DNA sequence heterogeneity in the gene encoding a 60-kilodalton extracellular protein of Listeria monocytogenes and other Listeria species KARENA. GUTEKUNST' Meningitis and Special Pathogens Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control, Atlanta, GA 30333, U.S.A. BRIANP. HOLLOWAY Scientifc Resource Program, Biotechnology Core Facility, Centers for Disease Control, Atlanta, GA 30333, U.S.A. AND
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
GEORGEM.
CAR LONE^
Meningitis and Special Pathogens Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control, Atlanta, GA 30333, U.S.A. Received November 26, 1991 Revision received February 18, 1991 Accepted March 9, 1992 K. A., HOLLOWAY, B. P., and CARLONE, G. M. 1992. DNA sequence heterogeneity in the gene encoding GUTEKUNST, a 60-kilodalton extracellular protein of Listeria monocytogenes and other Listeria species. Can. J . Microbiol. 38: 865-870. Chromosomal DNA sequences from the 60 kilodalton protein gene of Listeria monocytogenes, amplified by the polymerase chain reaction, were used for restriction fragment length polymorphism differentiation of L. monocytogenes serotypes and other Listeria species. All 24 strains of L. monocytogenes examined produced an extracellular protein of molecular weight 60 000 (p60) as determined by Western blot analysis. Four of six other Listeria species had a protein that cross-reacted to antibodies to p60, but all differed in molecular weight, ranging from approximately 50 000 t o 65 000. The gene encoding p60 was amplified from chromosomal DNA in all strains using polymerase chain reaction with a single primer pair. Restriction enzyme digestion with HindIII of the amplified product revealed a restriction pattern that was distinct between serotypes 1/2a and either 4b or 1/2b of L. monocytogenes. Of the other Listeria species, four strains that produced a cross-reacting protein likewise produced a polymerase chain reaction amplification product with the primer pair. Listeria innocua alone had a restriction pattern similar to that of Listeria monocytogenes serotype 4b and 1/2b. Genotypic heterogeneity, as revealed by DNA amplification and restriction endonuclease digestion of the p60 open reading frame, correlates with "electrophoretic type" grouping and may be related t o differences in virulence mechanisms of Listeria monocytogenes and other Listeria species. Key words: Listeria monocytogenes, 60-kilodalton extracellular protein, polymerase chain reaction, restriction fragment length polymorphism.
K. A., HOLLOWAY, B. P., et CARLONE,G. M. 1992. DNA sequence heterogeneity in the gene encoding GUTEKUNST, a 60-kilodalton extracellular protein of Listeria monocytogenes and other Listeria species. Can. J . Microbiol. 38 : 865-870. Des sequences d'ADN chromosomique du gene codant pour la proteine de 60 kilodaltons de Listeria monocytogenes ont CtC soumises a la reaction d'amplification de gene par la polymerase (PCR), puis utilisees pour la differentiation du polymorphisme de restriction des serotypes de L. monocytogenes et d'autres especes de Listeria. L'analyse par immunoempreinte a permis de determiner que la totalite des 24 souches de L. monocytogenes produisent une protkine extracellulaire de poids moleculaire de 60 000 (p60). Parmi six autres especes de Listeria, quatre possedaient une proteine montrant une reaction croisee avec les anticorps dirigks contre p60, mais toutes ces protkines furent differentes par leurs poids moleculaires variant approximativement entre 50 000 et 65 000. Le gene codant pour p60 a ete amplifie chez toutes les souches par la polymerase, avec une seule paire d'amorces, a partir de I'ADN chromosomique. La digestion du produit amplifie avec l'enzyme de restriction HindIII a montre un patron de restriction distinct entre le serotype 1/2a et l'un ou l'autre des serotypes 4b et 1/2b de L. monocytogenes. Parmi les autres especes de Listeria, il a ete egalement possible d'obtenir un produit d'amplification par la polymerase avec la paire d'amorces chez les quatre souches qui ont produit une proteine donnant une reaction croiske. Seul Listeria innocua a eu un profil de restriction similaire a celui des serotypes 4b et 1/2b de L. monocytogenes. L'amplification de 1'ADN et la digestion par l'endonuclease de restriction du cadre de lecture ouvert de p60 ont revele que l'heterogeneite du genotype correspond au regroupement par type ClectrophorCtique et qu'elle peut &re relie a des differences des mecanismes de virulence de L. monocytogenes et d'autres especes de Listeria. Mots clks : Listeria monocytogenes, proteine extracellulaire de 60 kDa, reaction d'amplification de gene par la polymerase, polymorphisme de restriction. [Traduit par la redaction]
'present address: Retrovirus Diseases Branch, Division of Viral and Rickettsia1 Diseases, Centers for Disease Control, Atlanta, G A 30333, U.S.A. 2 ~ u t h otro whom all correspondence should be addressed. Printed in Canada / Imprime au Canada
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
866
CAN. J . MICROBIOL. VOL. 38, 1992
Listeria monocytogenes has been shown to be pathogenic for both humans and animals. It has recently been implicated in several food-borne outbreaks of listeriosis (Fleming et al. 1985; Linnan et al. 1988; Malinverni et al. 1985; Schlech et al. 1983). More commonly, listeriosis occurs sporadically, mainly in pregnant women, newborns, the elderly, and immunocompromised individuals (Gellin and Broome 1989). The sporadic cases of listeriosis are caused by only three serotypes of L. monocytogenes, 1/2a, 1/2b, and 4b (Gellin and Broome 1989). However, the recent foodborne outbreaks have been caused by strains belonging to the serotype 4b. This difference in the epidemiologic distribution of serotypes may reflect differences in the pathogenicity of the various serotypes. Specific factors involved in the virulence of L. monocytogenes have been identified. The sulfhydryl-activated 0-hemolysin, listeriolysin 0 , has been directly correlated with the virulence of L. monocytogenes (Cossart et al. 1989; Gaillard et al. 1986; Kathariou et al. 1987). A regulatory gene, prfA, has also been shown to influence virulence by regulation of the expression of listeriolysin in addition to other factors (Leimeister-Wachter et al. 1990). Mutations in a gene encoding a phosphatidylinositol-specific phospholipase have been shown to result in a loss of virulence (Camilli et al. 1990). Finally, a 60-kilodalton extracellular protein (p60) has been shown to play a role in virulence, although the specific role of this protein has not been proven (Kohler et al. 1990; Kuhn and Goebel 1989; Wuencher et al. 1991). The polymerase chain reaction (PCR) (Saiki et al. 1988) has been suggested as a method to identify L. monocytogenes, using listeriolysin-specific primer pairs (Bessesen et al. 1990; Border et al. 1990; Deneer and Boychuk 1991). In this study, we used a single primer pair corresponding to sequences in the gene encoding p60 to amplify chromosomal DNA sequences from 24 L. monocytogenes and from 6 other Listeria species. We combined the PCR technique with restriction endonuclease digestion and found differences in the structure of the gene encoding p60. Use of this method