firus Research, 24 (1992) 173-186 Q 1992 Elsevier Science Publishers B.V. All rights reserved 0168.1702/92/$05.00

173

VIRUS 00790

Domains 1 and 2 of ICAM- are sufficient to bind human rhinoviruses Donald W. Lineberger, Carol R. Uncapher, Donald J. Graham and Richard J. Colonno + Department

of Virus and

Cell Biology, Merck Sharp and Dohme Research Laboratories, Wext Poinf, PA 19486, USA

(Received 12 December 1991; revision received and accepted 25 February 1992)

Summary The intercellular adhesion molecule-l (ICAM-1) receptor was expressed in primary chicken embryo cells using a retroviral vector and shown to specifically bind major group human rhinoviruses (HRVs). A truncated, membrane-bound ICAM- protein containing N-terminaf domains 1, 2, and 3 retained the ability to bind virus whereas proteins containing domains 1 and 2 or domain 1 were not expressed under these conditions. Soluble forms of ICAM- proteins were expressed to circumvent the reduced expression levels of shorter ICAM- truncations. FuIl-length and truncated ICAM- molecules containing only domains 1 and 2 were capable of neutralizing HRV binding to cells. Soluble receptors containing only domain 1 could not be recovered. Mutants of ICAM- lacking carbohydrate attachment sites were constructed and shown to have no effect on the ability of ICAM- to bind HRVs. In addition, ICAM- proteins expressed in the presence of tunicamycin also retained their virus binding capability. These data suggest that the N-terminaf two domains of ICAM- are sufficient for virus interaction and that carbohydrates do not play a major role in virus binding. Viral receptor; Picornavirus; Carbohydrate

Correspondence to: Donald W. Lineberger, Department of Virus and Cell Biology, Merck Sharp and Dohme Research Laboratories, West Point, PA 19486, USA. * Present address: Bristol-Myers Squibb Pharmaceutical Research Institute, P.O. Box 4000, Princeton, NJ 08543-4000, USA.

174

Introduction The initial event in animal virus infections is the specific attachment of virus particles to cellular receptors. Thus, virus-receptor interaction plays an important role in virus entry into susceptible hosts. Human rhinoviruses (HRVs), the major causative agents of the common cold in man (Gwaltney, 19821, represent a family of 102 antigenically distinct serotypes that have been divided into 2, and possibly 3, receptor families (Abraham and Colonno, 1984; Colonno et al., 1986; Uncapher et al., 1991). Ninety-one serotypes utilize a single cellular receptor for entry into cells and are referred to as the major group HRVs, while 10 of the remaining 11 serotypes comprise the minor group and bind to a putative 120 kDa receptor (Colonno et al., 1986; Mischak et al., 1988). One serotype, HRV-87, may represent a third receptor family (Uncapher et al., 1991). Within the Picornaciridae, only the cellular receptors for poliovirus and the major group of HRVs have been identified. The receptor for the major group HRVs has been identified as the intercellular adhesion molecule-l (ICAM- 1 (Greve et al., 1989; Staunton et al., 1989; Tomassini et al., 1989). ICAMis the cell surface ligand for the integrin lymphocyte function associated antigen-l and plays an important role in immune and inflammatory responses (Makgoba et al., 1988). ICAMis a member of the immunoglobulin supergene family and is structurally related to the CD4 receptor used by the human immunodeficiency virus (HIV) and to the immunoglobulin-like receptor identified for poliovirus (Greve et al., 1989; Mendelsohn et al., 1988; Staunton et al., 1989; Tomassini et al., 1989). Previous studies using human/murine chimeras have mapped the virus binding site to the N-terminal domain 1 of ICAM(Staunton et al., 1990; McClelland et al., 1991; Register et al., 1991). The primary sequence of ICAMencodes 8 potential N-linked glycdsylation attachment sites throughout the molecule, 7 of which were detected by partial digestion with endoglycosidase F (Stanton et al., 1988; Tomassini et al., 1989). Initial studies using detergent solubilized receptor suggested that carbohydrates may be involved in binding of HRVs (Lineberger et al., 1990). Subsequent studies examining the role of ICAMcarbohydrates reported that removal of the first 4 carbohydrate attachment sites within domain 2 had no effect on virus binding (McClelland et al., 1991). However, what role, if any, the remaining carbohydrates play in virus binding was not addressed. Detailed studies were undertaken to define the shortest ICAMfragment capable of binding HRVs and to determine whether carbohydrates play any role in virus-receptor interactions.

