Signal Transduction: Down-regulation of Cyclooxygenase-2 by the Carboxyl Tail of the Angiotensin II Type 1 Receptor Rapita Sood, Waleed Minzel, Gilad Rimon, Sharon Tal and Liza Barki-Harrington J. Biol. Chem. 2014, 289:31473-31479. doi: 10.1074/jbc.M114.587576 originally published online September 17, 2014

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 21 references, 12 of which can be accessed free at http://www.jbc.org/content/289/45/31473.full.html#ref-list-1

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

Access the most updated version of this article at doi: 10.1074/jbc.M114.587576

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 45, pp. 31473–31479, November 7, 2014 © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

Down-regulation of Cyclooxygenase-2 by the Carboxyl Tail of the Angiotensin II Type 1 Receptor* Received for publication, June 7, 2014, and in revised form, September 9, 2014 Published, JBC Papers in Press, September 17, 2014, DOI 10.1074/jbc.M114.587576

Rapita Sood‡, Waleed Minzel‡, Gilad Rimon§, Sharon Tal‡, and Liza Barki-Harrington‡1 From the ‡Department of Human Biology, Faculty of Natural Sciences, University of Haifa, Haifa, Israel 3498838 and § Department of Clinical Biochemistry and Pharmacology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Be’er-Sheva 84105, Israel Background: The levels of the pro-inflammatory enzyme COX-2 require tight regulation. Results: The carboxyl tail of Angiotensin II type 1 receptor (AT1) enhances COX-2 degradation. Conclusion: We identified a novel mechanism for COX-2 regulation that is independent of receptor activation. Significance: The tail sequence of AT1 may serve as a basis for design of novel therapeutic agents that degrade COX-2.

Prostaglandins are bioactive lipids that function as major regulators of cardiovascular homeostasis. They are derived from a common H2 prostaglandin endoperoxide (PGH2), a metabolite of arachidonic acid (AA)2 that is formed by the ratelimiting enzyme cyclooxygenase (COX). COXs exist in two main isoforms, COX-1 and COX-2 that reside on the luminal surfaces of the endoplasmic reticulum and the inner and outer membranes of the nuclear envelope (1). Both isoforms display similar catalytic mechanisms but differ in their expression pat-

* This work was supported by the United States Israel Binational Science Foundation Grant 2009246 (to L. B. H.). To whom correspondence should be addressed: Dept. of Human Biology, Faculty of Natural Sciences, University of Haifa, 199 Aba Khoushy Ave. Mt. Carmel, Haifa, 3498838, Israel. Tel.: 972-4-8288776; Fax: 972-4-8288763; E-mail: [email protected]. 2 The abbreviations used are: AA, arachidonic acid; COX-2, cyclooxygenase-2; AT1, Angiotensin II type 1 receptor; AngII, Angiotensin II; CT, carboxyl tail. 1

NOVEMBER 7, 2014 • VOLUME 289 • NUMBER 45

terns. COX-1 is expressed almost ubiquitously and fulfills many housekeeping functions, while COX-2 is usually absent from most tissues but undergoes a rapid and transient increase of expression by a broad range of pathological stimuli (2). As such, inhibition of its activity by non-steroidal anti-inflammatory drugs (NSAIDs) is one of the most common therapeutic targets for treatment of inflammation. However, COX-2 is also normally expressed in some tissues where it has some important physiological roles. In the kidney, the products of COX-2 catalysis increase the generation of the vasoconstricting hormone angiotensin II (AngII), which in turn down-regulates the expression of COX-2, mainly through activation of the angiotensin II type 1 receptor (AT1) (3, 4). The AT1 receptor belongs to the super-family of G proteincoupled receptors (GPCRs) that relay signals by activating heterotrimeric G proteins, followed by second-messenger-mediated intracellular signaling. Studies in the last decade showed that AT1 signals through two distinct signaling pathways, whereby binding of ligand initiates activation of G proteins, but quickly thereafter switches to ␤ arrestin-mediated, G proteinindependent pathways (reviewed in (5)). Coupling of AT1 to G proteins is mediated primarily through a DRY motif located in the third intracellular loop of the receptor. Mutation of this motif abrogates coupling to G proteins but ␤ arrestin recruitment and activation of the ERK MAP kinase pathway remains intact (6). In contrast, the absence of certain phosphorylation sites in the carboxyl tail (CT) of AT1 prevents ␤ arrestin-mediated signaling while preserving the G-protein pathway (7). Elevated levels of COX-2 are characteristic of many types of chronic ailments suggesting that tight regulation of its levels is critical for normal physiological function. Whereas the signaling cascades that lead to the induction of COX-2 are well-studied (8), there is much less information about the regulatory pathways that mediate its degradation. In the absence of its major substrate AA, COX-2 undergoes continuous turnover by shuttling from the endoplasmic reticulum to the cytosol via the ER-associated degradation (ERAD) pathway, where it is subsequently degraded by the proteasome (9). Degradation of COX-2 in the proteasome is preceded by its polyubiquitination (10), and was recently shown to be facilitated by caveolin-1 (11) and also through its interaction with the GPCRs, prostaglandin JOURNAL OF BIOLOGICAL CHEMISTRY

