probes proved to be (CAG), [ 15, 161, which hybridizes to GTGGTGGTGGTGGTG, a sequence clearly Jeffreys et al. [81 were the first to show that minisatellite homologous to Jeffreys’ core. Furthermore, in 1987 Vasprobes derived from the human myoglobin gene were capa- sart et al. [171 serendipitously found out that when insertfree M 13 bacteriophages were used as probes, they were Abbreviations:BCIP, 5 -bromo-4-chloro-3-indolylphosphate;bp,basepair; also capable of generating individual-specific DNA fingerHVR, hypervariable region; kb, kilobasefs); MCS, multiple cloning site; prints in Southern blots of human DNA. The hybridizNBT, Nitroblue Tetrazolium; SDS, sodium dodecyl sulfate; SSC, saline- ing region was shown to be the protein Ill gene of the M13 sodium citrate buffer; SSPE, saline-sodiumphosphate-EDTA buffer; TBE, phage, which contained internal repetitions of the motif Tris-borate-EDTA buffer; TE,Tris-EDTA; VNTR, variable number of (GluGlyGlyGlySer), corresponding to the nucleotide setandem repeats quence GAGGGTGGYGGYTCT, which is also homoloCorrespondence: Prof. SCrgio D. J. Pena, Nucleo de Genktica Medica de gous to Jeffrey’s core. From these data emerges a picture of a Minas Gerais (GENE/MG), Caixa Postal 3396,30.112 - Belo Horizonte, multitude of minisatellites spread throughout the human geMG, Brazil nome, forming a network of GC-rich sequences. 0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1991

0173-0835/91/02-302-3-0146 %3.50+.25/0

Electrophoresis 1991,12, 146-152

D N A fingerprints with any ofthese probes proved to be highly reproducible, showed somatic stability, and were inherited in strict Mendelian fashion. Because of these properties and their hypervariability they were applied as revolutionary new tools in criminal identification [ 18, 191 and paternity testing [ 201. However, for routine use in clinical laboratories, the standard DNA fingerprint methodology is too complex. The isotope labeling of the probes with 32Pseverely limits their shelf life, demands specialized equipment and constitutes a low but definite health hazard. We have been successful in the development of a simplified DNA non-isotopic fingerprinting system using biotin-labeled probes, which we have called D N A bioprints. To achieve this we explored three main technical features: utilization of biotinylated nonradioactive probes as a simpler substitute for 32P-labeledprobes [2 1-251, utilization of oligonucleotide probes as a simpler substitute for recombinant probes [24, 251 and direct hybridization in the dried agarose gel as a simpler substitute for Southern blots [24,251. In this article we review our results in the development of D N A bioprints.

2 Material and methods 2.1 DNA Human DNA was extracted from peripheral blood by a modification of the method described by Madisen et al. 1261, as follows: 2 mL of total blood collected in EDTA tubes were transferred to a 15 mL capped tube, and 10 mL of red cell lysis buffer (0.155 M NH,CI/O. 17 M Tris-HC1, pH 7.65) preheated to 37 "C, were added and mixed. After incubating for 5 min at 37 "C the solution was spun at 2000 rpm for 10 min in a tabletop centrifuge. The supernatant was withdrawn and the same steps repeated with 5 mL red cell lysis buffer. To the second pellet were then added 10mL isotonic saline and the white cells were respun. To the final peliet were added 1.5 mL high TrisEDTA (TE) buffer (40m~EDTA/l0Om~Tris-HCl,pH KO), the cells were suspended and 2 mL of white cell lysis solution (0.2 % SDS in high TE, containing I M NaC1) forcefully injected with a syringe through an 18-gauge needle. Then 50 pL of proteinase K stock (20 pg/mL in H 2 0 )were added and the solution was incubated overnight at 37 "C. The following day the mixture was extracted sequentially with 4 mL phenol, saturated with H,O and 4 mL ch1oroform:isoamyl alcohol (24: 1 v/v). Finally 400 pL of 4 M ammonium acetate and 4.4 mL ice-cold isopropyl alcohol were added to precipitate the DNA. The DNA strands were fished with an ultra thin glass rod, air-dried for 3 min and transferred directly to a microcentrifuge tube containing 400 pL low T E (1 mM EDTA/10 mM Tris-HCI, pH 8.0). The D N A was solubilized by incubation for 2 h at 50 OC and kept at 4 "C until use. The D N A was quantified by visual comparison with concentration standards after brief electrophoresis and staining with ethidium bromide t271.