Materials

and Methods

Viruses cells transfections, and infections The propagation and purification of radiolabeled HRVs were described previously (Abraham and Colonno, 1984). Primary chicken embryo fibroblasts (CEFs)

175

were obtained from Specific Pathogen-Free Avian Supply (SPAFAS, Inc., Storrs, CT) and maintained as previously described (Garber et al., 1991). Subcon~uent CEF cells (30-50% confluency) were transfected by the standard calcium-phosphate procedure (Kingston et al., 1991) or infected by adding l/lOth volume of medium from previously transfected cells containing recombinant Rous sarcoma virus (RSVI. Three to four days after transfection or infection, confluent monolayers were tested for their ability to bind radiolabeled MAb-IA6 (Colonno et al., 1986) or radiolabeled HRVs as described (Register et al., 1991). Immunofluorescence was carried out as described (Watkins, 1991) using MAb-IA6 or anti-ICAMrabbit polyclonal antisera. After reaction with the primary antibody and extensive washing, fluorescein-labeled goat anti-mouse or goat anti-rabbit (polyclonal) was reacted with bound lA6 or polyclonal antibodies, respectively. The fluorescence of each culture was observed under microscopic examination. In all cases, the fluorescence observed was evenly distributed over the individua1 ceil and positive cells were readily distinguishable from fluorescent negative cells. Three levels of intensity were observed as compared to untransfected cells: -, no fluorescence over untransfected controls; + + +, maximum intensity seen in the full-length ICAM- expressing cells; +, fluorescence levels intermediate between the two extremes.

vectorconstruction The retroviral vector, pNPRAV, was a generous gift from Dr. E. Garber (Merck Sharp and Dohme, Rahway, NJ). The plasmid was further modified to contain a unique CIuI site for insertion of foreign genes (pNPRAV-DCla). A cDNA copy of ICAM- containing C/u1 ends was generated by PCR amplification of an ICAM-I clone (Tomassini et al., 1989) using primers homologous to the termini of ICAMwith additional sequences for C/a1 digestion (5 primer = 5’ TCTAGAATCGATTTCAGAGTTGCAACCTCAGCCTCG 3’; 3’ primer = 5’ TCTAGAATCGATGC’ITTATTAACTAACACAAAGGAAG 3’). The ICAM- PCR product was digested with C/a1 and inserted into the ClaI digested plasmid pNPRAV-DCla to generate pNPRAV/ICAM. Truncations and carbohydrate mutants of ICAMwere constructed in a pGEM7Zf( + I plasmid. Construction of synthetic ICAM-I plasmids, pDlD2 and pSICAM, has been described elsewhere (Register et al., 1991). Construction of membrane-bound ICAM-

truncations

A fragment containing the transmembrane and cytoplasmic regions of ICAMwas generated by digestion with the restriction enzymes BglII or X&o1 at one end, blunting the fragments with Klenow polymerase, then digesting with XbaI. The fragment was gel purified and used for subsequent truncation constructions. Truncations were made by digesting pSVL/ICAM (Tomassini et al., 1989) with Sal1 and NarI for domains l-3, Sat1 and BgZI for domains I and 2, and Sal1 and HincII for domain 1. Each fragment was blunted with Klenow polymerase or T4

176

polymerase (BglI digested end) prior to gel purification. Purified fragments were ligated to the fragment encoding the transmembrane and cytoplasmic regions, then digested with XbaI. Ligated, digested DNAs were gel purified, and ligated into pSVL/Neo plasmid (Pharmacia, Piscataway, NJ). Each was PCR amplified using the primers described above, digested with CfaI, and ligated into pNPRAV previously digested with ClaI. Carbohydrate mutants qf ICAM-I All mutations carbohydrate sites ual mutants were nesis as previously all 4 of the above ping primers with

substituted a Leu for an Asn at the 4 potential N-linked within domain 2 of ICAM(N103, N118, N126, N174). Individconstructed by oligonucleotide directed, gapped-duplex mutagedescribed (Colonno et al., 19881. A combined mutant containing mutations was constructed by PCR amplification using overlapmutant sequences (Register et al., 1991).

Soluble ICAM- 1 truncations A soluble form of ICAMcontaining all 5 extracellular domains was constructed by digesting the ICAM-l/pGEM plasmid with BstEII enzyme to remove the transmembrane region and part of the 3’ noncoding region of the ICAMclone. A double-stranded linker containing Bst EII overhang ends and homologous to ICAMsequences from the Bst EII site at base 1479 to just prior to the start of the transmembrane region (base 1511) replaced the small BstEII fragment. In addition, the linker contained a stop codon in frame with the coding region of the ICAMclone to terminate the subsequent protein at amino acid 453. The resultant plasmid was digested with MscI enzyme and the small fragment containing the new stop codon was transferred to the pSICAM plasmid, replacing its small MscI fragment, to generate sDl-5. Soluble ICAMcontaining only domains 1 and 2 was constructed by digesting the pDlD2 plasmid with SpeI enzyme and ligating a double-stranded linker containing a stop codon in frame with the coding sequence. The linker contained an SpeI overhang at its 5’ terminus followed by the stop codon and a CfuI overhang at its 3’ terminus, resulting in a soluble protein that terminates at amino acid 194. After digestion with ClaI, the soluble DlD2 sequence was ligated into the CfaI site of pNPRAV. Purification of soluble ICAM-