31473

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

The enzyme cyclooxygenase-2 (COX-2) plays an important role in the kidney by up-regulating the production of the vasoconstrictor hormone angiotensin II (AngII), which in turn down-regulates COX-2 expression via activation of the angiotensin II type 1 receptor (AT1) receptor. Chemical inhibition of the catalytic activity of COX-2 is a well-established strategy for treating inflammation but little is known of cellular mechanisms that dispose of the protein itself. Here we show that in addition to its indirect negative feedback on COX-2, AT1 also down-regulates the expression of the COX-2 protein via a pathway that does not involve G-protein or ␤-arrestin-dependent signaling. Instead, AT1 enhances the ubiquitination and subsequent degradation of the enzyme in the proteasome through elements in its cytosolic carboxyl tail (CT). We find that a mutant receptor that lacks the last 35 amino acids of its CT (⌬324) is devoid of its ability to reduce COX-2, and that expression of the CT sequence alone is sufficient to down-regulate COX-2. Collectively these results propose a new role for AT1 in regulating COX-2 expression in a mechanism that deviates from its canonical signaling pathways. Down-regulation of COX-2 by a short peptide that originates from AT1 may present as a basis for novel therapeutic means of eliminating excess COX-2 protein.

The Carboxyl Tail of AT1 Down-regulates COX-2 E1 (EP1), and ␤1 adrenergic (␤1AR) receptors (12, 13). Here we set to explore whether, in addition to the known negative feedback loop between angiotensin II and COX-2, there is an additional mechanism for down-regulating COX-2 expression by AT1, and to identify the domains of the receptor that mediate this effect.

31474 JOURNAL OF BIOLOGICAL CHEMISTRY

VOLUME 289 • NUMBER 45 • NOVEMBER 7, 2014

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

EXPERIMENTAL PROCEDURES Materials—Goat polyclonal anti-COX-2 (C-20), mouse monoclonal anti- ubiquitin (P4D1), goat polyclonal anti-actin (I-19), rabbit polyclonal anti-pERK (Thr202/Tyr204), mouse monoclonal anti-ERK (D-2), mouse monoclonal anti-c-Myc (9E10), and mouse monoclonal anti-GAPDH (G-9) were obtained from Santa Cruz Biotechnologies (Santa Cruz, CA), as was N-methylmaleimide (NEM). Mouse monoclonal antiHA.11 was from Covance (Emeryville, CA). Mouse monoclonal anti-GFP was from MBL International Corporation (Woburn, MA). Horseradish peroxidase-conjugated bovine anti-goat IgG, goat anti-rabbit IgG, and goat anti-mouse IgG were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA). Alexa Fluor 647 (Cy5) donkey anti-goat IgG for microscopy imaging experiments was obtained from Invitrogen (Carlsbad, CA). PGE2 Rabbit antisera for radioimmunoassays and 1-Oleoyl-2-acetyl-sn-glycerol (OAG) and rabbit polyclonal anti-FLAG (F7425) were purchased from Sigma Aldrich (Rehovoth, Israel). Tritium-labeled PGE2 (190 Ci/mmol) was obtained from Perkin Elmer (Waltham, MA). (s)-MG132 was from Cayman Chemical (Ann Arbor, MI). GF109203X (GFX) was from Tocris Bioscience (Bristol, UK). All other reagents were standard laboratory grade. Cell Culture and Transfection—HEK-293 cells were grown in Eagle’s MEM media, supplemented with 10% fetal bovine serum and 100 units/ml penicillin and streptomycin. Transient transfections were carried out in subconfluent (70 – 80%) monolayers using PolyJet (SignaGen Laboratories) at a ratio of 1:3 cDNA: PolyJet, according to the manufacturer’s instructions. All samples contained the same amount of total cDNA. cDNA Constructs—pcDNA5/FRT/TO encoding human COX-2 and G533A COX-2 were gift from Prof. William L. Smith, University of Michigan. DRY/AAY AT1 was a gift from Prof. L. Hunyady, Semelweis University, Hungary. HA-AT1, FLAG-AT1, GFP-AT1, AT1TSTS/A, and ⌬324 AT1 were a gift from R. J. Lefkowitz, Duke University Medical Center. Cloning of fluorescent versions of COX-2, wild type, AT1TSTS/A, and DRY/AAY AT1 mutants was done as follows: COX2-YFP: Forward 5⬘-ATTAAGCTTATGCTCGCCCGCGCCCTG-3⬘ and reverse 5⬘-ATTGGATCCTTCAGTTCAGTCGAACGTTC-3⬘ and inserted into pEYFP-N1 vector (Clontech) between BamHI and HindIII sites. The following constructs were cloned into pECFP-N1 between Xhol and BamHl sites; CFP-AT1: forward primer 5⬘-ATACTCGAGATGGCCCTTGACTCTTCT-3⬘ and reverse primer 5⬘-ATAGGATCCCGCTCCACCTCAAAAC-3⬘; CFP-TSTS/A AT 1 : forward primer 5⬘-ATACTCGAGATGGCCCTTGACTCTTCT-3⬘ and the reverse primer 5⬘-ATAGGATCCCGCTCCACCTCAAAAC-3⬘; CFP-DRY/AAY AT1: forward 5⬘-ATACTCGAGATGGCCCTTGACTCTTCT-3⬘ and the reverse primer 5⬘-ATAGGATCCCGCTCCACCTCAAAAC-3⬘.