enabled us to distinguish between different serotypes of L. monocytogenes and also between other Listeria species. Differences at the gene level may reflect significant differences in the virulence mechanisms of the various Listeria isolates. The strains used in this study and their origin are listed in Table 1. All strains were grown at 37°C in brain heart infusion (BHI) broth (Difco, Detroit, Mich.) for 18 h on an orbital shaker and used immediately. Bacterial cells were removed by centrifugation from an overnight culture grown in BHI. The cleared supernatant was filtered through a 0.45-pm filter, and 100% trichloroacetic acid (w/v) was added to a final concentration of 7% (w/v). The mixture was incubated statically at 0°C for 2 h. The proteins were sedimented by centrifugation at 10 000 x G for 30 min at 4°C in a Sorvall SS-34 rotor. Proteins were resuspended in sterile, pyrogen-free water at a concentration of 1/ 100 of the initial volume. The pH was adjusted to 8 with 1 M Tris. Equivalent amounts of proteins were analyzed by sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDSPAGE) on an 8% separating and 4% stacking gel by the method of Laemmli (1970). Gels were stained overnight with Coomassie Brilliant Blue R-250 and destained with 50070
TABLE1 . Listeria monocytogenes strains and other Listeria species used Serotype L. monocytogenes strain* (1) G3239 (2) G3412 (3) G2294 (4) G2593 (5) G43 13 (6) G2228 (7) G2996 (8) G2893 (9) G3378 (10) 15u (1 1) G3384 (12) F7245 (13) F7243 (14) F4636 (15) G3638 (16) G3622 (17) G3959 (18) G1951 (19) G3134 (20) G3572 (21) F4684 (22) F4683 (23) G1032 (24) G9599 Other Listeria species L. grayi (KC1773) L. innocua (KC1783) L. ivanovii (KC1786) L. murrayi (KC1780) L. seeligeri (KC 1785) L. welshimeri (KC1836)
Origin Patient, Georgia Patient, Los Angeles Patient, Georgia Patient (pregnant) Milk Hot dog Patient, San Francisco Patient, San Francisco Patient, Los Angeles Nova Scotia outbreak Patient, Los Angeles Patient, Los Angeles Patient, Los Angeles Patient, Massachusetts Patient, Los Angeles Patient, Costa Rica Patient, San Francisco Cheese, Switzerland Patient, Los Angeles Patient, Oklahoma Patient, Houston Patient, Houston Patient, Texas Patient, California Type Type Type Type Type Type
strain, ATCC 19120 strain, ATCC 33090 strain, ATCC 191 19 strain ATCC 25401 strain ATCC 35967 strain ATCC 35897
*All strains were obtained from the Epidemic Investigations Laboratory and the Special Bacterial Reference Laboratory, Centers for Disease Control, Atlanta, Ga. 'strains were typed to serotype 4 but could not be typed for flagellar antigens. h d , not determined.
methanol, 10% acetic acid. Unstained proteins were transferred electrophoretically from polyacrylamide gels to nitrocellulose membranes according to the procedure of Towbin et al. (1979). p60 was purified by solution-phase isoelectric focusing using a Rotofor apparatus (Bio-Rad Laboratories, Rockville Centre, N.Y.). Purified p60 (200 pg) was suspended in Freund's incomplete adjuvant and injected subcutaneously at multiple sites on the back of New Zealand female white rabbits. Rabbits were boosted 2 weeks postinjection with an intramuscular injection of 100 pg purified p60 protein. Six weeks after the second injection the rabbits were exsanguinated and the serum was collected. Antibodies to the purified p60 were reacted with the nitrocellulose for at least 2 h at room temperature in phosphatebuffered saline containing 0.1 % Tween-20 (PBS-T). Unbound antibodies were removed by washing with PBS-T. Goat antirabbit antibody conjugated to horseradish peroxidase was added in PBS-T for 1 h at room temperature, followed by two washes with PBS-T and a final wash with PBS. Color development was achieved by incubation of the membrane with diaminobenzidine (0.5 mg/mL) and 0.012% H202. Chromosomal DNA was extracted from Listeria species by a method previously described (Kim et al. 1991). DNA from 10 mL of cells was suspended in a final volume of
NOTES
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
FIG. 1 . Western blot of 24 L. monocytogenes strains using polyclonal antibody to p60. Lanes 1-9 are serotype 1/2a, lanes 10-18 are serotype 4b, lanes 19-22 are serotype 1/2b, and lanes 23 and 24 are serotype 4?. The order of sample loading corresponds to the order in Table 1 . Arrow indicates a protein at 60 kDa.
100 pL sterile, pyrogen-free water. DNA from Listeria strains was amplified using a Perkin-Elmer thermocycler (Cetus, Emeryville, Calif.). Each reaction contained 20 pmol of each primer; each of the four dNTPs at a concentration of 50 pM; reaction buffer consisting of 20 mM Tris, pH 8.3, 1.5 mM MgCI2, 50 mM KCl, and 100 pg/mL gelatin; 10 ng chromosomal DNA; afld 2 units (U) Taq polymerase (US Biochemicals, Cleveland, Ohio). Thirty cycles of amplification were performed under the following conditions: after an initial denaturation step at 94°C for 5 min the cycles were performed by denaturing at 94°C for 30 s, annealing at 50°C for 1 min, and extending at 70°C for 2 min. The final extension reaction lasted for 5 min. The reaction was stopped by cooling to 4°C. PCR amplification products were purified by passage of the reaction mixture over a column containing Biogel P-60 (Bio-Rad, Rockville, Centre, N.Y .). All restriction digests were performed according to the manufacturer's recommendations. The products from the PCR reactions were analyzed by 1% agarose gel electrophoresis in Tris-acetate buffer, using standard procedures (Maniatis et al. 1982). Gels were stained with 0.1 % ethidium bromide and were photographed with ultraviolet illumination. Primers for PCR amplification of Listeria DNA were synthesized on Applied Biosystems model 380A or 380B DNA synthesizers utilizing standard phosphoramidite chemistry (Becker et al. 1985; Heron 1984). The oligonucleotides were purified to a single homogeneous band on a Waters W600 HPLC system. Buffers and gradient conditions used are described elsewhere (Sinha et al. 1984). Primers were designed based on the published sequence of the gene encoding p60 (Kohler et al. 1990). Cloning linkers were added to each primer to allow the rapid cloning of the PCR amplified products for future studies. The following primers were used for PCR reaction. Primer 1 : 5 ' CCGAATTCGG TACGTACTGGGATTTTCTGA3' EcoRI linker Amino terminal primer (bases 406-425) Primer 2: 5 ' CGGGATCCCG CACCGTCTTTCATTAAGAT3' BamHI linker Carboxy terminal primer (bases 1962- 1980)
Separation of equivalent amounts of the extracellular proteins of L. monocytogenes revealed very similar patterns for all strains. However, when antibodies to p60 were used in a Western blot, it appeared that p60 migrated at a slightly different molecular weight for the different serotypes (Fig. 1). Figure 2 is a Western blot of six other Listeria species that had proteins of different molecular masses that cross-reacted to antibodies to p60 from L. monocytogenes.
w
*
1
2
3
4
5
6
7
FIG. 2. Western blot of Listeria species using polyclonal antibody to p60. Lane 1 , L. monocytogenes serotype 1/2a; lane 2, L. grayi; lane 3, L. innocua; lane 4, L. ivanovii; lane 5 , L. murrayi; lane 6 , L. seeligeri; and lane 7, L. welshimeri. Arrow indicates a protein at 60 kDa.