proteins

Supernatants of CEF cells expressing soluble ICAMproteins were harvested and cellular debris pelleted by centrifugation at 1000 Xg for 5 min. Supernatants were centrifuged at 27,000 rpm for 3 h using a Beckman SW28 rotor. When necessary, clarified supernatants were concentrated 2-5 X using Centriprep 10 concentrators (Amicon, Danvers, MA). Soluble ICAMmolecules were purified by affinity chromatography using a column of purified MAb-lA6 coupled to

177

Affiprep-10 (Tomassini and Colonno, 1986) equilibrated in TBS (10 mM Tris-HCl, pH 7.5/0.15 M NaCl). After elution with 50 mM diethylamine, pH 11.5, the protein was neutralized with Tris-HCl, pH 7.5, to 200 mM and dialyzed against 0.1 X TBS overnight with one buffer change. The resulting proteins were concentrated lo-fold in a Speed Vat Concentrator (Savant, Farmingdale, NY) and protein concentrations determined by BioRad Protein Assay kit. Western blot analysis of soluble ICAM-I proteins

One microgram of purified sDl-5 previously expressed in the absence or presence of 100 pg/ml tunicamycin B, was loaded onto a 10% polyacrylamide gel, electrophoresed, and transferred to nitrocellulose using standard procedures. Western analysis of the transferred proteins was performed as previously described (Winston et al., 1991). A 1: 200 dilution of rabbit anti-1CAM-l antiserum served as the primary antibody followed by binding of alkaline phosphatase-conjugated goat anti-rabbit IgG (Cat. No. 605 200; Boehringer Mannheim Biochemicals, Indianapolis, IN) to the immunoblot. Specific proteins were detected using the BCIP/NBT phosphatase substrate system (Kirkegaard and Perry Laboratories, Inc., Gaithersburg, MD). Nitrocellulose binding assay

Purified, soluble ICAM- proteins, glycosylated sDl-5 and deglycosylated sDl-5 were bound to nitrocellulose membranes in a Bio-Dot apparatus (BioRad) according to the manufacturer’s protocol. After blocking nonspecific sites with 3% BSA in 50 mM Tris, pH 7.5/150 mM NaCl/0.03% NaN,, radiolabeled HRV-36 or HRV-2 was allowed to react with the bound proteins for 1-2 h at room temperature in phosphate buffered saline (PBS) containing 10 mM MgCl,. Supernatants were discarded and the wells washed 4 times with PBS. The filter was removed and individual dots were counted by liquid scintillation. Neutralization of HRV binding

Soluble ICAM- proteins, sDl-5 and sDl-2, or control buffer (0.1 ml) subjected to an identical purification scheme, were preincubated with [35S]methionine-labeled HRV-36 for 15 min. Culture medium was removed from duplicate wells of a 48-well plate containing confluent HeLa cells and replaced with the appropriate test solution. Binding was for 1 h at 34°C and determined as previously described (Register et al., 1991). Labeling of proteins and immunoprecipitation

Medium from subconfluent CEF monolayers was removed and the monolayers washed once with PBS. Fresh McCoy’s medium without methionine and cysteine was added for 1 h and then replaced with fresh McCoy’s medium containing 60

178

pCi/ml [“‘Slmethionine and [3”S]cysteine (EXPRE”“S3”S; Amersham, Arlington Heights, IL). Cultures were incubated X-16 h prior to harvesting. Cells were pelleted for 2 min in an Eppendorf centrifuge and supernatants preincubated with Protein A-agarose (Boehringer Mannheim Biochemicals, Indianapolis, IN) for 10 min at 4°C. Beads were removed by pelleting, and supernatants were transferred to new tubes containing 0.5 Fg of MAb-IA6 and allowed to react overnight at 4°C. Protein A-agarose was added and rotated 30 min at 4°C. Beads were washed 3 times with TBS containing 0.25% NP40 then once with TBS. An equal volume of 2 x Laemmli sample buffer was added and the beads were heated to 100°C for 3 min. An aliquot of each was counted and equal counts subjected to PAGE on 12.5% SDS gels and autoradiography.