2.2 DNA restriction The restriction enzyme BspRI (an isoschizomer of HaeIII) was obtained from the Fundaqgo Oswaldo Cruz, Rio de Janeiro, Brazil, and was used for all the experiments reported here. For restriction, 10 pg of DNA weredigested overnight at 37 'C with 20 units of the enzyme in 50 mM Tris-HC1,50 mM NaC1, 10 mM MgCI,, pH 7.5. The next morning, another 20

DNA bioprints: Nonisotopic DNA fingerprints

147

units of enzyme were added and the sample further incubated for 2 h at 37 "C. A small aliquot was then removed and electrophoresed in a minigel. Complete digestion was indicated by a typical smear and the presence in males of a sharp band of 3.4 kilobase (kb), which originates from repetitive DNA of the long arm of the human Y chromosome. The DNA was then ethanol-precipitated overnight at -20 "C, dried, and resuspended in low TE. 2.3 Probes

2.3.1 Wild-type and recombinant M 13 phages The wild-type bacteriophage M 13mp8 was obtained from Bethesda Research Laboratories (BRL, Gaithersburg, MD, USA). The 33.15 probe cloned in M 13mp8 [8l was a kind gift from Prof. A. J. Jeffreys, University of Leicester, England. The F10 probe, composed of a 900 bp genomic clone of the gene encoding the major protein of the eggshell of Schistosoma mansoni[281 in theEcoRI siteofM13mp10 was gift from Prof. F. Rumjanek, Universidade Federal do Rio de Janeiro, Brazil. This gene has been shown to recognize multiple hypervariable minisatellites in the human genome [291. The wild-type and recombinant phages were grown in E. coli JMlOl and the single-stranded (ss) forms were obtained by routine methods [27].

2.3.2 Oligonucleotides The following oligonucleotides were synthesized by routine methods by the Oligonucleotide Synthesis Laboratory of Queen's University in Kingston, Canada or by Clontech Laboratories, Palo Alto, CA, USA: (CAC), [ 151, the 24-mer oligonucleotide TGGAGGAGGGCTGGAGGAGGGC based on the core motif of Jeffreys' 33.6 fingerprinting probe 1301 and the 18-mer oligonucleotide (GGCACA), based on the core sequence of the repeat motif of the Drosophila Per gene, which has been shown to recognize a family of hypervariable minisatellites in the human genome [3 11.

2.4 Labeling with biotin 2.4.1 Wild-type and recombinant M 13 phages For nonradioactive hybridization, the whole single-stranded nonrecombinant M13 phage D N A was labeled by the incorporation of biotinyl- 11-dUTP by extension with Klenow polymerase of a M 13 17-mer universal sequencing primer, as described previously by us [21,221. The recombinant 33.15 and F 10 probes, both cloned in M 13, were biotin-labeled by a method described previously by us [231, which is a modification of a technique originally developed by Hu and Messing [321. This synthesis generated probes made up of the singlestranded unlabeled insert attached to a long, double-stranded, heavily biotinylated M 13 "tail" (Fig. 1). This probe was not denatured prior to hybridization. 2.4.2 Oligonucleotides The oligonucleotides were biotin-labeled at the 3' end by the incorporation of biotinyl- 1 1-dUTP by terminal deoxynucleotidyl transferase or at the 5' end by the incorporation of Aminomodifier I1 (Ciontech Inc., Palo Alto, CA) and