Listeria grayi and Listeria murrayi did not produce any protein that cross-reacted to antibodies to p60. Listeria innocua expressed a protein smaller than 60 kDa (approximately 50 kDa) that cross-reacted to p60 antibodies. Listeria seeligeri expressed a protein of approximately 70 kDa and a smaller (approximately 40 kDa) protein that weakly crossreacted with p60 antibodies. Listeria ivanovii and Listeria welshimeri both expressed proteins of approximately 65 kDa that cross-reacted with p60 antibodies, although the reaction with L. welshimeri was very weak. To determine whether the subtle differences observed in molecular mass of the p60 protein between different serotypes of L. monocytogenes and the other Listeria species could be due to differences in the gene encoding this protein, the gene from the various strains was amplified by the polymerase chain reaction. All 24 strains of L. monocytogenes produced a product approximately 1600 base pairs (bp) in length when amplified by the primer pair used (Fig. 3A). This was the expected size based on the published sequence of the gene (Kohler et al. 1990). Analysis of the published sequence of the gene from serotype 1/2a (Kohler et al. 1990) revealed a limited number of restriction sites within the coding sequence of the gene. Of the enzymes available, only HindIII gave polymorphic fragments upon analysis by DNA agarose gel electrophoresis. BamHI, EcoRI, and PstI either did not restrict any of the DNAs or gave only nonpolymorphic DNA fragments. Restriction digestion of the PCR amplified products by HindIII showed a distinct restriction pattern for strains belonging to serotype 1/2a (Fig. 3B, lanes 1-9) as opposed to 4b or 1/2b, (Fig. 3b, lanes 10-22). All strains belonging to serotype 1/2a showed DNA fragments of approximately
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
CAN. J.
MICROBIOL. VOL. 38,
1992
FIG. 3. (A) Agarose gel of 24 PCR products from amplification reaction done on 24 L. monocytogenes strains. The leftmost lane is a 1-kb ladder; the numbers to the left indicate fragment sizes (bp); lanes 1-24 correspond to lanes 1-24 in Fig. 1 and samples 1-24 in Table 1 . (B) Agarose gel of DNA samples from Fig. 3A digested with HindIII.
750 and 400 bp in length (possibly a doublet) and a faint band at 1150 bp (probably a result of partial digestion). This correlates well with the published sequence of the gene encoding p60 (Kohler et al. 1990). Strains belonging to serotype 1/2b or 4b showed DNA fragments of approximately 1150 and 400 bp and a faint band at 1600 p (probably undigested DNA). Listeria innocua produced an amplification product with the same size and restriction pattern as L. monocytogenes serotype 1/2b or 4b (Figs. 4A, 4B). The other Listeria species (L. ivanovii, L. seeligeri, and L. welshimeri) also had an amplification product using these primers, but the fragment is larger, approximately 1700 bp (Fig. 4A). Restriction digestion of these products with HindIII reveals DNA fragments of 1250 bp. Listeria grayi or L. murrayi did not produce any product with these primer pairs (Fig. 4B). Listeriosis is generally caused by only 3 of the 12 known serotypes of L. monocytogenes: serotypes 1/2a, 1/2b, and 4b (Gellin and Broome 1989). Occasionally, a few cases are found to be caused by serotype 1/2c. While all three serotypes are found in sporadic cases of listeriosis, only the 4b serotype has been implicated in recent food-borne outbreaks (Fleming et al. 1985; Linnan et al. 1988; Malinverni et al. 1985; Schlech et al. 1983). In addition, there is a high association of serotypes 1/2b and 4b with pregnancy-
associated cases of listeriosis (McLauchlin 1990). These serotypes caused 8 1% of the cases, and serotypes 1/2a and 1/2c caused only 14%. The reasons for the predominance of the 1/2b and 4b serotypes in these cases are not known, but it may be a result of different pathogenic mechanisms between the different serotypes. The identification of specific virulence factors or other virulence regulators (Cossart et al. 1989; Gaillard et al. 1986; Kathariou et al. 1987; Leimeister-Wachter 1990) may provide a better understanding of the mechanisms of virulence of L. monocytogenes. We examined the gene that encodes p60 and showed that this single protein is genetically distinct as a result of sequence divergence between serotypes a and b. This information correlates well with data from "electrophoretic type" grouping (Bibb et al. 1989, 1990) of L. monocytogenes strains. In the examination of hundreds of isolates by multilocus enzyme electrophoresis, all of the electrophoretic types fell into two phylogenetic groups: Group a comprised serotypes 1/2a and 1/2c; group b comprised serotypes 1/2b and 4b. These two groups were separated by a genetic distance of 0.4. Traditionally, restriction fragment length polymorphism (RFLP) analysis has been used in the context of analyzing entire bacterial genomes between different species of bacteria. This method can be labor intensive and costly, and
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
NOTES
869
Listeria, only L. innocua had a restriction pattern resembling L. monocytogenes 4b or 1/2b. However, since L. innocua does not show hemolysis on sheep blood agar plates, in most cases it would be distinguished from L. monocytogenes during isolation procedures. Vines et al. (1992) have verified our results, using 12 strains of L. monocytogenes representing serotypes 1/2a, 1/2b, 1/2c, and 4b, in which they studied four virulence genes, including the gene encoding p60. Of the restriction endonucleases tested, only HindIII demonstrated restriction fragment length polymorphism and separated the serotypes into two groups, 1/2a or 1/2c and 1/2b or 4b. In contrast to the traditional RFLP analysis, PCR-RFLP analysis may provide a faster, inexpensive method for reliably determining DNA sequence heterogeneity in a gene or genes that may be related to virulence within a species of bacteria. Although this method cannot substitute for having the entire DNA sequence of a gene, it can provide a rapid initial look at sequence divergence within a gene that may be related to differences in virulence. The association of L. monocytogenes serotypes 1/2b and 4b with food-borne outbreaks and pregnancy-associated cases of listeriosis may imply that the virulence mechanism of these serotypes differs from that of other serotypes. Identification of genotypic divergence within specific virulence factors will be important for understanding the pathogenic mechanisms of L. monocytogenes and perhaps other pathogenic bacteria as well.