CFP- AT1 carboxyl tail (CT; amino acids 325–359) was cloned using the oligo overlap cloning method into pECFP-N1 vector (Clontech) between EcoRI and BamHI sites using the overlapping primers: 5⬘-AATTCTAAGTCCCACTCAAGCCTGTCTACGAAAATGAGCACGCTTTCTTACCGGCCTTCGG ATAACATGAGCTCATCGGCCAAAAAGCCTGCGTCTTGTTTTGAGGTGGAGTGAG-3⬘ and 5⬘-GATCCTCACTCCACCTCAAAACAAGACGCAGGCTTTTTGGCCGATGAGCTCATGTTATCCGAAGGCCGGTAAGAAA GCGTGCTCATTTTCGTAGACAGGCTTGAGTGGGACTTAG-3⬘. His-Myc tagged AT1- CT was cloned using the gBlocks Gene Fragment: AACGGCGGATCCACCATGGCCAAGTCCCACTCAAGCCTGTCTACGAAAATGAGCACGCTTTCTTACCGGCCTTCGGATAACATGAGCTCATCGGCCAAAAAGCCTGCGTCTTGTTTTGAGGTGGAGAAGCTTGGCCTT. The fragment was designed to carry BamHI and HindIII restriction sites (bold) and a Kozak translation initiation sequence (underline). Cloning was performed using the standard manufacturer’s protocol. All constructs were confirmed by restriction digestion analysis and sequenced at the core sequencing facilities of the Technion Israel Institute of Technology and Hylabs (Rehovoth, Israel). Immunoprecipitation and Immunoblotting—Monolayers in 100-mm culture dishes were washed twice with ice-cold PBS and lysed exactly as we had done before (13). Nitrocellulose membranes containing the immuno-complexes or total cell lysate proteins were incubated with primary antibodies at a dilution of 1:500 (COX-2 and HA), and 1:250 for Ub. Proteins were visualized by a WesternBright ECL (Advansta, CA) and quantified using a CCD camera and Quantity One software (XRS, Bio Rad). Radioimmunoassay—Cells were plated in 12-well dishes and transfected with COX-2, with either empty plasmin (pcDNA3.1) or AT1, as indicated above. Radioimmunoassays were performed in triplicates exactly as described (13). Protein levels were measured in each well, and PGE2 ng/mg protein was determined. Samples in each experiment were normalized against the controls that contained only COX-2, and data are presented as fold change in PGE2 production obtained from different experiments. Flow Cytometry—Cells were washed twice with PBS, and resuspended in 150 –200 ␮l of PBS for cytometric analysis. All experiments were performed in triplicates. The samples were analyzed using BD FACSCanto II flow cytometer with DACSDiva software (BD Biosciences, San Jose, CA), as described (13). Microscopy—Cells were grown on 13-mm glass coverslips. Following transfection, cells were fixed with 4% paraformaldehyde, washed with PBS and blocked in PB buffer (1% BSA and 0.1% Triton X-100) for 5 min. Samples were then incubated with anti-COX-2 (1:200) for 1 h, washed three times with PBS, and incubated with Alexa Fluor 647 donkey anti-goat IgG (1:200) for 1 h. Following an additional three washes with PBS, samples were mounted onto glass slides using Mowiol (Sigma Aldrich) and visualized under an ApoTome.2 laser scanning confocal microscope (Zeiss) at a 63⫻ magnification. All images were acquired using the same exposure conditions. Statistical Analysis—Experiments shown are mean ⫾ S.E. for data averaged from at least three independent experiments. To

RESULTS

NOVEMBER 7, 2014 • VOLUME 289 • NUMBER 45

1.0 0.8 0.6 0.4 0.2 0

1.0 0.8 0.6 0.4 0.2 0

Mock AT1

COX-2

1.2

AT1

Mock AT1

COX-2 + AT1

Cy5

GFP

FIGURE 1. AT1 receptor lowers COX-2 expression. A, HEK 293 cells were transfected with COX-2 and either empty vector (Mock) or HA-AT1 at a ratio of 1:5. 36 h post-transfection cells were stimulated with 50 ␮M AA for 30 min. The culture medium was collected and probed for PGE2 production by RIA (n ⫽ 4, in triplicates). B, HEK 293 cells were transfected with YFP-COX-2 and HA-AT1 as in A, and levels of YFP COX-2 were analyzed by flow cytometry. C, expression of COX-2 (cy5) and GFP-AT1 was analyzed by fluorescent microscopy. D, effect of CFP-AT1 on YFP-tagged COX-1 or COX-2 was measured in the presence of increasing levels of CFP-AT1 at the indicated ratios. Total DNA levels were equal in all samples (n ⫽ 4).