148

S. D. J. Pena et a/.

Electrophoresis 1991,12, 146-152

Insert sequence cloned into multiple ctoning site(MC9

(Schleicher and Schuell) or nylon(Genetran 45) membranes in 10 x ssc (1 x ssc : 0.15 M Na citrate, 0.15 M NaC1. pH 7.0). The membranes were baked for 1 hat 80 OC and then exposed for 1 h at 50 “C to a block solution containing 1 % casein (Sigma), 3 %calf skin gelatin (Sigma), 0.05 %Tween 20,0.5 M NaCl and 0.1 M Tris-HCl, pH 7.5. The membrane was then hybridized with the biotinylated probes (200 ng/mL) for 24 h at 42 “C in a solution containing 5 x SSC, 45 % deionized formamide, 10 % dextran sulfate (Pharmacia), 0.1 % sodium dodecyl sulfate (SDS) and 1 x modified Denhardt’s solution containing 0.02 % (respectively) of polyvinylpirrolidone, Ficoll 400 (Pharmacia) and calf skin gelatin. The posthybridization stringency washes included two initial washes of 5 min in 2 x SSC with 0.1 % SDS at room temperature, followed by two washes of 5 rnin in 1 x SSC with 0.1 % SDS at room temperature and a final wash with 1 x SSC and 0.1 % SDS for 30 rnin at 52 OC. The membranes were reblocked for 1 h at room temperature and incubated for 30 min with a streptavidin-alkaline phosphatase conjugate (BRL) diluted 1:1000 in a buffer containing0.1 MTris-HCl(pH 7.5),0.5 MNaCl and 5 % Tween 20. The membrane was :hen washed 4 x min with MTris-HCl(pH 7.5),0.5 MNaClandtwicefor5 minwithO.l M Tris-HC1(pH 9. I), 0.1 M NaC1,5 mM MgCI, (stain buffer) and finally transferred to a solution containing 165 yg/mL of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and SO Fg/mL of Nitroblue Tetrazolium (NBT) in stain buffer. After color development the membrane was rinsed in water, dried, and photographed.

2.5.2 Hybridization in dried agarose gels

*=Biotinylated

nucleotide

Figure 1. Biotin-labeling of probes cloned in M 13. The method is based on the hybridization to M13 of a primer that anneals to the region 5’ to the multiple cloning site of the phage. DNA synthesis is then initiated by Klenow polymerase in the presence of biotinyl-1 1-dUTP. By limiting the concentration of dATP and performing the reaction at low temperature, we can stop the synthesis reaction before it goes all around and theinsert region is reached. In this fashion we generate a probe made up of the single-stranded unlabeled insert attached to a long, double-stranded, heavily biotinylated M13 “tail”.

chemical coupling with N-hydroxysuccinimibiotinester (Biotin-XX-NHS ester; Clontech) followed by removal of unreacted compounds on Sephadex G-25 1331.The final results, obtained with either labeling method, were the same.

2.5 Hybridization 2.5.1 Southern hybridizations These were done by amodification of our previously described methods [2 1,221 as follows. Ten yg of human genomic DNA, digested with 40 units of BspRI as described above, were electrophoresed in a 14 cmlong, 0.7 % agarose gel in TBE (89 mM Tris-borate, 2 mMEDTA, pH 8.0) at 2 V/cm for 26 h until the 2.2 kb Hind111fragment of lambda phage had migrated off the gel. After the run the gel was exposed once to 0.5 M NaOH, 1.5 M NaCl for 30 min, neutralized once in 0.5 MTris-HCl, 1.5 M NaCl (PH 7.5) and transferred overnight onto nitrocellulose