Acknowledgments The authors gratefully acknowledge Dr. R.E. Weaver for serotyping the Listeria strains, and Dr. L. Pine for helpful discussions during the preparation of this manuscript. Support from the National Research Council, Washington, D.C., to K.A.G. is acknowledged.
FIG. 4. (A) Agarose gel of PCR amplification products. The leftmost lane is a 1-kb ladder; the numbers to the left indicate fragment sizes (bp). Lane 1, L. monocytogenes serotype 1/2a; lane 2, L . grayi; lane 3, L. innocua; lane 4, L. ivanovii; lane 5, L. murrayi; lane 6, L. seeligeri; lane 7, L. welshimeri. (B) DNAs digested with HindIII. Lane 1, L. monocytogenes serotype 1/2a; lane 2, L. monocytogenes serotype 4b; lane 3, L. grayi; lane 4, L. innocua; lane 5, L. ivanovii; lane 6, L. seeligeri; lane 7, L. welshimeri.
may require very careful interpretation of the data. Only recently have Regnery et al. (1991) used a technique called PCR-RFLP analysis to analyze intraspecies differences in two rickettsial genes. Using multiple amplified DNA digest patterns they were able to estimate the intraspecies nucleotide sequence divergence for two rickettsial genes. The relationships estimated with these data correlated well with previously established taxonomic schemes. We used a single primer pair to amplify DNA sequences in 24 isolates of L. monocytogenes and 6 other Listeria species. Using PCR-RFLP, we were able to clearly distinguish sequence divergence between serotype 1/2a and 1/2b or 4b of L. monocytogenes. Of the other six species of
Becker, C.R., Efcavitch, J.W., Heiner, C.R., and Kaiser, N.F. 1985. Use of a reverse phase column for the HPLC purification of synthetic oligonucleotides. J . Chromatogr . 326: 293-299. Bessesen, M.T., Luo, Q., Rotbart, H.A., et al. 1990. Detection of Listeria monocytogenes by using the polymerase chain reaction. Appl. Environ. Microbiol. 56: 2930-2932. Bibb, W.F., Schwartz, B., Gellin, B.G., et al. 1989. Analysis of Listeria monocytogenes by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Int. J. Food Microbiol. 8: 233-239. Bibb, W.F., Gellin, B.G., Weaver, R., et al. 1990. Analysis of clinical and food-borne isolates of Listeria monocytogenes in the United States by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Appl. Environ. Microbiol. 56: 2133-2141. Border, P.M., Howard, J. J., Plastow, G.S., and Siggens, K.W. 1990. Detection of Listeria species and Listeria monocytogenes using polymerase chain reaction. Lett. Appl. Microbiol. 11: 158-162. Camilli, A., Goldfine, H., and Portnoy, D.H. 1990. Listeria monocytogenes mutants lacking phosphatidylinositol-specific phospholipase C are avirulent. J. Exp. Med. 173: 751-754. Cossart, P., Vicente, M.F., Mengaud, J., et al. 1989. Listeriolysin 0 is essential for virulence of Listeria monocytogenes: direct evidence obtained by gene complementation. Infect. Immun. 57: 3629-3636. Deneer, H.G., and Boychuk, I. 1991., Species-specific detection of Listeria monocytogenes by DNA amplification. Appl. Environ. Microbiol. 57: 606-609.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
870
CAN. J. MICROBIOL. VOL. 38, 1992
Fleming, DW., Cochi, S.L., MacDonald, K.L., et al. 1985. Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. N. Engl. J. Med. 312: 404-407. Gaillard, J.-L., Berche, P., and Sansonetti, P. 1986. Transposon mutagenesis as a tool to study the role of hemolysin in the virulence of Listeria monocytogenes. Infect. Immun. 52: 50-55. Gellin, B.G., and Broome, C.V. 1989. Listeriosis. J. Am. Med. Assoc. 261: 1313-1320. Heron, E.J. 1984. System for automated DNA synthesis. Am. Biotechnol. Lab. 2: 52. Kathariou, S., Metz, P., Hof, H., and Goebel, W. 1987. Tn916-induced mutations in the hemolysin determinant affecting virulence of Listeria monocytogenes. J. Bacteriol. 169: 1291-1297. Kim, C., Graves, L.M., Swaminathan, B., et al. 1991. Evaluation of hybridization characteristics of a cloned pRF106 probe for Listeria monocytogenes detection and development of a nonisotopic colony hybridization assay. Appl. Environ. Microbiol. 57: 289-294. Kohler, S., Leimeister-Wachter, M., Chakraborty, T., et al. 1990. The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes. Infect. Immun. 58: 1943-1950. Kuhn, M., and Goebel, W. 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells, Infect. Immun. 57: 55-61. Laemmli, U .K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London), 227: 680-685. Leimeister-Wachter, M., Haffner, C., Domann, E., et al. 1990. Identification of a gene that positively regulates expression of listeriolysin, the major virulence factor of Listeria monocytogenes. Proc. Natl. Acad. Sci. U.S.A. 87: 8336-8340. Linnan, M.J., Mascola, L., Lou, X.D., et al. 1988. Epidemic listeriosis associated with Mexican-style cheese. N. Engl. J. Med. 319: 823-828.
Malinverni, R., Bille, J., Perret, C., et al. 1985. Listeriose epidemique. Schweiz. Med. Wochenschr. 115: 2-10. Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. McLauchlin, J. 1990. Distribution of serovars of Listeria monocytogenes isolated from different categories of patients with listeriosis. Eur. J. Clin. Microbiol. Infect. Dis. 9: 210-21 3. Regnery, R.L., Spruill, C.L., and Plikaytis, B.D. 1991. Genotypic identification of Rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsia1 genes. J. Bacteriol. 173: 1576-1589. Saiki, R.K., Gelealand, P.H., Stoffel, S., et al. 1988. Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science (Washington, D .C .), 239: 487-491. Schlech, W.F., 111, Lavigne, P.M., Bortolussi, R.A., et al. 1983. Epidemic listeriosis-evidence for transmission by food. N. Engl. J. Med. 308: 203-206. Sinha, N.D., Baernat, J., McManus, J., and Koester, H. 1984. Polymer support oligonucleotide synthesis. XVII. use of P-cyanoethyl-N,N-dialkylarnino-N-morpholino phosphoramidite of deoxynucleotides for synthesis of DNA fragments simplifying deprotection and isolation of the final product. Nucleic Acids Res. 12: 4539. Towbin, H., Staehelin, J.S., and Gordon, J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76: 4350-4354. Vines, A., Reeves, M.W., Hunter, S., and Swaminathan, B. 1992. Restriction fragment length polymorphism in four virulenceassociated genes of Listeria monocytogenes. Res. Microbiol. 143: 28 1-294. Wuencher, M., Kohler, S., and Goebel, W. 1991. The p60 protein of Listeria monocytogenes: purification and characterization of biological activity. Annu. Meet. Am. Soc. Microbiol. Abstr. D-178. p. 108.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
GEORGEM.