Results Expression of truncated forms of ICAMA RSV expression vector was used to express native ICAM(Fig. 1A) on the surface of ICAM-l-negative CEF cells following transfection (Register et al.. 1991). Since this expression vector encodes a replication competent retroviral genome, infectious virus carrying the ICAMgene is released into the medium of transfected cells, spreading the viral infection throughout the cell monolayer. The

A. Expression Vector

B. ICAM-

Constructions L

ICAM

(01.5)

ICAMP-3)

Dl

H

02 I

D4

03 I

D5 TMCYTO

n

I

I

H__1_7__t-,,

I

.I -0’

ICAMP-2)

H-l--l-____ ---_.I

/-

pNPRAV/ICAM-1 lcAM(Dl)

H_3--_____

sDl-5

H

I

s

H

I

/-

--_.

rag I

I

I

tag Dl-2

Y

Fig. 1. Retroviral vector and ICAM-I constructs. (A) Schematic representation of the retroviral vector, pNPRAV/ICAM. showing the insertion site for ICAMsequences relative to viral structural genes (gag, group specific antigen; BH-pal, Bryan high titer polymerase; env, envelope) and the long terminal repeats (LTR). (B) Diagrams of constructed ICAMproteins. L = leader sequence. DI through D5 = extracellular domains, TM = transmembrane region, CYTO = cytoplasmic domain, and tag = stop codon.

179

TABLE HRV

1

binding

Transfected

pNPRAV ICAMICAMICAMICAM-

to transfected DNA

(Control) (Dl-51 (Dl-31 (Dl-2) (Dl)

CEF cells Relative

immunofluorescence

MAb-IA6

Polyclonal

_

_

+++ + _ _

+++ + _ _

”

% HRV-36

binding

’

+ MAb-lA6 2 21 6 2 2

to.41 (7.41 (1.11 (0.4) to.11

2 (0.21 l(O.11 2 (0.6) 1 (0.3) 2 (0.11

a Relative immunofluorescence is indicated as: -, no fluorescence observed over untransfected control cells; + + + , maximum fluorescence observed in full-length ICAMexpressing cells; +, intermediate fluorescence. h Standard deviations for binding assays are indicated in parentheses.

net result is expression of ICAMon the surface of virtually all cells within 3-4 days post transfection as monitored by visual observation of fluorescent stained cells using Mab lA6 as the primary antibody (data not shown). In addition, transfected cultures were tested for the presence of RSV p24 antigen in an ELISA assay. In all cultures tested, the levels of p24 were equivalent, strongly suggesting that each culture was infected equally (data not shown). A series of truncated forms of ICAMwas generated that retained the transmembrane region of the molecule for membrane anchorage (Fig. lB>. The ability of full-length and truncated molecules to serve as functional receptors was measured in binding studies using [ “5S]methionine-labeled HRV-36. CEF cells expressing ICAM(Dl-5) bound HRV-36, whereas cells transfected with a control plasmid (pNPRAV1 failed to bind virus (Table 1). Specificity of HRV-36 binding was demonstrated by the ability of anti-1CAM-l MAb-lA6 (Colonno et al., 1986) to block virus attachment. Cells transfected with the Dl-3 construct exhibited a reduced level of immunofluorescence and a concomitant reduction in virus binding activity (Table 1). However, the HRV binding detected was credible since the observed binding could be blocked by MAb-lA6. A more drastic reduction in expression levels was observed when CEF cells were transfected with plasmids encoding the truncations Dl-2 and Dl. ICAMwas not detected on the surface of transfected CEF cells by either MAb-lA6 or polyclonal anti-ICAMantiserum (Table 1). The reduced expression levels of Dl-2 and Dl remain unexplained, but are not the result of reduced transcription levels since equivalent levels of ICAMspecific mRNA for each of the membrane anchored truncations, including the non-expressing truncations, were detectable by Northern blot analysis (data not shown). Similar expression efficiencies were observed following attempts to express the shorter ICAMmolecules in other receptor negative cell lines such as Vero cells (unpublished data). A previous report indicated that a membrane bound deletion mutant of ICAMcontaining domains 1 and 2 is detectable when expressed in COS cells (Staunton et al., 1990). However, their construct of domains 1 and 2 of ICAM-

01 0.0

/ 0.2

I

0.4

I

0.6

I

0.6

I

1.0

I

1.2

I

1.4

I

1.6

I

I .a

Micrograms Added Fig. 2. Neutralization of virus binding by soluble ICAMproteins. Purified, radiolabeled HRV-36 or HRV-2 was mixed with the indicated amounts of purified full-length (D ). sDlD2 (0). or buffer control ( A 1 prior to binding studies on HeLa cell monolayers (Abraham and Colonno, 1984).