To further exclude the involvement of possible downstream signaling by AT1 in its effect on COX-2, we inhibited PKC, the major downstream protein kinase activated by AT1. Cells were transfected with COX-2 in the presence or absence of AT1 and treated with different concentrations of the PKC inhibitor GFX for the full duration of transfection. As depicted in Fig. 2D, this treatment did not reverse the reduction caused by AT1. A similar result was obtained using OAG, another potent inhibitor of PKC (data not shown). Coupling of the AT1 receptor to G-proteins and ␤ arrestin is mediated via specific motifs on the receptor. Thus, G protein coupling to AT1 is abolished by mutating the highly conserved DRY sequence to AAY, and association with ␤ arrestin is defecJOURNAL OF BIOLOGICAL CHEMISTRY

31475

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

The AT1 Receptor Down-regulates the Expression of COX-2— To test whether expression of the AT1 receptor affects COX-2, HEK293 cells were co-transfected with COX-2 together with either empty plasmid or the receptor, and analyzed for the ability of COX-2 to generate PGE2. Since HEK 293 cells do not express detectable amounts of either COX isoform, the data reflect only the activity of transfected COX-2 (13). As depicted in Fig. 1A, co-transfection of COX-2 with AT1 at a ratio of 1:5 reduced PGE2 secretion by nearly half. To find out whether this decrease is due to diminished COX-2 levels, we used flow cytometry to analyze the levels of YFP-tagged COX-2 in the absence or presence of AT1. Co-expression of both proteins under the same conditions as the RIA experiment resulted in a marked 80% reduction in COX-2 expression (Fig. 1B), suggesting that most of the reduction in PGE2 secretion may be attributed to a reduction in COX-2 levels. Consistent with this, immunofluorescence microscopy showed that compared with co-expression with an empty plasmid, the expression of YFPCOX-2 is severely down-regulated in the presence of GFP-AT1 (Fig. 1C). To test whether AT1 has a similar effect on the expression of COX-1, we expressed either COX-1 or COX-2 together with increasing amounts of CFP-AT1. The total DNA levels were kept the same at all times. As shown in Fig. 1D, while increasing the levels of AT1 caused a marked drop in COX-2 levels, it did not have a significant effect on the levels of COX-1. Down-regulation of COX-2 by AT1 Is Not Mediated via Classical Signaling Pathways—We next sought to determine whether the effect of AT1 on COX-2 is mediated via its classical signaling pathways (6). First, we expressed COX-2, AT1, or both in HEK 293 cells, stimulated them with the AT1 ligand AngII, and measured COX-2 levels and phosphorylation of the ERK MAP kinase as an indication for receptor activation. Cells transfected with COX-2 alone did not show a response to AngII, indicating that they do not express significant amounts of endogenous AT1 (Fig. 2A, first two lanes). Expression of AT1 alone elicited a marked response to AngII stimulation, as detected by activation of ERK (Fig. 2A, two middle lanes). Coexpression of COX-2 together with AT1 significantly lowered COX-2 expression, and this phenomenon was not affected by the presence of AngII (Fig. 2A, last two lanes). Time response experiments in the presence of AT1 alone or AT1 and COX-2 showed that there were no differences in the kinetics of ERK activation by AngII, both showing a peak response at 5–10 min of stimulation (Fig. 2B). However, ERK activation by AT1 was dampened in the presence of COX-2 (Fig. 2C). The same reduction in the ability of AT1 to stimulate COX-2 was observed using the catalytically inactive mutant G533A COX-2, suggesting that COX-2 protein interferes with signaling in this pathway in a manner that is independent of its catalytic activity.

1.2 YFP-COX-2 (fold COX-2 alone)

determine statistical significance, Student’s t test or one-way ANOVA were used. Post-hoc analysis was performed with Tukey multi-comparison test when appropriate. p values ⬍ 0.05 were considered significant. Analyses were done using GraphPad Prism 5 software.

PGE2 production (fold COX-2 alone)

The Carboxyl Tail of AT1 Down-regulates COX-2

AT1

COX2AngII

-

-

+

ERK activity (fold AT1 alone)

The Carboxyl Tail of AT1 Down-regulates COX-2

COX+2-AT1

+

-

+ COX2p-ERK T-ERK

40 35

AT1 AT1+COX-2

30 25 20 15 10 5 0

0

10

20

30

40

50

60

AngII (min)

0.8 0.6 0.4 0.2 0

-

1.0 0.8 0.6 0.4 0.2

+COX-2 +G533A COX-2

CFP-AT1 (fold wtAT1 alone)

1.2 1.0 0.8 0.6 0.4 0.2

YFP-COX-2 CFP-AT1

0

-

-

2

5

10

GFX (μM)

