S. Dooley, C. Welter and N. Blin
EIectrophorrr.! 1992, 13, 333-334
333
Short communications Steven Dooley Cornelius Welter Nikolaus Blin Institute of Human Genetics, University of the Saar, Homburg
DNA-protein interaction analysis using polyacrylamide gel electrophoresis and a simple and sensitive UV crosslinking procedure A simple and reproducible technique for DNA-protein interaction analysis is described using UV crosslinking and polyacrylamide gel electrophoresis, leading to visualization of the complexes as distinct and strong signals. It avoids incorporation of bromodeoxyuridine (BrdU) into DNA and requires no special equipment. It was successfullyapplied to an oligonucleotide sequence from within the first intron of the mouse myb proto-oncogene and nuclear extracts from a myb-expressing cell line.
Sequence-specific DNA-binding proteins form a vital link between cis regulatory elements, present in promoter and enhancer sequences, and the general transcription machinery. The existence of such site-specific DNA-protein interactions has been demonstrated by several approaches. A limitation of most of these techniques is that, despite identifying the binding site within the DNA, they do not characterize the specific proteins involved. Information about their nature can be obtained only after extensive purification procedures. Two principle methods exist that allow molecular weight determination of DNA-binding proteins in crude nuclear extracts. The Southwestern analysis uses protein gel electrophoresis and Western blotting with subsequent incubation of the membrane to a labeled oligonucleotide that binds to the target protein factor [l].Irradiation of protein-nucleic acid complexes with ultraviolet (UV) light causes covalent bonds to form between the nucleic acid and amino acids that are in close contact with this nucleic acid (for review see [2]). Thus, when labeled DNA fragments are incubated with a protein mixture, the molecular weight of a sequence-specific binding protein in a formed complex can be rapidly and reliably determined using UV crosslinking and subsequent gel electrophoresis. Here, we wish to desribe a simplification of existing UVcrosslinking protocols that gives a reproducible and good signal-to-noise ratio, often a problem in most protocols. To enhance the DNA’s photosensitivity, 5-bromodeoxyuridine (BrdU) is incorporated in most cases [3,4].This procedure has two disadvantages. First, BrdU is a hazardous mutagen and therefore dangerous to handle and second, BrdU can interfere with DNA binding when short oligonucleotide sequences are used. The method described here can be divided into three stages: (i) Incubation of the extract containing the protein of interest with a short [32P]dNTP-labeled oligonucleotide that contains a high affinity binding site for this protein. Labeling the oligonucleotide is exactly as previously described [5]: lo5 cpm (Cerenkov) are incubated for 15 min at room Correspondence: Dr. S. Dooley, Institute of Human Genetics, University of the Saar, W-6650 Homburg, Germany Abbreviations: BrdU, 5-bromodeoxyuridine; dNTP, deoxyribonucleotide triphosphate; PAGE, polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulfate
0VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1992
temperature in 10 mM N-(2-hydroxymethyl) piperazine-N‘(2-ethanesulfonic acid (Hepes)-NaOH, pH 8.0; 1 mM spermidine; 5 mM MgC1,; 50 mM KC1; 0.5 mM dithiothreitol (DTT); 1 pg poly(d1-dC); 8.6% glycerol; with 10 -20 pg nuclear extract in a total volume of 15 ILL. (ii) Crosslinking of bound protein to DNA probe. For this procedure we use the “Stratalinker 2400” (Stratagene), which is commonly applied for crosslinking of DNA or 1
2
3
4
5
---- 96kd Cn
-
Cm
-
----46kd
----30kd
----21.5kd
Figure I . SDS-PAGE of complexes between an oligonucleotide sequence from the transcriptional pause region within the first intron ofthe mouse c-myb oncogene (5’CCGGATGATTAATTTCGACCGGTC3’) and specific binding proteins.The molecular weight of the factor is determined by UV crosslinking as indicated in the text. The free oligonucleotide is cut off from the gel. (1) Control 1 (oligonucleotide without protein); ( 2 ) 30 min cross-linking time; ( 3 ) 1 h crosslinking time; (4) control 2 (protein incubation assay, not cross-linked); (5) ‘‘C-labeled marker. C, complex; C,, unspecific complex (increasing the amount of poly(d1dC) which is used for competing unspecific binding will specifically decrease this signal); C,, main complex, 46 kd. 0173-0835/92/0505-0333 $3.50+.25/0
334
P. Aud) and A . Asselin
Electrophoresis 1992, 13, 334-337
RNA onto nylon sheets for Southern or Northern hybridization. Using the 254 nm UV light (NIS 8W GL-8 installed in the Stratalinker) instead of the commonly used 3 12 nm bulbs avoids the necessity of using BrdU in crosslinking. A piece of Parafilm is placed onto an ice bag and the DNAprotein mixture is added on top as a single drop. This assembly is carefully placed into the “Stratalinker”, leaving a distance of about 5 cm to the UV bulbs.Titration of the irradiation energy, required for complex formation, is routinely performed to minimize DNA degradation. Best results with ourprobes are obtained after exposure for 30 min (120000 pJ/cm2 X 30 s).