When biotinylated oligonucleotides were used as probes the hybridization was performed directly in the dried agarose gel [24, 251 as follows. Human genomic DNA was prepared, digested and electrophoresed in 0.6 % w/v agarose gels in TBE as described above. The gels were 14 cm long, 10.5 cm wide and 0.6 cm thick. For reasons which are not clear to us, results were not as good with larger gels. After staining with ethidium bromide and photography,the gels were treated once -with 200 mL of denaturation solution (0.5 M NaOH, 1.5 M NaC1) for 30 rnin and once with 200 mL of neutralization buffer (0.5 M Tris-HC1, pH 7.5, with 2.5 M NaCl), also for 30 min, and then dried under vacuum in a Bio-Rad Model 224 slab gel dryer for 60 min at room temperature, followed by 30 min at 60 OC. Although the agarose gels dry easily, a strong vacuum was found to be essential for success of the overall procedure. The dried gel was hybridized with the probe(200 ng/mL in 5 x SSPE, containing 5 x Denhardt’s solution and 0.5 % w/v SDS 1 x SSPE:O.l8MNaCl, 1 0 m ~ N a H , P 0 , ,1 mMEDTA, pH 8.0, at 42 OC overnight, washed three times in 6 x SSC with 0.1 % w/v SDS at room temperature and given a stringency wash in the same buffer for 1 rnin at 42 “C, for the (CAC)Sor Per probes, or 50 OC for the 33.6 oligonucleotide probe. No prehybridization or carrier DNA was necessary. The dried gels were then washed once in 6 x SSC with 1 % w/v Triton X-l00,oncein6 x SSC,oncewithO.l ~Tris-HC1.0.5MNaC1, pH 7.5 (wash buffer) and incubated for at least 48 h with a streptavidin-alkaline phosphatase conjugate (BRL) diluted 1:1000 in wash buffer. Shorter periods of incubation yielded weaker hybridization signals. The gels were then washed at least 8 times with agitation for 30 rnin in the same buffer, washed once in stain buffer (0.1 M Tris-HC1, pH 9.1, 0.1 M NaCI, 5 mM MgCl,) and developed overnight in BCIPINBT as described above.

149

DNA bioprints: Nonisotopic DNA fingerprints

Electrophoresis 1991,12, 146-152

3 Results and discussion 3.1 Southern hybridizations 3.1.1 Application of the streptavidin-biotinsystem Two problems appear when biotin labeling is substituted for 32Plabeling in Southern blots: higher background and lower sensitivity. To control the background, Dykes et al. [34] developed an efficient membrane blocking solution based on 1 % casein and 3 % fish skin gelatin. However, the fish skin gelatin is not an easily available reagent and we have found that calf skin gelatin (Sigma # G-9382) is an effective substitute. As a second reagent we have used either a covalent streptavidin-alkaline phosphatase conjugate (BRL) or a noncovalent streptavidin-biotinyl alkaline phosphatase conjugate (Enzo Biochem), both with good results. The Enzo Biochem conjugate generally yields a lower background, but also a weaker signal, than the BRL conjugate. Now we routinely use the latter. We have also had good results with both nitrocellulose and nylon membranes. The background is lower with nitrocellulose membranes, but because of their mechanical stability and higher reproducibility we now prefer to use nylon membranes. We have tried several brands of nylon and can obtain good results with practically all of them. The sensitivity problem ofthe biotin methodology is related intrinsically to the color detection method, but is also influenced by probe characteristics, such as low label density and interference of the biotinyl group with hybridization. For instance, we could not get sufficient sensitivity with biotin labeling by either nick translation or random primers. Thus we had to develop special labeling strategies based on primer extension, which are described below. When using the protein 111 gene of M 13 as a probe we have used relatively low stringency (45 % formamide and 42 “C)during hybridization to try to compensate for the interference of the biotinyl group. However, our procedure for labeling probes cloned in M 13 (see below) completely overcomes this problem because the hybridizing region is not itself biotinylated.

3.1.2 MI3 as a fingerprinting probe For DNA fingerprinting with the protein I11 gene of M13 phage we used the incorporation of biotinyl- 1 1-dUTP by simple extension with Klenow polymerase of a primer which hybridizes 3’ to the multiple cloning region (MCS) of M13. In this fashion we achieved synthesis of a heavily biotinylated probe made up of theentire (-) strand of the phage. Hybridization with this probe permitted excellent visualization and good resolution of D N A fingerprints in Southern blots of human genomic D N A digested with BspRI (Fig. 2). An example of Mendelian inheritance of the bands can be seen in the fingerprings of a mother and son (Fig. 2, lanes 1 and 2) while somatic stability is demonstrated by the identical D N A fingerprints of monozygous twins (Fig. 2, lanes 3 and 4). As reported previously [221 the degree of polymorphism of the M13 bioprings, measured by the number of bands and the degree of band sharing, is comparable to that of Jeffreys’ probes [91. However, there is an advantage in the use of M 13 as a probe for D N A fingerprinting because of its wide availability, which brings the procedure within reach of most molecular biology laboratories. On the other band, the quality of results with M I 3 is not always good, depending on the batch of the phage and on day-to-day fluctuations, or for other reasons not yet