1.2 1.0 0.8 0.6 0.4 0.2

O X +w -2 +D tA R T1 Y/ +T AA ST Y S/ A

C

O X +w -2 +D tA R T1 Y/ +T AA ST Y S/ A

0

0

C

YFP-COX-2 (fold COX-2 alone)

Fold change in fluorescence

1.0

1.2

FIGURE 2. The effect of AT1 on COX-2 does not require receptor activation. A, cells were transfected with COX-2 and empty vector (first two lanes), HA-AT1 and empty vector (two middle lanes) and COX-2 with HA-AT1 (last two lanes), and treated with AngII (1 ␮M, 10 min). Receptor activation was evaluated by measuring activation of ERK MAP kinase (pERK). Shown is a representative immunoblot of n ⫽ 3. B, quantification of ERK activation (ratio of phospho to total ERK) by 1 ␮M AngII at the indicated time points (n ⫽ 3). C, cells were transfected with either AT1 alone or in the presence of wild type COX-2 or its catalytically inactive mutant G533A COX-2. ERK activation was measured after 10 min of stimulation with 1 ␮M AngII (n ⫽ 5). D, cells were transfected as above and treated with the PKC inhibitors GFX at the indicated concentrations, throughout transfection. Levels of YFP-COX-2 and CFP-AT1 were analyzed by flow cytometry (n ⫽ 3). E, YFP-COX-2 was transfected with CFP-tagged wild type AT1, DRY/AAY AT1, or TSTS/A AT1 at ratios of 1:5. Levels of YFP-COX-2 (black columns) and CFP-AT1 (gray columns) were obtained by flow cytometry (n ⫽ 5).

tive in AT1 with a TSTS/A substitutions in the CT of the receptor (6, 14). To test whether these motifs are involved in the effect of AT1 on COX-2, we tagged the mutant receptors with cyan fluorescent protein (CFP) and co-expressed them together with YFP-COX-2 (Fig. 2E). Flow cytometry measurements showed that the wild type and mutant receptors expressed to similar extents (Fig. 2E, right panel), and both significantly lowered COX-2 expression. AT1 Promotes Degradation of COX-2 via the Proteasome— Our previously published data showed that the prostaglandin EP1 receptor down-regulates COX-2 expression by enhancing its ubiquitination and subsequent proteasomal degradation (13). To test whether proteasomal degradation is involved in the effect of AT1 on COX-2, cells expressing YFP-tagged COX-2, alone or with CFP-AT1, were treated overnight with or without the specific proteasome inhibitor MG132. Blockade of proteasomal activity abolished the effect of AT1, resulting in

31476 JOURNAL OF BIOLOGICAL CHEMISTRY

more than double the amount of COX-2 (Fig. 3A). Treatment with MG132 also caused a parallel reduction in the levels of CFP-AT1 (Fig. 3B). Similar results were observed using untagged proteins (Fig. 3C), thus excluding the possibility that the observed effect is an artifact of the fluorescent tags. A doseresponse experiment with increasing concentrations of MG132 showed that COX-2 recovery was observed as soon as the levels of the receptor began falling at concentrations as low as 0.1 ␮M MG132 (Fig. 3D). We next tested whether COX-2 and AT1 interact with each other. For this, cells were transfected with each protein alone or together, and samples were subject to immunoprecipitation. To enable detection of a possible interaction, we used a transfection ratio of 1:1 COX-2: AT1 that was found in dose-titration experiments to have a minimal effect on COX-2 expression (Fig. 1D). As shown in Fig. 4, A and B, only cells that expressed both proteins showed the reciprocal protein in coprecipitates. VOLUME 289 • NUMBER 45 • NOVEMBER 7, 2014

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

ERK activity (fold AT1 alone)

D 1.2

The Carboxyl Tail of AT1 Down-regulates COX-2 B

COX-2 COX-2 +AT1

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2

1.0 0.8 0.6 0.4 0.2 0

0

MG132

COX-2 +AT1

1.2 CFP-AT1 (fold AT1 alone)

YFP-COX-2 (fold COX-2 alone)

A

-

+

C

-

+

-

+

+

AT1 COX-2+AT1

COX-2 MG132

-

MG132

-

+

-

+ COX-2 AT1

FIGURE 4. AT1 enhances proteasomal degradation of COX-2 by increasing its ubiquitination. AT1 co-immunoprecipitates with COX-2. Cells were transfected with empty vector, COX-2, or HA-AT1 and COX-2 with HA-AT1 at a ratio of 1:1. Immunoprecipitation of (A) HA or (B) COX-2, was performed 16 h after transfection (representative blots of n ⫽ 4). C, COX-2 ubiquitination is elevated in the presence AT1. COX-2 was immunoprecipitated from cells expressing COX-2 or HA-AT1 alone or together. 16 h after transfection, samples were collected and probed first for ubiquitin content followed by COX-2 and AT1 antibodies (representative blot of n ⫽ 4).