CAR LONE^
Meningitis and Special Pathogens Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control, Atlanta, GA 30333, U.S.A. Received November 26, 1991 Revision received February 18, 1991 Accepted March 9, 1992 K. A., HOLLOWAY, B. P., and CARLONE, G. M. 1992. DNA sequence heterogeneity in the gene encoding GUTEKUNST, a 60-kilodalton extracellular protein of Listeria monocytogenes and other Listeria species. Can. J . Microbiol. 38: 865-870. Chromosomal DNA sequences from the 60 kilodalton protein gene of Listeria monocytogenes, amplified by the polymerase chain reaction, were used for restriction fragment length polymorphism differentiation of L. monocytogenes serotypes and other Listeria species. All 24 strains of L. monocytogenes examined produced an extracellular protein of molecular weight 60 000 (p60) as determined by Western blot analysis. Four of six other Listeria species had a protein that cross-reacted to antibodies to p60, but all differed in molecular weight, ranging from approximately 50 000 t o 65 000. The gene encoding p60 was amplified from chromosomal DNA in all strains using polymerase chain reaction with a single primer pair. Restriction enzyme digestion with HindIII of the amplified product revealed a restriction pattern that was distinct between serotypes 1/2a and either 4b or 1/2b of L. monocytogenes. Of the other Listeria species, four strains that produced a cross-reacting protein likewise produced a polymerase chain reaction amplification product with the primer pair. Listeria innocua alone had a restriction pattern similar to that of Listeria monocytogenes serotype 4b and 1/2b. Genotypic heterogeneity, as revealed by DNA amplification and restriction endonuclease digestion of the p60 open reading frame, correlates with "electrophoretic type" grouping and may be related t o differences in virulence mechanisms of Listeria monocytogenes and other Listeria species. Key words: Listeria monocytogenes, 60-kilodalton extracellular protein, polymerase chain reaction, restriction fragment length polymorphism.
K. A., HOLLOWAY, B. P., et CARLONE,G. M. 1992. DNA sequence heterogeneity in the gene encoding GUTEKUNST, a 60-kilodalton extracellular protein of Listeria monocytogenes and other Listeria species. Can. J . Microbiol. 38 : 865-870. Des sequences d'ADN chromosomique du gene codant pour la proteine de 60 kilodaltons de Listeria monocytogenes ont CtC soumises a la reaction d'amplification de gene par la polymerase (PCR), puis utilisees pour la differentiation du polymorphisme de restriction des serotypes de L. monocytogenes et d'autres especes de Listeria. L'analyse par immunoempreinte a permis de determiner que la totalite des 24 souches de L. monocytogenes produisent une protkine extracellulaire de poids moleculaire de 60 000 (p60). Parmi six autres especes de Listeria, quatre possedaient une proteine montrant une reaction croisee avec les anticorps dirigks contre p60, mais toutes ces protkines furent differentes par leurs poids moleculaires variant approximativement entre 50 000 et 65 000. Le gene codant pour p60 a ete amplifie chez toutes les souches par la polymerase, avec une seule paire d'amorces, a partir de I'ADN chromosomique. La digestion du produit amplifie avec l'enzyme de restriction HindIII a montre un patron de restriction distinct entre le serotype 1/2a et l'un ou l'autre des serotypes 4b et 1/2b de L. monocytogenes. Parmi les autres especes de Listeria, il a ete egalement possible d'obtenir un produit d'amplification par la polymerase avec la paire d'amorces chez les quatre souches qui ont produit une proteine donnant une reaction croiske. Seul Listeria innocua a eu un profil de restriction similaire a celui des serotypes 4b et 1/2b de L. monocytogenes. L'amplification de 1'ADN et la digestion par l'endonuclease de restriction du cadre de lecture ouvert de p60 ont revele que l'heterogeneite du genotype correspond au regroupement par type ClectrophorCtique et qu'elle peut &re relie a des differences des mecanismes de virulence de L. monocytogenes et d'autres especes de Listeria. Mots clks : Listeria monocytogenes, proteine extracellulaire de 60 kDa, reaction d'amplification de gene par la polymerase, polymorphisme de restriction. [Traduit par la redaction]
'present address: Retrovirus Diseases Branch, Division of Viral and Rickettsia1 Diseases, Centers for Disease Control, Atlanta, G A 30333, U.S.A. 2 ~ u t h otro whom all correspondence should be addressed. Printed in Canada / Imprime au Canada
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
866
CAN. J . MICROBIOL. VOL. 38, 1992
Listeria monocytogenes has been shown to be pathogenic for both humans and animals. It has recently been implicated in several food-borne outbreaks of listeriosis (Fleming et al. 1985; Linnan et al. 1988; Malinverni et al. 1985; Schlech et al. 1983). More commonly, listeriosis occurs sporadically, mainly in pregnant women, newborns, the elderly, and immunocompromised individuals (Gellin and Broome 1989). The sporadic cases of listeriosis are caused by only three serotypes of L. monocytogenes, 1/2a, 1/2b, and 4b (Gellin and Broome 1989). However, the recent foodborne outbreaks have been caused by strains belonging to the serotype 4b. This difference in the epidemiologic distribution of serotypes may reflect differences in the pathogenicity of the various serotypes. Specific factors involved in the virulence of L. monocytogenes have been identified. The sulfhydryl-activated 0-hemolysin, listeriolysin 0 , has been directly correlated with the virulence of L. monocytogenes (Cossart et al. 1989; Gaillard et al. 1986; Kathariou et al. 1987). A regulatory gene, prfA, has also been shown to influence virulence by regulation of the expression of listeriolysin in addition to other factors (Leimeister-Wachter et al. 1990). Mutations in a gene encoding a phosphatidylinositol-specific phospholipase have been shown to result in a loss of virulence (Camilli et al. 1990). Finally, a 60-kilodalton extracellular protein (p60) has been shown to play a role in virulence, although the specific role of this protein has not been proven (Kohler et al. 1990; Kuhn and Goebel 1989; Wuencher et al. 1991). The polymerase chain reaction (PCR) (Saiki et al. 1988) has been suggested as a method to identify L. monocytogenes, using listeriolysin-specific primer pairs (Bessesen et al. 1990; Border et al. 1990; Deneer and Boychuk 1991). In this study, we used a single primer pair corresponding to sequences in the gene encoding p60 to amplify chromosomal DNA sequences from 24 L. monocytogenes and from 6 other Listeria species. We combined the PCR technique with restriction endonuclease digestion and found differences in the structure of the gene encoding p60. Use of this method enabled us to distinguish between different serotypes of L. monocytogenes and also between other Listeria species. Differences at the gene level may reflect significant differences in the virulence mechanisms of the various Listeria isolates. The strains used in this study and their origin are listed in Table 1. All strains were grown at 37°C in brain heart infusion (BHI) broth (Difco, Detroit, Mich.) for 18 h on an orbital shaker and used immediately. Bacterial cells were removed by centrifugation from an overnight culture grown in BHI. The cleared supernatant was filtered through a 0.45-pm filter, and 100% trichloroacetic acid (w/v) was added to a final concentration of 7% (w/v). The mixture was incubated statically at 0°C for 2 h. The proteins were sedimented by centrifugation at 10 000 x G for 30 min at 4°C in a Sorvall SS-34 rotor. Proteins were resuspended in sterile, pyrogen-free water at a concentration of 1/ 100 of the initial volume. The pH was adjusted to 8 with 1 M Tris. Equivalent amounts of proteins were analyzed by sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDSPAGE) on an 8% separating and 4% stacking gel by the method of Laemmli (1970). Gels were stained overnight with Coomassie Brilliant Blue R-250 and destained with 50070