was actually a chimeric molecule composed of domains 1 and 2 of ICAMand the transmembrane and cytoplasmic regions of ICAM-2. No results of a similar deletion mutant utilizing ICAMtransmembrane and cytoplasmic regions, as we have attempted, were discussed. In an effort to circumvent the block in expression of the smaller membrane anchored truncations, soluble forms of ICAMwere constructed, expressed, and purified by immunoaffinity chromatography as described in Materials and Methods. The sDl-2 fragment was now detectable, although the amount of expressed sDl-2 protein was some 20-fold lower than the sDl-5 protein (0.1 vs. 2.0 pg/ml supernatant). Both proteins appeared to be glycosylated based on their reduced migration during PAGE compared to in vitro translated (unglycosylated) proteins (data not shown). Previous studies have utilized a neutralization assay to show that soluble ICAMreceptors are functional (Marlin et al., 19901. We employed a similar assay to test purified, soluble ICAMproteins for their ability to neutralize the binding of radiolabeled HRV-36 to HeLa cells. Both the sDl-5 and sDl-2 forms of ICAMwere capable of neutralizing HRV-36 binding in a concentration-dependent manner (Fig. 2). A 50% reduction in virus binding was achieved using 0.3 pg (50 nM) of sDl-5, while 0.5 ,ug (220 nM) of sDl-2 was required for comparable inhibition (Fig. 2). The ability of the sDl-2 truncated form of ICAMto effectively neutralize virus binding at molar concentrations only 4-fold higher than full-length ICAMsuggested that soluble receptor containing only the first 2 domains can serve efficiently as viral receptor. To ensure that neutralization of viral binding reflected binding of soluble receptors to HRVs, a functional binding assay was also developed. Soluble ICAMproteins were bound to nitrocellulose filters and the resulting filters assayed for their ability to support HRV binding. Results (Fig. 3, section A) showed that filter bound ICAMwas capable of

181

2500-

2000-

1500-

A) Glycosylated Soluble ICAMB) Deglycosylated Soluble ICAMC) IgG Control

z 0 1 ooo-

500-

O-

A

B

C

Fig. 3. Virus binding to filter bound soluble 1CAM-l proteins. Soluble, glycosylated sDl-5 ICAM(A), unglycosylated sDl-5 ICAM(B), or control IgG protein (C) was bound to nitrocellulose in a BioRad Bio-Dot apparatus and used in binding studies with radiolabeled HRV-36 (open bars), HRV-36 in the presence of MAb-lA6 (shaded bars), or HRV-2 (solid bars). The amount of radioactivity retained on the filters after washing is indicated.

specifically binding major group HRVs as evidenced by the inhibition of binding in the presence of MAb-lA6 and the inability to bind the minor group serotype HRV-2. We have also attempted to express a soluble form of ICAMcontaining only domain 1 without success. The inability to express domain 1 alone remains unexplained. Role of carbohydrates in virus binding to ICAM-I An earlier observation that deglycosylated ICAMisolated from detergentsolubilized HeLa cells failed to bind virus in a virus pelleting assay (Lineberger et al., 1990) suggested that carbohydrates may play a role in virus-receptor interaction. Since it is clear from the truncation studies above that ICAMmolecules containing only domains 1 and 2 can serve as receptor, the role of the 4 N-linked carbohydrate attachment sites within domain 2 was examined. Each site was eliminated either individually or simultaneously by mutagenesis and the resulting constructs expressed in CEF cells. Relative levels of expression were measured by the ability of transfected CEF cells to bind radiolabeled MAb-lA6. The individual mutant proteins, CHOl, CH02, CH03, and CH04, representing the Asn to Leu change at amino acids 103, 118, 156 and 175, respectively, were expressed at levels equal to or greater than the native ICAMcontrol (Table 2). Mutant CHOl-4, containing all 4 single-site mutations, was expressed at significantly lower levels (10% of control ICAM-1) with virus binding reduced proportionately to 7% of control values (Table 2).

182 TABLE HRV Mutant

CHOl CH02 CH03 CH04 CHOl-4

2

binding

to ICAM-

carbohydrate

mutants

Q of control

binding

“

[“S]HRV-36

[“51]1A6

162 98 227 114 7

113 92 143 103

IO

‘I The percent of [“S]HRV-36 binding to cells expressing control ICAM-I was 20-50s with standard deviations within f 1%. Standard deviations of mutant binding assays, except CHOl-4, were within the range of the control binding. The standard deviation of CHOl-4 binding assays was + 5%‘. Similar results were obtained in assays measuring binding of [“sI]lA6 to control and mutant ICAM-I proteins.

kd

98 69

46

Fig. 4. Soluble ICAMsDl-5 in the absence and presence of tunicamycin. Purified, soluble SDl-5 expressed in the absence (lane 1) and presence (lane 2) of tunmicamycin was electrophoresed through a 10% polyacrylamide denaturing gel and transferred to nitrocellulose for Western blot analysis as described in Materials and Methods.