Next, we measured the levels of ubiquitinated COX-2 in the presence or absence of AT1. COX-2 was immunoprecipitated from all samples, and membranes were probed first for ubiquitination levels and then for the presence of COX-2 and AT1. Under conditions of 1:1 co-expression AT1 did not cause a significant reduction in COX-2 but the levels of its ubiquitination were elevated compared with those of COX-2 alone (Fig. 4C). The Effect of AT1 on COX-2 Is Mediated via Its Carboxyl Tail (CT)—The CT of most GPCRs has a critical role in their interactions with intracellular proteins. To determine whether the effect of AT1 on COX-2 involves its CT, we overexpressed COX-2 with either a wild type receptor or a truncated receptor mutant that lacks its entire cytosolic tail (⌬324; (7)). As demonstrated by both Western blot (Fig. 5A) and flow cytometry (Fig. 5B) analyses, the effect of AT1 onCOX-2 was completely abolished in the absence of its CT. We next reasoned that if the CT is required for down-regulation of COX-2 expression by AT1, then the inhibitory effect of AT1 on COX-2 may be mimicked by the CT amino acid sequence itself. To test this, we appended the amino acid sequence (325–359) of the CT to CFP or c-Myc and followed its effect on COX-2 expression. As depicted by fluorescent NOVEMBER 7, 2014 • VOLUME 289 • NUMBER 45

AT1 COX-2

+

wt Δ324 + + COX-2 AT1 Actin

YFP-COX-2 (fold COX-2 alone)

FIGURE 3. Inhibition of the proteasome lowers AT1 and rescues COX-2. Cells transfected with YFP-COX-2 and either empty vector or CFP-AT1 were treated with or without 10 ␮M MG132 for 16 h. A, summary graph of the effect of MG132 on YFP-COX-2 levels. (n ⫽ 6). B, expression of CFP-AT1 from the same experiments. C, representative immunoblot of cells transfected and treated as above that were analyzed for COX-2 and AT1 using specific antibodies. D, dose-dependent effect of MG132 treatment of YFP-COX-2 and CFPAT1 levels (n ⫽ 3).

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0

FIGURE 5. The carboxyl terminus of AT1 is necessary for its effect on COX-2. A, HEK293 cells were transfected with COX-2 and either empty vector, wild type AT1 (wt), or the ⌬324 mutant at a 1:5 ratio. Shown is a representative immunoblot of n ⫽ 5 experiments. B, effect of wild type and ⌬324 mutant on YFP-COX-2 expression was measured by flow cytometry (n ⫽ 5, in triplicates).

microscopy (Fig. 6A) and Western blotting (Fig. 6B) co-expression of the CT of AT1 together with COX-2 in HEK 293 cells, significantly down-regulates the expression of the latter. To test whether wild type AT1 or the CT lower the levels of endogeJOURNAL OF BIOLOGICAL CHEMISTRY

31477

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

D

The Carboxyl Tail of AT1 Down-regulates COX-2 Cy5

CFP

HEK293 75

Mock AT1 CT

COX-2 50

Flag-AT1

11

CT-Myc GAPDH

37

NIH3T3 75

Mock AT1 CT

COX-2 50

Flag-AT1

11

CT-Myc GAPDH

1.2 1.0 0.8 0.6 0.4 0.2 0

Mock +wtAT1 +CT-Myc

FIGURE 6. The tail sequence of AT1 (CT) is sufficient to down-regulate COX-2 expression. A, HEK 293 cells were transiently transfected with YFP-COX-2, CFP-CT or both at a ratio of 1:5. The effect on COX-2 expression was detected by fluorescent microscopy. CFP without the CT sequence was used as control and did not lower COX-2 expression (last panel). B, HEK 293 cells were transfected with wild type AT1 or CT-Myc with or without COX-2. Representative immunoblot of n ⫽ 5 experiments. C, NIH 3T3 fibroblasts were transfected with either empty vector or CT-Myc for 16 h in starvation media, followed by stimulation with 20% serum for 4 h (representative blots of n ⫽ 4). D, effect of wild type AT1 or CT-Myc on YFP- COX-2 was measured using flow cytometry (n ⫽ 4, in triplicates).

nously expressing COX-2, we tested their effect on NIH3T3 fibroblasts that express endogenous COX-2 following serumstimulation (15). Cells were transfected with empty vector, wild type AT1, or CT-Myc and stimulated 1 day later with 20% serum. As shown in Fig. 6C, both wild type and CT lowered endogenous COX-2 expression in these cells, in a similar manner to the effect they had on the HEK 293 cells that were transfected with COX-2. Flow cytometry analysis showed both wild type AT1 and CT cause a reduction of ⬃50% in COX-2 expression (Fig. 6D).