TABLE1 . Listeria monocytogenes strains and other Listeria species used Serotype L. monocytogenes strain* (1) G3239 (2) G3412 (3) G2294 (4) G2593 (5) G43 13 (6) G2228 (7) G2996 (8) G2893 (9) G3378 (10) 15u (1 1) G3384 (12) F7245 (13) F7243 (14) F4636 (15) G3638 (16) G3622 (17) G3959 (18) G1951 (19) G3134 (20) G3572 (21) F4684 (22) F4683 (23) G1032 (24) G9599 Other Listeria species L. grayi (KC1773) L. innocua (KC1783) L. ivanovii (KC1786) L. murrayi (KC1780) L. seeligeri (KC 1785) L. welshimeri (KC1836)
Origin Patient, Georgia Patient, Los Angeles Patient, Georgia Patient (pregnant) Milk Hot dog Patient, San Francisco Patient, San Francisco Patient, Los Angeles Nova Scotia outbreak Patient, Los Angeles Patient, Los Angeles Patient, Los Angeles Patient, Massachusetts Patient, Los Angeles Patient, Costa Rica Patient, San Francisco Cheese, Switzerland Patient, Los Angeles Patient, Oklahoma Patient, Houston Patient, Houston Patient, Texas Patient, California Type Type Type Type Type Type
strain, ATCC 19120 strain, ATCC 33090 strain, ATCC 191 19 strain ATCC 25401 strain ATCC 35967 strain ATCC 35897
*All strains were obtained from the Epidemic Investigations Laboratory and the Special Bacterial Reference Laboratory, Centers for Disease Control, Atlanta, Ga. 'strains were typed to serotype 4 but could not be typed for flagellar antigens. h d , not determined.
methanol, 10% acetic acid. Unstained proteins were transferred electrophoretically from polyacrylamide gels to nitrocellulose membranes according to the procedure of Towbin et al. (1979). p60 was purified by solution-phase isoelectric focusing using a Rotofor apparatus (Bio-Rad Laboratories, Rockville Centre, N.Y.). Purified p60 (200 pg) was suspended in Freund's incomplete adjuvant and injected subcutaneously at multiple sites on the back of New Zealand female white rabbits. Rabbits were boosted 2 weeks postinjection with an intramuscular injection of 100 pg purified p60 protein. Six weeks after the second injection the rabbits were exsanguinated and the serum was collected. Antibodies to the purified p60 were reacted with the nitrocellulose for at least 2 h at room temperature in phosphatebuffered saline containing 0.1 % Tween-20 (PBS-T). Unbound antibodies were removed by washing with PBS-T. Goat antirabbit antibody conjugated to horseradish peroxidase was added in PBS-T for 1 h at room temperature, followed by two washes with PBS-T and a final wash with PBS. Color development was achieved by incubation of the membrane with diaminobenzidine (0.5 mg/mL) and 0.012% H202. Chromosomal DNA was extracted from Listeria species by a method previously described (Kim et al. 1991). DNA from 10 mL of cells was suspended in a final volume of
NOTES
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
FIG. 1 . Western blot of 24 L. monocytogenes strains using polyclonal antibody to p60. Lanes 1-9 are serotype 1/2a, lanes 10-18 are serotype 4b, lanes 19-22 are serotype 1/2b, and lanes 23 and 24 are serotype 4?. The order of sample loading corresponds to the order in Table 1 . Arrow indicates a protein at 60 kDa.
100 pL sterile, pyrogen-free water. DNA from Listeria strains was amplified using a Perkin-Elmer thermocycler (Cetus, Emeryville, Calif.). Each reaction contained 20 pmol of each primer; each of the four dNTPs at a concentration of 50 pM; reaction buffer consisting of 20 mM Tris, pH 8.3, 1.5 mM MgCI2, 50 mM KCl, and 100 pg/mL gelatin; 10 ng chromosomal DNA; afld 2 units (U) Taq polymerase (US Biochemicals, Cleveland, Ohio). Thirty cycles of amplification were performed under the following conditions: after an initial denaturation step at 94°C for 5 min the cycles were performed by denaturing at 94°C for 30 s, annealing at 50°C for 1 min, and extending at 70°C for 2 min. The final extension reaction lasted for 5 min. The reaction was stopped by cooling to 4°C. PCR amplification products were purified by passage of the reaction mixture over a column containing Biogel P-60 (Bio-Rad, Rockville, Centre, N.Y .). All restriction digests were performed according to the manufacturer's recommendations. The products from the PCR reactions were analyzed by 1% agarose gel electrophoresis in Tris-acetate buffer, using standard procedures (Maniatis et al. 1982). Gels were stained with 0.1 % ethidium bromide and were photographed with ultraviolet illumination. Primers for PCR amplification of Listeria DNA were synthesized on Applied Biosystems model 380A or 380B DNA synthesizers utilizing standard phosphoramidite chemistry (Becker et al. 1985; Heron 1984). The oligonucleotides were purified to a single homogeneous band on a Waters W600 HPLC system. Buffers and gradient conditions used are described elsewhere (Sinha et al. 1984). Primers were designed based on the published sequence of the gene encoding p60 (Kohler et al. 1990). Cloning linkers were added to each primer to allow the rapid cloning of the PCR amplified products for future studies. The following primers were used for PCR reaction. Primer 1 : 5 ' CCGAATTCGG TACGTACTGGGATTTTCTGA3' EcoRI linker Amino terminal primer (bases 406-425) Primer 2: 5 ' CGGGATCCCG CACCGTCTTTCATTAAGAT3' BamHI linker Carboxy terminal primer (bases 1962- 1980)
Separation of equivalent amounts of the extracellular proteins of L. monocytogenes revealed very similar patterns for all strains. However, when antibodies to p60 were used in a Western blot, it appeared that p60 migrated at a slightly different molecular weight for the different serotypes (Fig. 1). Figure 2 is a Western blot of six other Listeria species that had proteins of different molecular masses that cross-reacted to antibodies to p60 from L. monocytogenes.
w
*
1
2
3
4
5
6
7
FIG. 2. Western blot of Listeria species using polyclonal antibody to p60. Lane 1 , L. monocytogenes serotype 1/2a; lane 2, L. grayi; lane 3, L. innocua; lane 4, L. ivanovii; lane 5 , L. murrayi; lane 6 , L. seeligeri; and lane 7, L. welshimeri. Arrow indicates a protein at 60 kDa.