183

To explore the role of carbohydrates further, CEF cells expressing the soluble form of full-length ICAMwere treated with 100 pg/ml tunicamycin B, homolog prior to isolation and purification of soluble receptor (Duksin and Mahoney, 19821. Tunicamycin treatment resulted in the expression of a deglycosylated form of sDl-5 protein as determined by its migration on SDS-PAGE gels (Fig. 4). In the absence of tunicamycin, soluble sDl-5 is expressed as a mixture of heterogeneous molecular weights ranging from 47 to 70 kDa (Fig. 4, lane 1). In contrast, soluble sDl-5 expressed in the presence of tunicamycin migrated as a major band at 47 kDa and minor bands of slightly higher molecular weight (Fig. 4, lane 2). Since glycoproteins typically migrate as heterogeneous bands on SDS-PAGE gels and as the heterogeneity of sDl-5 was drastically reduced in the presence of tunicamycin, we believe that the deglycosylated form of sDl-5 does not contain the majority of the carbohydrate associated with the glycosylated form. After binding to nitrocellulose, the deglycosylated form of ICAMretained its ability to bind the major group virus, HRV-36 (Fig. 3, section B). The binding activity was specific since no binding was observed in the presence of the blocking MAb-lA6. In addition, a control IgG protein did not react with labeled virus (Fig. 3, section 0. These data, together with the above results, strongly suggest that carbohydrates are not directly involved in binding of major group rhinoviruses to ICAMreceptors.

Discussion The vast majority of HRV serotypes has been assigned to a single receptor family, designated the major HRV group, based on competition binding and immunological studies (Colonno et al., 1986; Uncapher et al. 1991). This group of HRVs exhibits an absolute dependence on a single cellular receptor, identified as ICAM-1, for entry into susceptible cells (Colonno et al., 1986). To a large degree, the presence or absence of ICAMreceptors determines the host range for this group of HRVs. ICAMis structurally related to other members of the immunoglobulin supergene family, such as the CD4 receptor of HIV and the immunoglobulin-like protein recently identified as the cellular receptor for poliovirus. The CD4 receptor is postulated to have 4 domains, while the poliovirus receptor is projected to have 3 homologous immunoglobulin-like domains (Mendelsohn et al., 1989; Littman and Gettner, 1987). ICAMcontains 5 extracellular domains and displays significant sensitivity to conformational and structural alterations. As illustrated in Table 1, elimination of domains in the generation of smaller membrane bound ICAMmolecules results in decreased expression levels directly proportional to the size of the receptor protein. In fact, the smallest truncations could not be detected. Since mRNA levels appear to be equivalent for all of the constructs, the decreased expression levels appear to be the result of membrane instability or inefficient maturation. The former appears more likely based on the finding that removal of the transmembrane portion of the receptor results in increased expression of the

184

shorter fragments. However, we were still unable to recover domain 1 alone regardless of the expression strategy used. The ability of ICAMto interact with HRVs and HRV blocking MAbs is conformation dependent. Using fragments of the ICAMreceptor that were generated by in vitro transcription and cell-free translation, Lineberger et al. (1990) showed that the binding sites of 3 blocking MAbs recognized an ICAMfragment containing only the N-terminal 82 amino acid residues. It was noted in these studies that microsomal membranes were required during translation for proper folding and/or glycosylation since immunoprecipitation experiments showed that only the proteins that had transversed the membranes were immunoprecipitated by each of the MAbs tested (Lineberger et al., 1990). This was also true for the shortest ICAMfragment (82 amino acids), which has no predicted glycosylation sites, and further suggests that insertion into membranes confers a conformational effect on in vitro synthesized ICAM-1. Human/murine chimeras have been most useful in mapping the region of ICAMinvolved in HRV binding and have taken advantage of the finding that murine cells, which express an ICAMhomolog, fail to bind the major group HRVs (Colonno et al., 1986; Uncapher et al., 1991). Chimera expression studies have indicated that murine ICAMmolecules, containing the first 168 amino acids (domain 1 and all but 17 residues of domain 2) or just the first 88 amino acids (domain 1) of the human sequence, were capable of binding the major group viruses (Staunton et al., 1990; McClelland et al., 1995). Subsequent studies involving human/murine chimeras have identified 5 amino acids in domain 1 (Pro 28, Lys 29, Leu 30, Ser 67, and Pro 70) that are crucial for interaction with several major group HRVs (Register et al., 1991). In addition, studies have also mapped the binding sites of 4 MAbs capable of blocking major group HRV binding to 3 distinct regions within domain 1 (McClelland et al., 1991; Register et al., 1991). The mutagenesis data support the anti-parallel, beta barrel model proposed for domain 1 (Giranda et al., 1990; Register et al., 1991). In this model, the amino acid residues important for MAb-lA6 binding are localized to one face of the domain while amino acids that interact with HRVs and other MAbs cluster to the N-terminal region of domain 1. This alignment of key amino acid residues also implies that the N-terminal portion of domain 1 is the region of human ICAMthat interacts with the virion canyon. Spatial considerations appear to support this hypothesis, since docking of domain 1 structure appears to involve approximately one-half of domain 1 (Giranda et al., 1990; Register et al., 1991). These studies indicate that the specificity for HRV binding resides within the first domain. However, studies involving soluble forms of ICAMsuggest that domain 2 is required to generate active fragments capable of neutralizing virus binding (Fig. 2; McClelland et al., 1991). The fact that the human and murine ICAMreceptors are nearly identical in size and play a similar functional role suggests that they both have similar structural features. It is possible that the domain 2 region of both human and murine ICAMmolecules may be interchangeable in fulfilling a structural requirement needed for domain 1 to be functional. This hypothesis is supported by recent crystallographic studies on the