DISCUSSION The data presented herein show that AT1 down-regulates COX-2 expression in a mechanism that is not mediated by classical signaling pathways. Agonist stimulation of AT1 promotes its coupling to G␣q, thereby initiating PLC-dependent activation of PKC (6). Immediately thereafter, the receptor is phosphorylated by G protein-coupled receptor kinases (GRKs) on distinct serine/threonine site located on its carboxyl terminus (14), thereby initiating a second wave of ␤ arrestin-dependent signaling (6). However, our data show that AngII-mediated activation of the receptor, or inhibition of PKC activity, do not reverse its effect on COX-2 expression. Moreover, AT1 mutants that are

31478 JOURNAL OF BIOLOGICAL CHEMISTRY

defective in their ability to engage with G proteins (DRY/AAY) or ␤ arrestin (TSTS/A) do not cause a significant reversal of the receptor on COX-2 expression. A role for ␤ arrestin cannot be ruled out completely because although the ⌬324 AT1 mutant that lacks the CT of the receptor has no effect on COX-2, it was shown to maintain a certain degree of phosphorylation-independent ␤ arresting recruitment (6). Nonetheless, since AT1mediated decrease in COX-2 is observed in the absence of any ligand, it is more likely that the CT of AT1 interacts with other currently unknown scaffold proteins that promote degradation of COX-2. One of the main findings of this study is that the CT sequence of AT1 mimics the effect of the full receptor. This suggests that the tail region has a major role in down-regulating COX-2 but whether it interacts with the same machinery as the full receptor remains to be determined. The tail region of AT1 contains motifs that bind different molecules such as proteins of the JAK/STAT pathway (16), and ATRAP (17) that may be involved in regulating COX-2 expression. Other GPCR-associated protein candidates that may regulate COX-2 localization and subsequent degradation include GTPase ARF4 that binds to a sorting signal on the CT of rhodopsin, and the E3 ligase Nedd4 that binds to the ␤2 adrenergic receptor and promotes its degradaVOLUME 289 • NUMBER 45 • NOVEMBER 7, 2014

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

YFP-COX-2 (fold COX-2 alone)

37

The Carboxyl Tail of AT1 Down-regulates COX-2

5. 6.

7.

8. 9.

10.

11.

12.

13.

14.

15.

16.

17.

Acknowledgment—We thank Dr. Sagie Schif-Zuck for assistance and expertise in the flow cytometry analyses. 18.

REFERENCES 1. Spencer, A. G., Woods, J. W., Arakawa, T., Singer, II, and Smith, W. L. (1998) Subcellular localization of prostaglandin endoperoxide H synthases-1 and -2 by immunoelectron microscopy. J. Biol. Chem. 273, 9886 –9893 2. Smith, W. L., and Langenbach, R. (2001) Why there are two cyclooxygenase isozymes. J. Clin. Invest. 107, 1491–1495 3. Cheng, H. F., Wang, J. L., Zhang, M. Z., Miyazaki, Y., Ichikawa, I., McKanna, J. A., and Harris, R. C. (1999) Angiotensin II attenuates renal cortical cyclooxygenase-2 expression. J. Clin. Invest. 103, 953–961 4. Zhang, M. Z., Yao, B., Cheng, H. F., Wang, S. W., Inagami, T., and Harris, R. C. (2006) Renal cortical cyclooxygenase 2 expression is differentially

NOVEMBER 7, 2014 • VOLUME 289 • NUMBER 45

19.

20. 21.