1

2

3

4

Figure 2. M 13 bioprints. Nonisotopic DNA fingerprints of a mother-child duo (lanes 1 and 2) and two unrelated monozygous twins (lanes 3 and4)obtained by hybridization with the M13 phage labeled with biotin. Thegenetic relationship between the individuals is shown in the pedigree above. The arrows indicate the migration of the Hind111digestion fragments of lambda phage,withmolecularsizes,fromtoptobottom:23.1,9.4,6.6and4.4kb.

clear to us. Because of this, we do not use M 13 as a first probe in routine paternity cases, reserving it for situations in which data from several probes is needed.

3.1.3 Fingerprinting probes cloned in M13 3.1.3.1 Use of Jeffreys’s 33.15 probe The recombinant 33.15, cloned in M13, was biotin-labeled by our nonisotopic adaption [ 231 of alabeling strategy originally developed by Hu and Messing [32]. The strategy (Fig. 1) is based on the hybridization to M 13 of a 17-mer oligonucleotide primer (called “probe primer”) that anneals with the region 5‘ to the multiple cloning site of the phage. D N A synthesis is then initiated by Klenow polymerase in the presence ofbiotinyl- 1 1dUTP, and the vector, rather than the template, is copied. By limiting the concentration of dATP and performing the reaction at low temperature, we can reliably stop the synthesis reaction before it goes all around and reaches the insert region

150

Electrophoresis 1991, 12, 146-152

~.~.~.penaetnl.

(Fig. 1). In this fashion we generate a probe made up of the single-stranded unlabeled insert attached to a long, doublestranded, heavily biotinylated M 13 “tail”. This probe presents three useful features: (i) high efficiency of hybridization because the insert region is single-stranded and does not contain biotinyl groups; (ii) good sensitivity because there are a great number of biotinyl groups in the “tail” region of the probe; (iii) no need to purify the labeled insert, because most of the M 13, including the potentially hybridizing protein I11 gene, remains double-stranded and thus does not bind to the target human sequences or to the membrane support. Thus we can obtain excellent D N A fingerprints with a good signal-tonoise ratio (Fig. 3). The same methodology was applied to another fingerprinting probe, F 10, discovered in our laboratory.

1 2 3 4 5 Figure 3. 33.15 bioprints. Nonisotopic D N A fingerprints of two motherchild-father trios, lanes (1),(2), (3) and (4), (5), (6),respectively,obtained by hybridization with the 33.15 probe labeled with biotin. The genetic relationship between the individuals is shown in the pedigree above. The arrows indicate the migration of the HindIII digestion fragments of lambda phage,withmolecularsizes,fromtoptobottom:23.1,9.4,6.6and4.4 kb.

3.1.3.2 Use of the F10 probe

F10, the gene encoding the major eggshell protein of the parasitic trematode Schistosoma mansoni has recently been cloned and sequenced [28]. The nucleotide sequence predicted a protein with 160 aminoacids and a 48.7 % content of glycine. Most of the glycines are in a stretch extending from amino acid 25 to 112, corresponding to nucleotides 329-593 in the gene sequence. We aligned this stretch trying to maximize its internal homology and were able to deduct a 12 bp consensus repeat motif TATGGTGGTGGT. This motif was clearly homologous to the CHI (Crossover Hostspot Instigator - GGCGGTGG) sequence ofEscherichia coli, to the consensus sequences of Jeffrey? fingerprinting probes l8.91

1 2 3 4 5 6 7 Figure 4 . F10 bioprints. Nonisotopic DNA fingerprints of three motherchildduos,lanes(l)and(2),(5)and(4),(6)and(7),respectively,obtainedby hybridization with the F 10genelabeled with biotin. The genetic relationship between the individuals is shown in the pedigree above. Note that the individual in lane (3) is the biological father ofthe threechildren(1anes 2,4 and 7). The arrows indicate the migration of the HindIII digestion fragments of lambda phage, with molecular sizes, from top to bottom; 23.1,9.4,6.6 and 4.4 kb.