8 - 12% polyacrylamide gels according to Ausubel et al. [6]. As size markers, we use a I4C-labeled protein mixture (Amersham). After electrophoresis the gel is fixed in 10% methanol, 10% acetic acid for 1 h, dried and exposed overnight at -80” C using intensifying screens. Cutting off the unbound DNA (front, height of dye marker) from the gel before exposing will reduce signal noise.
(iii) Determination of the molecular weight of the crosslinked proteins in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by autoradiography. The short oligonucleotides (20 - 30 bp) require no digestion with nucleases prior to electrophoresis because their contribution to the electrophoretic mobility of the complex is quite negligible (the free probe migrates in this gel system with the Bromophenol Blue front). Transfer the drop (after irradiation) into a reaction tube, add 2 WLof 10 X SDS probe buffer (125 mM Tris-HC1, pH 6.8; 10% 6-mercaptoethanol; 0.05% Bromophenol Blue; 10% SDS) and 2 pL 86% gjycerol, boil for 5 min and separate in
References
Patrice Audy Main Asselin DCpartment de phytologie FacultC des sciences de l’agriculture et de I’alimentation UniversitC Laval, QuCbec
Supported in part by a DFG grant (B1166/3-3). Received December 3. 1991
111 Dooley, S., Radtke, J., Blin, N. and Unteregger, G., NucleicAcids Res. 1988, 16, 11893. [2] Markowitz, A., Biochem. Biophys. Acta 1972, 281, 522-534. [3] Chodosh, L. A., Carthew, R. W. and Sharp, P. A., Mol. Cell. Biol. 1986, 6, 4723-4733. [4] Lynn, S. Y. and Riggs, A. D., Proc. Natl. Acad. USA 1974,71,947-951. [5] Dooley, S., Welter C., Theisinger, B. and Blin, N. Genet. Anal. Techn. Appl. 1990, 7, 133-137. [6] Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidmann, J. G . , Smith, F. A. and Struhl, K., Current Protocols i n MolecularBiology 1987.
Gel electrophoretic analysis of chitosan hydrolysis products Enzymatic hydrolysis of commercial crustacean chitosan by barley chitosanases was analyzed by subjecting chitosan to electrophoresis in a 10% w/v polyacrylamide slab gel in the presence of 7 M urea and 5.5 O/o v/v acetic acid. Chitosan migrated as a polycation. Chitosan was stained with Coomassie Brilliant Blue R-250 or visualized by ultraviolet transillumination after staining with Calcofluor White M2R. Some chitosan molecules were retarded by gel electrophoresis while small chitosan molecules migrated at the bottom of a 10 O/o w/vpolyacrylamide gel. Such analysis revealed that 96 h were necessary to convert all chitosan to oligosaccharides under our assay conditions. Chitosan oligosaccharides generated by enzymatic or chemical hydrolysis were further analyzed by electrophoresis in a 33 Yo w/v polyacrylamide gel containing urea and acetic acid. Coomassie Brilliant Blue R-250 was found to be better than CalcofluorWhite M2Rfor staining chitosan oligosaccharides. Chitosan oligomers of four residues (tetramers) or more were easily resolved in such a polyacrylamide gel system.To our knowledge, this is the first report of a gel electrophoretic separation of chitosan and its oligosaccharides.
Chitin is the most abundant aminopolysaccharide in nature [l]. It is an unbranched polymer of P-1,4-linked anhydro-2-acetamido-~-glucosefound in fungi [2], insects [3] and some marine invertebrates [4]. Chitosan consists of ~~
Correspondence: Dr. A. Asselin, Departement de phytologie, F.S.A.A., Universite Laval, Quebec, Canada G1K 7P4
Abbreviations: PAGE, polyacrylamide gel electrophoresis; TLC, thinlayer chromatography
‘0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1992
N-deacetylated derivatives of chitin. In nature, chitosan is prevalent in the walls of some fungi [2]. Chitosan is also commercially produced by chemical deacelylation of crustacean chitin [5]. Chitosan is a cationic polyelectrolyte with several applications in the fields of food science [6], medicine [7,8] and process biochemistry [9,10]. Moreover, chitosan can induce various defense reactions in higher plants [ll-151 and some chitosan derivatives can exhibit antimicrobial properties [ 161. Chitosan can be chemically or enzymatically degraded into chitosan oligosaccharides. Such oli0173-0835/92/0505-0334 $3.50+.25/0
EIectrophorrr.! 1992, 13, 333-334
333
Short communications Steven Dooley Cornelius Welter Nikolaus Blin Institute of Human Genetics, University of the Saar, Homburg
DNA-protein interaction analysis using polyacrylamide gel electrophoresis and a simple and sensitive UV crosslinking procedure A simple and reproducible technique for DNA-protein interaction analysis is described using UV crosslinking and polyacrylamide gel electrophoresis, leading to visualization of the complexes as distinct and strong signals. It avoids incorporation of bromodeoxyuridine (BrdU) into DNA and requires no special equipment. It was successfullyapplied to an oligonucleotide sequence from within the first intron of the mouse myb proto-oncogene and nuclear extracts from a myb-expressing cell line.