regulated by angiotensin II AT(1) and AT(2) receptors. Proc. Natl. Acad. Sci. U.S.A. 103, 16045–16050 Shenoy, S. K., and Lefkowitz, R. J. (2011) ␤-Arrestin-mediated receptor trafficking and signal transduction. Trends Pharmacol. Sci. 32, 521–533 Wei, H., Ahn, S., Shenoy, S. K., Karnik, S. S., Hunyady, L., Luttrell, L. M., and Lefkowitz, R. J. (2003) Independent ␤-arrestin 2 and G protein-mediated pathways for angiotensin II activation of extracellular signal-regulated kinases 1 and 2. Proc. Natl. Acad. Sci. U.S.A. 100, 10782–10787 Wei, H., Ahn, S., Barnes, W. G., and Lefkowitz, R. J. (2004) Stable interaction between beta-arrestin 2 and angiotensin type 1A receptor is required for ␤-arrestin 2-mediated activation of extracellular signal-regulated kinases 1 and 2. J. Biol. Chem. 279, 48255– 48261 Mbonye, U. R., and Song, I. (2009) Posttranscriptional and posttranslational determinants of cyclooxygenase expression. BMB Rep. 42, 552–560 Mbonye, U. R., Yuan, C., Harris, C. E., Sidhu, R. S., Song, I., Arakawa, T., and Smith, W. L. (2008) Two distinct pathways for cyclooxygenase-2 protein degradation. J. Biol. Chem. 283, 8611– 8623 Neuss, H., Huang, X., Hetfeld, B. K., Deva, R., Henklein, P., Nigam, S., Mall, J. W., Schwenk, W., and Dubiel, W. (2007) The ubiquitin- and proteasome-dependent degradation of COX-2 is regulated by the COP9 signalosome and differentially influenced by coxibs. J. Mol. Med. 85, 961–970 Chen, S. F., Wu, C. H., Lee, Y. M., Tam, K., Tsai, Y. C., Liou, J. Y., and Shyue, S. K. (2013) Caveolin-1 interacts with Derlin-1 and promotes ubiquitination and degradation of cyclooxygenase-2 via collaboration with p97 complex. J. Biol. Chem. 288, 33462–33469 Brender, S., and Barki-Harrington, L. (2014) beta1-Adrenergic receptor downregulates the expression of cyclooxygenase-2. Biochem. Biophys. Res. Commun. 451, 319 –321 Haddad, A., Flint-Ashtamker, G., Minzel, W., Sood, R., Rimon, G., and Barki-Harrington, L. (2012) Prostaglandin EP1 receptor down-regulates expression of cyclooxygenase-2 by facilitating its proteasomal degradation. J. Biol. Chem. 287, 17214 –17223 Oakley, R. H., Laporte, S. A., Holt, J. A., Barak, L. S., and Caron, M. G. (2001) Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-␤-arrestin complexes after receptor endocytosis*. J. Biol. Chem. 276, 19452–19460 Mbonye, U. R., Wada, M., Rieke, C. J., Tang, H. Y., Dewitt, D. L., and Smith, W. L. (2006) The 19-amino acid cassette of cyclooxygenase-2 mediates entry of the protein into the endoplasmic reticulum-associated degradation system. J. Biol. Chem. 281, 35770 –35778 Ali, M. S., Sayeski, P. P., Dirksen, L. B., Hayzer, D. J., Marrero, M. B., and Bernstein, K. E. (1997) Dependence on the motif YIPP for the physical association of Jak2 kinase with the intracellular carboxyl tail of the angiotensin II AT1 receptor. J. Biol. Chem. 272, 23382–23388 Daviet, L., Lehtonen, J. Y., Tamura, K., Griese, D. P., Horiuchi, M., and Dzau, V. J. (1999) Cloning and characterization of ATRAP, a novel protein that interacts with the angiotensin II type 1 receptor. J. Biol. Chem. 274, 17058 –17062 Shenoy, S. K., Xiao, K., Venkataramanan, V., Snyder, P. M., Freedman, N. J., and Weissman, A. M. (2008) Nedd4 mediates agonist-dependent ubiquitination, lysosomal targeting, and degradation of the ␤2-adrenergic receptor. J. Biol. Chem. 283, 22166 –22176 Harris, R. C., McKanna, J. A., Akai, Y., Jacobson, H. R., Dubois, R. N., and Breyer, M. D. (1994) Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction. J. Clin. Invest. 94, 2504 –2510 Harris, R. C., Zhang, M. Z., and Cheng, H. F. (2004) Cyclooxygenase-2 and the renal renin-angiotensin system. Acta Physiol. Scand. 181, 543–547 Spector-Chotiner, A., Shraga-Heled, N., Sood, R., Rimon, G., and BarkiHarrington, L. (2014) Prostaglandin receptor EP(1)-mediated differential degradation of cyclooxygenases involves a specific lysine residue. Biochem. Biophys. Res. Commun. 443, 738 –742

JOURNAL OF BIOLOGICAL CHEMISTRY

31479

Downloaded from http://www.jbc.org/ at UNIV OF UTAH on November 27, 2014

tion (18). Identification of additional proteins that are involved in the mechanism of COX-2 down-regulation by GPCRs requires further investigation and is ongoing. As opposed to its highly inducible nature in most tissues, COX-2 is constitutively expressed in the cortex of the mammalian kidney, particularly in the macula densa and the thick ascending limb of Henle (19), where it generates prostaglandins that raise the levels of renin. Elevated renin (e.g. due to salt depletion) or inhibition of the angiotensin-converting enzyme (ACE) cause a significant increase in COX-2 expression thus constituting positive feedback loop between renin and COX-2 (19, 20). In contrast, the end product of renin, AngII, negatively regulates the expression of COX-2 (3, 4). This effect was shown to involve receptor signaling since administration of ACE inhibitors or angiotensin receptor blockers to rodents in vivo caused a marked elevation in COX-2 expression (3). Interestingly however, mice with a genetic depletion of AT1 (Agtr1a⫺/⫺, Agtrb⫺/⫺) also display significantly higher levels of COX-2 in their macula densa, thus providing support to our hypothesis that the actual presence of the AT1 receptor may be required to keep COX-2 expression at bay. In summary, we found that the AT1 receptor plays an important role in facilitating COX-2 degradation, thus constituting an additional feedback loop that does not depend on classical signaling pathways. These findings are in line with our previous work that demonstrated a similar effect for EP1 and ␤1 adrenergic receptors in accelerating COX-2 degradation by enhanced ubiquitination (12, 13, 21). Together these studies suggest that the mechanism of receptor-mediated regulation of COX-2 expression is common to other GPCRs, thus endowing them with an additional function that deviates from accepted signaling paradigms. We further posit that this type of regulation may constitute a physiological means of controlling normal COX-2 turnover, and that pathological conditions that involve changes in the expression of GPCRs may affect COX-2 as well. Lastly, the ability of a short amino acid sequence of the CT to downregulate COX-2 expression may present a basis for novel therapeutic approach for eliminating excess COX-2 protein.