Listeria grayi and Listeria murrayi did not produce any protein that cross-reacted to antibodies to p60. Listeria innocua expressed a protein smaller than 60 kDa (approximately 50 kDa) that cross-reacted to p60 antibodies. Listeria seeligeri expressed a protein of approximately 70 kDa and a smaller (approximately 40 kDa) protein that weakly crossreacted with p60 antibodies. Listeria ivanovii and Listeria welshimeri both expressed proteins of approximately 65 kDa that cross-reacted with p60 antibodies, although the reaction with L. welshimeri was very weak. To determine whether the subtle differences observed in molecular mass of the p60 protein between different serotypes of L. monocytogenes and the other Listeria species could be due to differences in the gene encoding this protein, the gene from the various strains was amplified by the polymerase chain reaction. All 24 strains of L. monocytogenes produced a product approximately 1600 base pairs (bp) in length when amplified by the primer pair used (Fig. 3A). This was the expected size based on the published sequence of the gene (Kohler et al. 1990). Analysis of the published sequence of the gene from serotype 1/2a (Kohler et al. 1990) revealed a limited number of restriction sites within the coding sequence of the gene. Of the enzymes available, only HindIII gave polymorphic fragments upon analysis by DNA agarose gel electrophoresis. BamHI, EcoRI, and PstI either did not restrict any of the DNAs or gave only nonpolymorphic DNA fragments. Restriction digestion of the PCR amplified products by HindIII showed a distinct restriction pattern for strains belonging to serotype 1/2a (Fig. 3B, lanes 1-9) as opposed to 4b or 1/2b, (Fig. 3b, lanes 10-22). All strains belonging to serotype 1/2a showed DNA fragments of approximately
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
CAN. J.
MICROBIOL. VOL. 38,
1992
FIG. 3. (A) Agarose gel of 24 PCR products from amplification reaction done on 24 L. monocytogenes strains. The leftmost lane is a 1-kb ladder; the numbers to the left indicate fragment sizes (bp); lanes 1-24 correspond to lanes 1-24 in Fig. 1 and samples 1-24 in Table 1 . (B) Agarose gel of DNA samples from Fig. 3A digested with HindIII.
750 and 400 bp in length (possibly a doublet) and a faint band at 1150 bp (probably a result of partial digestion). This correlates well with the published sequence of the gene encoding p60 (Kohler et al. 1990). Strains belonging to serotype 1/2b or 4b showed DNA fragments of approximately 1150 and 400 bp and a faint band at 1600 p (probably undigested DNA). Listeria innocua produced an amplification product with the same size and restriction pattern as L. monocytogenes serotype 1/2b or 4b (Figs. 4A, 4B). The other Listeria species (L. ivanovii, L. seeligeri, and L. welshimeri) also had an amplification product using these primers, but the fragment is larger, approximately 1700 bp (Fig. 4A). Restriction digestion of these products with HindIII reveals DNA fragments of 1250 bp. Listeria grayi or L. murrayi did not produce any product with these primer pairs (Fig. 4B). Listeriosis is generally caused by only 3 of the 12 known serotypes of L. monocytogenes: serotypes 1/2a, 1/2b, and 4b (Gellin and Broome 1989). Occasionally, a few cases are found to be caused by serotype 1/2c. While all three serotypes are found in sporadic cases of listeriosis, only the 4b serotype has been implicated in recent food-borne outbreaks (Fleming et al. 1985; Linnan et al. 1988; Malinverni et al. 1985; Schlech et al. 1983). In addition, there is a high association of serotypes 1/2b and 4b with pregnancy-
associated cases of listeriosis (McLauchlin 1990). These serotypes caused 8 1% of the cases, and serotypes 1/2a and 1/2c caused only 14%. The reasons for the predominance of the 1/2b and 4b serotypes in these cases are not known, but it may be a result of different pathogenic mechanisms between the different serotypes. The identification of specific virulence factors or other virulence regulators (Cossart et al. 1989; Gaillard et al. 1986; Kathariou et al. 1987; Leimeister-Wachter 1990) may provide a better understanding of the mechanisms of virulence of L. monocytogenes. We examined the gene that encodes p60 and showed that this single protein is genetically distinct as a result of sequence divergence between serotypes a and b. This information correlates well with data from "electrophoretic type" grouping (Bibb et al. 1989, 1990) of L. monocytogenes strains. In the examination of hundreds of isolates by multilocus enzyme electrophoresis, all of the electrophoretic types fell into two phylogenetic groups: Group a comprised serotypes 1/2a and 1/2c; group b comprised serotypes 1/2b and 4b. These two groups were separated by a genetic distance of 0.4. Traditionally, restriction fragment length polymorphism (RFLP) analysis has been used in the context of analyzing entire bacterial genomes between different species of bacteria. This method can be labor intensive and costly, and
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
NOTES
869
Listeria, only L. innocua had a restriction pattern resembling L. monocytogenes 4b or 1/2b. However, since L. innocua does not show hemolysis on sheep blood agar plates, in most cases it would be distinguished from L. monocytogenes during isolation procedures. Vines et al. (1992) have verified our results, using 12 strains of L. monocytogenes representing serotypes 1/2a, 1/2b, 1/2c, and 4b, in which they studied four virulence genes, including the gene encoding p60. Of the restriction endonucleases tested, only HindIII demonstrated restriction fragment length polymorphism and separated the serotypes into two groups, 1/2a or 1/2c and 1/2b or 4b. In contrast to the traditional RFLP analysis, PCR-RFLP analysis may provide a faster, inexpensive method for reliably determining DNA sequence heterogeneity in a gene or genes that may be related to virulence within a species of bacteria. Although this method cannot substitute for having the entire DNA sequence of a gene, it can provide a rapid initial look at sequence divergence within a gene that may be related to differences in virulence. The association of L. monocytogenes serotypes 1/2b and 4b with food-borne outbreaks and pregnancy-associated cases of listeriosis may imply that the virulence mechanism of these serotypes differs from that of other serotypes. Identification of genotypic divergence within specific virulence factors will be important for understanding the pathogenic mechanisms of L. monocytogenes and perhaps other pathogenic bacteria as well.
Acknowledgments The authors gratefully acknowledge Dr. R.E. Weaver for serotyping the Listeria strains, and Dr. L. Pine for helpful discussions during the preparation of this manuscript. Support from the National Research Council, Washington, D.C., to K.A.G. is acknowledged.