185

CD4 receptor that showed domains 1 and 2 of CD4 in close contact with each other (Ryu et al., 1990; Wang et al., 1990). Since domain 2 of both human and murine ICAMis glycosylated, the role of carbohydrates in viral attachment was subsequently assessed by removing each of the 4 glycosylation sites found in domain 2. Results (Table 2, Fig. 3) showed that elimination of the 4 sites individually or together (McClelland et al., 1991) by mutagenesis had no effect on the ability of ICAMto bind HRVs. In addition, isolation of an unglycosylated form of soluble ICAMfrom cells treated with tunicamycin resulted in a receptor molecule still capable of both binding and neutralizing virus (Fig. 3; McClelland et al., 1991). However, the expression and/or stability of unglycosylated forms of ICAMwere severely diminished, and may account for initial indications that carbohydrates play a role in virus binding (Lineberger et al., 19901. Clearly, much work remains to be done to define the complex interactions that occur between HRVs and their cellular receptors. Future studies involving the co-crystallization of functional ICAMfragments with HRVs will greatly enhance our understanding of these interactions.

References Abraham, G. and Colonno, E.J. (1984) Many rhinovirus serotypes share the same cellular receptor. J. Virol. 51, 340-345. Colonno, R.J., Callahan, P.L. and Long, W.J. (1986) Isolation of a monoclonal antibody that blocks attachment of the major group of human rhinoviruses. J. Viral. 57, 7-12. Colonno, R.J., Condra, J.H., Mizutani, S., Callahan, P.L., Davies, M.E. and Murcko, M.A. (1988) Evidence for the direct involvement of the rhinovirus canyon in receptor binding. Proc. Natl. Acad. Sci. U.S.A. 85, 5449-5433. Duksin, D. and Mahoney, M.A. (1982) Relationship of the structure and biological activity of the natural homologues of tunicamycin. J. Biol. Chem. 257, 3105-3109. Garber, E.A., Chute, H.T., Condra, J.H., Gotlib, L., Colonno, R.J. and Smith, R.G. (1991) Avian cells expressing the murine Mxl protein are resistant to influenza virus infection. Virology 180, 754-762. Giranda, V.L., Chapman, M.S. and Rossmann, M.G. (1990) Modeling of the human intercellular adhesion molecule-l, the human rhinovirus major group receptor. Proteins: Structure, Function, Genet. 7, 227-233. &eve, J.M., Davis, G., Meyer, A.M., Forte, C.P., Yost, S.C., Marlor, C.W., Kamarck, M.E. and McClelland, A. (1989) The major human rhinovirus receptor is ICAM-1. Cell 56, 839-847. Gwaltney, J.M. Jr. (1982) Viral Infection of Man. Epidemiology and Control, pp. 491-517. Kingston, R.E., Chen, C.A. and Okayama, H. (1991) Transfection of DNA into eukaryotic cells. In: F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl (Eds.), Current protocols in Molecular Biology, Vol. 1, pp. 9.1.1-9.1.3. Greene, New York. Lineberger, D.W., Graham, D.J., Tomassini, J.E. and Colonno, R.J. (1990) Antibodies that block rhinovirus attachment map to domain 1 of the major group receptor. J. Virol. 64, 2582-2587. Littman, D.R. and Gettner, S.N. (1987) Unusual intron in the immunoglobulin domain of the newly isolated murine CD4 (L3T4) gene. Nature 325, 453-455. Makgoba, M.W., Sanders, M.E., Ginther Lute, G.E., Gugel, E.A., Dustin, M.L., Springer, T.A. and Shaw, S. (1988) Functional evidence that intercellular adhesion molecule-l (ICAM-I) is a ligand for LFA-l-dependent adhesion in T cell-mediated cytotoxicity. Eur. J. Immunol. 18, 637-640.

IX6 Marlin,

SD.,

Staunton,

D.E.,

Springer. T.A.,

A soluble form of intercellular McClelland,

A., DeBear,

tion of monoclonal intercellular Mendelsohn.

Stratowa.

C.. Sommergruber.

W. and Merluzzi.

adhesion molecule-l

inhibits rhinovirus

infection,

J.. Yost. SC., antibody

adhesion molecule C.L..