Electrophoresis 1991,12, 146-152

and to the repeat of the M 13 protein I11 gene L 171. On this basis, we predicted that F 10 should also be able to recognize a family of minisatellites in the human genome. Indeed, as predicted, F 10, cloned in M 13mp 10 and biotin-labeled as described above, hybridized to human genomic D N A digested with BspRI, and generated a complex and highly variable D N A fingerprinting pattern [29]. Figure 4 illustrates the F 10 bioprints of an interesting paternity case in which one individual was shown to be the father ofthree children by three different woman. Analysis of these individuals and over 50 other unrelated persons showed an average of 2 1.5 resolvable bands above 4 kb per individual, with a 22 O/o overall band sharing (unpublished observations). Thus, F 10 is an informative multilocal probe, and its efficiency in paternity testingiscomparabletoJeffreys’33.6 and33.15 probes [8,9]. 3.2 Hybridization in dried’agarose gels 3.2.1 The (CAC), oligonucleotide

Epplen’s group showed that the oligonucleotide (CAC), is a highly informative probe for D N A fingerprinting [ 15,

DNA bioprints: Nonisotopic DNA fingerprints

15 1

161. Even though (CAC), has been mostly discussed in the context of GATA/GACA simple quadruplet repeats [ 15, 16, 351 it is relevant to point out that it hybridizes to GTGGTGGTGGTGGTG, a sequence which is clearly homologous to the other CHI-related fingerprinting probes already discussed above. This demonstration that oligonucleotide probes can be used for D N A fingerprinting had great appeal to us for two reasons. In the first place, probe preparation becomes much simpler. Instead of the the timeconsuming procedures of bacterial cultures and preparation of M13 DNA, one can obtain milligram quantities of the desired probe by chemical synthesis. In the second place, we knew that oligonucleotide probes were being used for direct hybridization in the dried agarose gel [36], a technique that is much simpler than Southern blotting, because it does not require transferring the D N A to membranes. We decided to try the procodure with biotinylated (CAC),. We anticipated that the most serious problem would be the penetration of the very large streptavidin-alkaline phosphatase conjugates into the dried gel matrix. However, after adjusting the conditions, and allowing a long time for penetration of the conjugates (a minimum of 48 h), we could obtain excellent results with the biotinyl-(CAC), probe (Fig. 5). As reported by Epplen’s group, who, by the way, independently also developed conditions for direct nonisotopic hybridization in dried agarose gels [371 using digoxigenin-labeled (CAC),, the D N A fingerprints obtained are also comparable in informative power to those obtained with Jeffreys’ probes [15,371. 3.2.2 Other oligonucleotide probes The hybridization of biotinyl-(CAC), in dried agarose gels proved to be so simple, reproducible, and reliable that it became our method of choice for routinely producing D N A fingerprints in the laboratory. This encouraged us to try two

1 2 3 4 5 Figure 5. (CAC), bioprints. Nonisotopic DNA fingerprints of a fatherchild-mother trio, lanes (l), (2), (3), and a mother-child-pair, lanes (4) and (5), obtained by direct hybridization in dried agarose gel with the (CAC), oligonucleotide labeled with biotin. The genetic relationship between the individuals is shown in the pedigree above. The arrowsindicate the migration of the Hind111 digestion fragments of lambda phage, with molecular sizes, from top to bottom: 23.1,9.4, 6.6 and 4.4 kb.

A B C Figureb. Direct hybridization in dried agarose gel ofthe same human DNA with three different oligonucleotide probes all labeled with biotin :33.6 (A), (CAC), (B), and Per (C). The stringent wash temperature was 42 OC for (CAC), and Per, and 50 “C for 33.6.