FIG. 4. (A) Agarose gel of PCR amplification products. The leftmost lane is a 1-kb ladder; the numbers to the left indicate fragment sizes (bp). Lane 1, L. monocytogenes serotype 1/2a; lane 2, L . grayi; lane 3, L. innocua; lane 4, L. ivanovii; lane 5, L. murrayi; lane 6, L. seeligeri; lane 7, L. welshimeri. (B) DNAs digested with HindIII. Lane 1, L. monocytogenes serotype 1/2a; lane 2, L. monocytogenes serotype 4b; lane 3, L. grayi; lane 4, L. innocua; lane 5, L. ivanovii; lane 6, L. seeligeri; lane 7, L. welshimeri.
may require very careful interpretation of the data. Only recently have Regnery et al. (1991) used a technique called PCR-RFLP analysis to analyze intraspecies differences in two rickettsial genes. Using multiple amplified DNA digest patterns they were able to estimate the intraspecies nucleotide sequence divergence for two rickettsial genes. The relationships estimated with these data correlated well with previously established taxonomic schemes. We used a single primer pair to amplify DNA sequences in 24 isolates of L. monocytogenes and 6 other Listeria species. Using PCR-RFLP, we were able to clearly distinguish sequence divergence between serotype 1/2a and 1/2b or 4b of L. monocytogenes. Of the other six species of
Becker, C.R., Efcavitch, J.W., Heiner, C.R., and Kaiser, N.F. 1985. Use of a reverse phase column for the HPLC purification of synthetic oligonucleotides. J . Chromatogr . 326: 293-299. Bessesen, M.T., Luo, Q., Rotbart, H.A., et al. 1990. Detection of Listeria monocytogenes by using the polymerase chain reaction. Appl. Environ. Microbiol. 56: 2930-2932. Bibb, W.F., Schwartz, B., Gellin, B.G., et al. 1989. Analysis of Listeria monocytogenes by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Int. J. Food Microbiol. 8: 233-239. Bibb, W.F., Gellin, B.G., Weaver, R., et al. 1990. Analysis of clinical and food-borne isolates of Listeria monocytogenes in the United States by multilocus enzyme electrophoresis and application of the method to epidemiologic investigations. Appl. Environ. Microbiol. 56: 2133-2141. Border, P.M., Howard, J. J., Plastow, G.S., and Siggens, K.W. 1990. Detection of Listeria species and Listeria monocytogenes using polymerase chain reaction. Lett. Appl. Microbiol. 11: 158-162. Camilli, A., Goldfine, H., and Portnoy, D.H. 1990. Listeria monocytogenes mutants lacking phosphatidylinositol-specific phospholipase C are avirulent. J. Exp. Med. 173: 751-754. Cossart, P., Vicente, M.F., Mengaud, J., et al. 1989. Listeriolysin 0 is essential for virulence of Listeria monocytogenes: direct evidence obtained by gene complementation. Infect. Immun. 57: 3629-3636. Deneer, H.G., and Boychuk, I. 1991., Species-specific detection of Listeria monocytogenes by DNA amplification. Appl. Environ. Microbiol. 57: 606-609.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by CONCORDIA UNIV on 12/08/14 For personal use only.
870
CAN. J. MICROBIOL. VOL. 38, 1992
Fleming, DW., Cochi, S.L., MacDonald, K.L., et al. 1985. Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. N. Engl. J. Med. 312: 404-407. Gaillard, J.-L., Berche, P., and Sansonetti, P. 1986. Transposon mutagenesis as a tool to study the role of hemolysin in the virulence of Listeria monocytogenes. Infect. Immun. 52: 50-55. Gellin, B.G., and Broome, C.V. 1989. Listeriosis. J. Am. Med. Assoc. 261: 1313-1320. Heron, E.J. 1984. System for automated DNA synthesis. Am. Biotechnol. Lab. 2: 52. Kathariou, S., Metz, P., Hof, H., and Goebel, W. 1987. Tn916-induced mutations in the hemolysin determinant affecting virulence of Listeria monocytogenes. J. Bacteriol. 169: 1291-1297. Kim, C., Graves, L.M., Swaminathan, B., et al. 1991. Evaluation of hybridization characteristics of a cloned pRF106 probe for Listeria monocytogenes detection and development of a nonisotopic colony hybridization assay. Appl. Environ. Microbiol. 57: 289-294. Kohler, S., Leimeister-Wachter, M., Chakraborty, T., et al. 1990. The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes. Infect. Immun. 58: 1943-1950. Kuhn, M., and Goebel, W. 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells, Infect. Immun. 57: 55-61. Laemmli, U .K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London), 227: 680-685. Leimeister-Wachter, M., Haffner, C., Domann, E., et al. 1990. Identification of a gene that positively regulates expression of listeriolysin, the major virulence factor of Listeria monocytogenes. Proc. Natl. Acad. Sci. U.S.A. 87: 8336-8340. Linnan, M.J., Mascola, L., Lou, X.D., et al. 1988. Epidemic listeriosis associated with Mexican-style cheese. N. Engl. J. Med. 319: 823-828.
Malinverni, R., Bille, J., Perret, C., et al. 1985. Listeriose epidemique. Schweiz. Med. Wochenschr. 115: 2-10. Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. McLauchlin, J. 1990. Distribution of serovars of Listeria monocytogenes isolated from different categories of patients with listeriosis. Eur. J. Clin. Microbiol. Infect. Dis. 9: 210-21 3. Regnery, R.L., Spruill, C.L., and Plikaytis, B.D. 1991. Genotypic identification of Rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsia1 genes. J. Bacteriol. 173: 1576-1589. Saiki, R.K., Gelealand, P.H., Stoffel, S., et al. 1988. Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase. Science (Washington, D .C .), 239: 487-491. Schlech, W.F., 111, Lavigne, P.M., Bortolussi, R.A., et al. 1983. Epidemic listeriosis-evidence for transmission by food. N. Engl. J. Med. 308: 203-206. Sinha, N.D., Baernat, J., McManus, J., and Koester, H. 1984. Polymer support oligonucleotide synthesis. XVII. use of P-cyanoethyl-N,N-dialkylarnino-N-morpholino phosphoramidite of deoxynucleotides for synthesis of DNA fragments simplifying deprotection and isolation of the final product. Nucleic Acids Res. 12: 4539. Towbin, H., Staehelin, J.S., and Gordon, J. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U.S.A. 76: 4350-4354. Vines, A., Reeves, M.W., Hunter, S., and Swaminathan, B. 1992. Restriction fragment length polymorphism in four virulenceassociated genes of Listeria monocytogenes. Res. Microbiol. 143: 28 1-294. Wuencher, M., Kohler, S., and Goebel, W. 1991. The p60 protein of Listeria monocytogenes: purification and characterization of biological activity. Annu. Meet. Am. Soc. Microbiol. Abstr. D-178. p. 108.