Wimmer,

cloning, nucleotide

Meyer.

epitopes

A.M.,

C.W.

and Greve.

residues for rhinovirus

1. Proc. Natl. Acad. Sci. U.S.A.

E. and Racaniello,

sequence,

Marlor,

and critical

V.J. (lY90)

Nature

334, 70-72.

J.M. (IYYI) binding

Identifica-

in domain

I of

88. 7YY3-7YY7.

V. (IYXX) Cellular

and expression of a new member

receptor

for poliovirus:

of the immunoglobulin

molecular

superfamily.

Cell 56, X55-X65. Mischak,

H.C.,

rhinovirus Register.

Neubauer.

C., Bergcr,

minor group receptor

R.B.,

Uncapher.

Human/murine

C.R.,

chimeras

of

antibody binding. J. Viral. Ryu, S.-E.,

Kwong,

P.D.,

nant fragment Staunton,

D.E..

families,

Cell 52. 925-Y%.

D.W.. D.W..

Nature

interaction

Merluzzi,

adhesion molecule, Staunton,

A., Porter,

S.D., Stratowa.

demonstrates

Staunton.

A.M.,

Dustin,

amino

T.G.. W.A.

D.W.

acid

of the human

hY, 2653-2656.

and

residues

Colonno,

critical

Arthos.

J., Rosenberg,

for

R.J.

(IYYI)

rhinovirus

and

of an HIV-hinding

N.-H..

recombi-

34X. 3lY-176.

between

M.L.

and Springer, T.A. (IYXX) Primary structut-e 01

members of the immunoglobulin

R.. Barton.

R., Marlin,

is the major surface receptor

M.L.,

M., Dai. X.. Xuong,

(IYYO) Crystal structure

c‘.. Dustin.

V.J.. Rothlein,

ICAM-I.

immunoglobulin-like

Detection

blots. J. Gen. Viral.

Lineberger,

identity

and Hendrickson,

ICAM-I

E. and Blass, D. (IYXX)

Western

65, 65X0-65%.

of human CD4.

Marlin

Naylor. 1CAM-l

Truneh.

Axel, R., Sweet. R.W.

B.. Kuechler.

on renaturing

Erickson.

1I.P.

domains of ICAM-

and integrin supergene

S.D. and Springer.

for rhinoviruses.

and Springer.

T.A.

T.A. (IYXY) A cell

Cell 56. 84Y-853.

(IYYO) The

and the binding sites for LFA-I

arrangement

of the

and rhinovirus.

Cell hl.

243-754. Tomassini,

J.E.

and Colonno.

human rhinoviruses. Tomassini, cDNA

J.E.. Graham. cloning

Uncapher.

C.R.,

T.R.

C.M..

for rhinovirus

attachment.

Dewitt,

and Colonno,

J.. Yan.

Rcinherz,

Y.,

Garrett.

two immunoglobulin-like Watkins.

S. (1901)

Brent.

R.E.

Kingston,

F.E.

SE..

Fuller.

Kingston.

Molecular

domains.

D.D.

Biology,

D.D.

involved

in attachment

of

on IIeLa

R.J. (IYXY,)

cells is intercellular

I. characterization

of a glycopro-

J. Biol. Chem. 264, lhS6-1662. R.J. (199 I) The major and minor group receptor

serotype. Virology

Nature

Moore,

Rodkey. J.A. and Colonno. receptor

86. 4YO7-4Yl

Liu. J.. Rodgers.

D.W..

Garlick,

R.L..

Tarr.

G.E..

Husain.

Y..

of human CD4 containing

34X. 41 ll3lX.

labeling J.G. J.G.R.

J.G. Seidman.

families

180, X14&317.

structure of a fragment

of cells grown as monolayers. Seidman.

J.A.

Biology. Vol. 2. pp. 14.6.1-14.6.2.

S.A. and Hurrell. Moore,

protein

R.J. (IYXYb) Biochemical

S.C. (1900) Atomic

Immunotluorescent

Protocols in Molecular Winston,

T.P.J..

E.L. and Harrison,

D.W..

rhinovirus

Acad. Sci. U.S.A.

contain all but one human rhinovirus Wang.

group

and Colonno.

C.M.

of a receptor

Lineberger.

the major

I. Proc. Natl.

J.E., Maxson.

tein required

that

Isolation

5X. 2YO-2%.

D. Dewitt.

reveals

adhesion molecule Tomassini.

R.J. (19%)

J. Viral.

(1901)

Smith

Greene.

Western

and

NW York.

Ausubel.

(Eds.).

R.

Current

New York.

blotting.

In: F.M.

J.A. Smith and K. Struhl (Eds.),

Vol. 2. pp. 10.X.1-10.X.6. Greene,

In: F.M.

K. Struhl

Ausubel.

Current

R. Brent.

Protocols

in