152

Electrophoresis 1991, 12, 146-152

S. D.J. Penaet al.

other oligonucleotide probes for hypervariable minisatellites: a 24-mer oligonucleotide based on the repeat motif ofJeffreys’ 33.6 probe [301 and an 18-mer oligonucleotide based on the repeat motif ofthe Per gene of Drosophila, which has also been shown to recognize a family of minisatellites in humans [3 11. With both probes we could obtain DNA fingerprints, although not with the same excellent signal-to-noise ratio of (CAC)S. However, when we examined D N A from the same person with the three different oligonucleotide probes, we were surprised to find that, with minor variations, the same pattern of bands emerged (Fig. 6). The known CHI-related probes, such as Jeffreys’ 33.6 and 33.15, the protein I11 gene of M 13, the 3’-a-HVR, andF 10, recognize different families of hypervariable minisatellites with little overlap. The specificity of these probes probably comes from the particular sequence of their core motif, but also from the specific number and spacing of the tandem repeats [91. When we use small oligonucleotide probes for D N A fingerprinting, these latter elements of specificity are apparently lost. Since we use conditions of low stringency, sequence variations are also attenuated. The final result is the observed common pattern of bands. We were surprised to see that the Per repeat, which is not generally considered to be CHI-related [35J, also recognized the same basic pattern as the CHI-related 33.6 repeat and (CAC),. It should thus probably be grouped together with these.

4 Concluding remarks Our results show that with the DNA biopring methodology it is possible, without any loss in the quality of results, to obtain a considerable simplification of the D N A fingerprinting procedure, adapting it for use in clinical laboratories. The first level of simplification was the substitution of biotin for 32Pas label. Biotin is safer to use than radioactive labels and the detection method with streptavidin-alkaline phosphatase is easy and does not demand specialized equipment. Furthermore, biotin-labeled probes are reusable and known to be stable for years. We have used the same hybridization solution as many as fifteen times. The second level of simplification resulted from the use of oligonucleotide probes and, in particular, of nonradioactive direct hybridization in dried agarose gels. This reduced the efforts needed for obtaining a probe, dispensed with prehybridization and transfer to membranes, and permitted the use of a simpler and less expensive hybridization solution because dextran sulfate and formamide are no longer needed.TheDNA bioprint procedures described in this article are being used routinely for paternity determination in Brazil with excellent results. We have not applied them yet to forensic analyses and criminal identification because undoubtedly the sensitivity of non-isotopic procedures is much smaller than with the use of 32P. However, with the discovery of newer chemiluminescent substrates for alkaline phospatase, sensitivities, close to those of radioactive procedures have been claimed [38]. If these claims are upheld, D N A bioprints may prove to be as useful in forensic cases as they have been in paternity testing. This work was supported by grants-in-aidfrom the Conselho Nucional de Pesquisas (CNPe) andthe Fundupio deAmpuro 2 Pesquisa de Minus Gerais (FAPEMIG). Received July 4, 1990

5 References 111 Wyman, A. and White, R., Proc. Nut. Acad. Sci. USA 1980, 77, 6754-6758. 121 Bell,G.I.,Selby,M.J. andRutter,W.J.,Nature 1982,295,3 1-35. 131 Capon, D. J., Chen, E. Y., Levinson, A. D., Seeburg, P. H. and Goed del, D. V., Nature 1983,302, 33-37. [41 Higgs, D. R., Goodbourn, S . E. Y., Wainscoat, J. S . , Clegg, J. B. and Weatherall, D. J., Nucleic Acids Res. 1981, 9, 4213-4224. I51 Proudfoot, N. J .,Gil, A. and Maniatis, T., Cell 1982,31,55 3-563. 161 Goodbourn, S. E. Y., Higgs, D. R., Clegg, J. B. and Weatherall, D. J., Proc. Nut. Acad. Sci. USA 1983,80, 5022-5026. [71 Jarman, A. P., Nicholls, R. D., Weatherall, D. J., Clegg, J. B. and Higgs, D. R., E M B O J 1986,5,1857-1863. 18 I Jeffreys, A. J., Wilson, V. andThein, S . L., Nature 1985,314,67-73. [91 Jeffreys, A. J.,Biochem. Soc. Trans. 1987,15,309-317. 1101 Nakamura, Y., Leppert, M., O’Connell, P., Wolff, R., Holm, T.,