Sequence-specific DNA-binding proteins form a vital link between cis regulatory elements, present in promoter and enhancer sequences, and the general transcription machinery. The existence of such site-specific DNA-protein interactions has been demonstrated by several approaches. A limitation of most of these techniques is that, despite identifying the binding site within the DNA, they do not characterize the specific proteins involved. Information about their nature can be obtained only after extensive purification procedures. Two principle methods exist that allow molecular weight determination of DNA-binding proteins in crude nuclear extracts. The Southwestern analysis uses protein gel electrophoresis and Western blotting with subsequent incubation of the membrane to a labeled oligonucleotide that binds to the target protein factor [l].Irradiation of protein-nucleic acid complexes with ultraviolet (UV) light causes covalent bonds to form between the nucleic acid and amino acids that are in close contact with this nucleic acid (for review see [2]). Thus, when labeled DNA fragments are incubated with a protein mixture, the molecular weight of a sequence-specific binding protein in a formed complex can be rapidly and reliably determined using UV crosslinking and subsequent gel electrophoresis. Here, we wish to desribe a simplification of existing UVcrosslinking protocols that gives a reproducible and good signal-to-noise ratio, often a problem in most protocols. To enhance the DNA’s photosensitivity, 5-bromodeoxyuridine (BrdU) is incorporated in most cases [3,4].This procedure has two disadvantages. First, BrdU is a hazardous mutagen and therefore dangerous to handle and second, BrdU can interfere with DNA binding when short oligonucleotide sequences are used. The method described here can be divided into three stages: (i) Incubation of the extract containing the protein of interest with a short [32P]dNTP-labeled oligonucleotide that contains a high affinity binding site for this protein. Labeling the oligonucleotide is exactly as previously described [5]: lo5 cpm (Cerenkov) are incubated for 15 min at room Correspondence: Dr. S. Dooley, Institute of Human Genetics, University of the Saar, W-6650 Homburg, Germany Abbreviations: BrdU, 5-bromodeoxyuridine; dNTP, deoxyribonucleotide triphosphate; PAGE, polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulfate
0VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1992
temperature in 10 mM N-(2-hydroxymethyl) piperazine-N‘(2-ethanesulfonic acid (Hepes)-NaOH, pH 8.0; 1 mM spermidine; 5 mM MgC1,; 50 mM KC1; 0.5 mM dithiothreitol (DTT); 1 pg poly(d1-dC); 8.6% glycerol; with 10 -20 pg nuclear extract in a total volume of 15 ILL. (ii) Crosslinking of bound protein to DNA probe. For this procedure we use the “Stratalinker 2400” (Stratagene), which is commonly applied for crosslinking of DNA or 1
2
3
4
5
---- 96kd Cn
-
Cm
-
----46kd
----30kd
----21.5kd
Figure I . SDS-PAGE of complexes between an oligonucleotide sequence from the transcriptional pause region within the first intron ofthe mouse c-myb oncogene (5’CCGGATGATTAATTTCGACCGGTC3’) and specific binding proteins.The molecular weight of the factor is determined by UV crosslinking as indicated in the text. The free oligonucleotide is cut off from the gel. (1) Control 1 (oligonucleotide without protein); ( 2 ) 30 min cross-linking time; ( 3 ) 1 h crosslinking time; (4) control 2 (protein incubation assay, not cross-linked); (5) ‘‘C-labeled marker. C, complex; C,, unspecific complex (increasing the amount of poly(d1dC) which is used for competing unspecific binding will specifically decrease this signal); C,, main complex, 46 kd. 0173-0835/92/0505-0333 $3.50+.25/0
334
P. Aud) and A . Asselin
Electrophoresis 1992, 13, 334-337
RNA onto nylon sheets for Southern or Northern hybridization. Using the 254 nm UV light (NIS 8W GL-8 installed in the Stratalinker) instead of the commonly used 3 12 nm bulbs avoids the necessity of using BrdU in crosslinking. A piece of Parafilm is placed onto an ice bag and the DNAprotein mixture is added on top as a single drop. This assembly is carefully placed into the “Stratalinker”, leaving a distance of about 5 cm to the UV bulbs.Titration of the irradiation energy, required for complex formation, is routinely performed to minimize DNA degradation. Best results with ourprobes are obtained after exposure for 30 min (120000 pJ/cm2 X 30 s).
8 - 12% polyacrylamide gels according to Ausubel et al. [6]. As size markers, we use a I4C-labeled protein mixture (Amersham). After electrophoresis the gel is fixed in 10% methanol, 10% acetic acid for 1 h, dried and exposed overnight at -80” C using intensifying screens. Cutting off the unbound DNA (front, height of dye marker) from the gel before exposing will reduce signal noise.
(iii) Determination of the molecular weight of the crosslinked proteins in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by autoradiography. The short oligonucleotides (20 - 30 bp) require no digestion with nucleases prior to electrophoresis because their contribution to the electrophoretic mobility of the complex is quite negligible (the free probe migrates in this gel system with the Bromophenol Blue front). Transfer the drop (after irradiation) into a reaction tube, add 2 WLof 10 X SDS probe buffer (125 mM Tris-HC1, pH 6.8; 10% 6-mercaptoethanol; 0.05% Bromophenol Blue; 10% SDS) and 2 pL 86% gjycerol, boil for 5 min and separate in
References
Patrice Audy Main Asselin DCpartment de phytologie FacultC des sciences de l’agriculture et de I’alimentation UniversitC Laval, QuCbec
Supported in part by a DFG grant (B1166/3-3). Received December 3. 1991
111 Dooley, S., Radtke, J., Blin, N. and Unteregger, G., NucleicAcids Res. 1988, 16, 11893. [2] Markowitz, A., Biochem. Biophys. Acta 1972, 281, 522-534. [3] Chodosh, L. A., Carthew, R. W. and Sharp, P. A., Mol. Cell. Biol. 1986, 6, 4723-4733. [4] Lynn, S. Y. and Riggs, A. D., Proc. Natl. Acad. USA 1974,71,947-951. [5] Dooley, S., Welter C., Theisinger, B. and Blin, N. Genet. Anal. Techn. Appl. 1990, 7, 133-137. [6] Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidmann, J. G . , Smith, F. A. and Struhl, K., Current Protocols i n MolecularBiology 1987.
Gel electrophoretic analysis of chitosan hydrolysis products Enzymatic hydrolysis of commercial crustacean chitosan by barley chitosanases was analyzed by subjecting chitosan to electrophoresis in a 10% w/v polyacrylamide slab gel in the presence of 7 M urea and 5.5 O/o v/v acetic acid. Chitosan migrated as a polycation. Chitosan was stained with Coomassie Brilliant Blue R-250 or visualized by ultraviolet transillumination after staining with Calcofluor White M2R. Some chitosan molecules were retarded by gel electrophoresis while small chitosan molecules migrated at the bottom of a 10 O/o w/vpolyacrylamide gel. Such analysis revealed that 96 h were necessary to convert all chitosan to oligosaccharides under our assay conditions. Chitosan oligosaccharides generated by enzymatic or chemical hydrolysis were further analyzed by electrophoresis in a 33 Yo w/v polyacrylamide gel containing urea and acetic acid. Coomassie Brilliant Blue R-250 was found to be better than CalcofluorWhite M2Rfor staining chitosan oligosaccharides. Chitosan oligomers of four residues (tetramers) or more were easily resolved in such a polyacrylamide gel system.To our knowledge, this is the first report of a gel electrophoretic separation of chitosan and its oligosaccharides.
Chitin is the most abundant aminopolysaccharide in nature [l]. It is an unbranched polymer of P-1,4-linked anhydro-2-acetamido-~-glucosefound in fungi [2], insects [3] and some marine invertebrates [4]. Chitosan consists of ~~
Correspondence: Dr. A. Asselin, Departement de phytologie, F.S.A.A., Universite Laval, Quebec, Canada G1K 7P4
Abbreviations: PAGE, polyacrylamide gel electrophoresis; TLC, thinlayer chromatography
‘0 VCH Verlagsgesellschaft mbH, D-6940 Weinheim, 1992
N-deacetylated derivatives of chitin. In nature, chitosan is prevalent in the walls of some fungi [2]. Chitosan is also commercially produced by chemical deacelylation of crustacean chitin [5]. Chitosan is a cationic polyelectrolyte with several applications in the fields of food science [6], medicine [7,8] and process biochemistry [9,10]. Moreover, chitosan can induce various defense reactions in higher plants [ll-151 and some chitosan derivatives can exhibit antimicrobial properties [ 161. Chitosan can be chemically or enzymatically degraded into chitosan oligosaccharides. Such oli0173-0835/92/0505-0334 $3.50+.25/0