[ I 11 [121

[ 131

I141

Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E. and White, R., Science 1987,235, 1616-1622. Nakamura, Y., Carlson, M., Krapcho, K., Kanamori, M. and White, R.,Am.J. Hum. Genet. 1988,43,854-859. Kidd, K. K., Bowcock, A. M., Schmitdtke, J., Track, R. K., Ricciuti, F., Hutchings, G., Bale, A., Pearson, P. and Willard, H. F., Cytogenet. Cell Genet. 1989,51, 622-947. Jeffreys, A. J., Wilson,V. andThein,S.L., Nature 1985,316,76-79. Ali, S., Muller, C. R. and Epplen, J. T., Hum. Genet. 1986, 74,

239-243. [15] Schafer, R., Zischler, H. and Epplen, J. T., NucleicAcids Res. 1988, 16, 5 196. [I61 Nurnberg, P., Roewer, L., Neitzel, H., Sperling, K., Popperl, A., Hundrieser, J., Poche, H., Epplen, C., Zischler, H. and Epplen, J. T., Hum. Genet. 1989,84,75-78. [171 Vassart, G., Georges, M., Monsieur, R., Brocas, H., Lequarre, A. S . and Christophe, D., Science, 1987, 235, 683-684. 1181 Gill,P.,Jeffreys, A.J. and Werrett,D.J.,Nature 1985,318,577-579. [191 Cawood,A. H., Clin. Chem. 1989,35, 1832-1837. I201 Helminen, P.,Ehnholm,C.,Lokki,M.-L.,Jeffreys,A. J. and Peltonen, K., Lancet 1978, i, 574-576. [211 Medeiros,A. C.,Macedo,A.M. andPena,S.D.J.,NucleicAcidsRes. 1988,16, 10394. 1221 Medeiros, A. C., Macedo, A. M. and Pena, S . D. J., Forens. Sci. Intern. 1989,4, 275-280. I231 Macedo,A.M.,Medeiros,A. C. andPena,S.D.J.,NucleicAcidsRes. 1989,16,4414. [24] Gontijo, N., Ribeiro, J. C. and Pena, S . D. J., Trends Genet. 1990,3, 6. [251 Gontijo,N., Ribeiro,J. C. andPena, S . D. J.,Focus 1990,12,55-57. [261 Madisen, L., Hoar, D. I., Holroyd, C. D., Crisp, M. and Hodes, J. E., A m . J. Med. Genet. 1987,27,379-390. [271 Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning:

A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Habor 1989. 1281 Rodrigues, V., Chaudhri, M., Knight, M., Meadows, H., Chambers, A. E., Taylor, W. R., Kelly, C. and Simpson, A. J. G., Mol. Biochern. Parasitol 1989,32, 7-14. 1291 Pena, S. D. J., Macedo, A. M.,Braga, V. M. M., Rumjanek, F. D. and Simpson, A. G. J., Nucleic Acids Res. 1990,17, in press. 1301 Edman, J. C., Evans-Holm, M. E., Marich, J. E. and Ruth, J. L., Nucleic Acids Res. 1988,16, 6235. [3 11 Georges, M., Cochaux, P., Lequarre, P., Young, M. W. and Vassart, G., Nucleic Acids Res. 1987, I S , 7193. [321 Hu, N. T. and Messing, J., Gene, 1982,17,271-277. [331 Agrawal, S., Christodoulou, C. and Gait, M., Nucleic Acids Res. 1986,14,6227-6245. 1341 Dykes, D., Fondell, J., Watkins, P. and Polesky, H., Electrophoresis 1986, 7,278-282. 1351 Dover, G. A., Nature 1989,342, 347-348. [361 Miyada, C. G. and Wallace, R. B., Methods Enzymol. 1987, 125, 94-107. [371 Zischler, H., Schafer, R. and Epplen, J. T., Nucleic Acids Res. 1989; 14,4411. [38] Carlson, D. P., Superko, C., Mackey, J., Gaskill, M. E. and Hansen, P., FOCUS1990,12, 9-12.

DNA bioprints: simple nonisotopic DNA fingerprints with biotinylated probes.

The discovery of multilocal DNA fingerprinting represented a revolution in criminal identification and paternity testing. However, for routine use in ...
861KB Sizes 0 Downloads 0 Views