Experimental dermatology • Original article
CED
Clinical and Experimental Dermatology
Ecklonia cava promotes hair growth S. S. Bak,1 B. N. Ahn,2 J. A. Kim,1 S. H. Shin,3 J. C. Kim,3 M. K. Kim,3 Y. K. Sung3 and S. K. Kim1,2 1
Marine Bioprocess Research Center and 2Department of Chemistry, Pukyong National University, Busan, Korea; and 3Department of Immunology, School of Medicine, Kyungpook National University, Daegu, Korea doi:10.1111/ced.12120
Summary
Background. Previous studies have reported the protective effects on skin elasticity of the edible marine seaweed Ecklonia cava, which acts through regulation of both antioxidative and anti-inflammatory responses. Aim. We evaluated the effect of E. cava and one of its components, dioxinodehydroeckol, on hair-shaft growth in cultured human hair follicles and on hair growth in mice. Methods. The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to check cell viability of human dermal papilla cells (DPCs) and outer root sheath (ORS) cells after treatment with E. cava and its metabolite, dioxinodehydroeckol. Hair-shaft growth was measured using the in vitro hair-follicle organ-culture system, in the presence or absence of E. cava and dioxinodehydroeckol. Anagen induction activity was examined by topical application of E. cava to the dorsal skin of C57BL/6 mice. Insulin-like growth factor (IGF)-1 expression was measured by reverse transcriptase PCR and ELISA. Results. The proliferation activity was found to be highest for the ethyl acetatesoluble fraction of E. cava (EAFE) in DPCs and in ORS cells. Treatment with EAFE resulted in elongation of the hair shaft in cultured human hair follicles, and promoted transition of the hair cycle from the telogen to the anagen phase in the dorsal skin of C57BL/6 mice. In addition, EAFE induced an increase in IGF-1 expression in DPCs. Dioxinodehydroeckol, a component of E. cava, induced elongation of the hair shaft, an increase in proliferation of DPCs and ORS cells, and an increase in expression of IGF-1 in DPCs. Conclusions. These results suggest that E. cava containing dioxinodehydroeckol promotes hair growth through stimulation of DPCs and ORS cells.
Introduction Marine algae (seaweeds) are a rich source of bioactive compounds and nutrients. From ancient times, the beautiful long hair of East Asian women has been Correspondence: Dr Se-Kwon Kim, Department of Chemistry, Pukyong National University, 45, Yongso-ro, Nam-gu, Busan, 608-737, Korea E-mail: [email protected] Conflict of interest: none declared. The last two authors were the senior authors and contributed equally to this work. Accepted for publication 14 November 2012
904
Clinical and Experimental Dermatology (2013) 38, pp904–910
associated with seaweed consumption, as seen in the tale of Genji, written in the 11th century.1 Based on this tradition, there is a belief in Japan that seaweed is helpful to the quality or growth of hair,1 although no scientific evidence of a correlation between alopecia and seaweed intake has been published. The brown algae have attracted particular interest, especially the edible seaweed Ecklonia cava.2 Details of the bioactivity of this alga, including its antioxidant, anti-inflammatory, anticancer and anticoagulant abilities, and its ability to prevent adipocyte differentiation, have been reported.3–9 Hair follicles contain several different types of cells, including the dermal sheath, dermal papilla (DP), outer
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
root sheath (ORS), inner root sheath and matrix cells.10 The DP is the mesenchymal component of the hair follicle, known to play an essential role in induction of anagen phase and maintenance of hair growth. Various growth factors from the DP are believed to affect proliferation and differentiation of epithelial cells during production of the hair shaft, which leads to promotion of hair growth.10 These growth factors include fibroblast growth factor-7,11 insulin-like growth factor (IGF)1,12,13 hepatocyte growth factor,14 keratinocyte growth factor,15 and vascular endothelial growth factor.16 DP cells (DPCs) also produce androgen-inducible negative regulators, include transforming growth factor-b1, Dickkopf-related protein 1 and interleukin-6.17–19 In the present study, we investigated the effects of E. cava and one of its components, dioxinodehydroeckol, on hair growth. The hair growth-promoting effects of E. cava and its components were assessed by investigation of proliferation in DPCs and ORS cells, hair-shaft elongation in cultured human scalp hair follicles, and induction of anagen from telogen in C57BL/6 mice.
Methods Ethics approval
All of the studies described were approved by the medical ethics committee of Kyungpook National University Hospital (Korea), and informed written consent was obtained from all human participants. Preparation of seaweed fractions
Dried E. cava powder (Parajeju, Jeju lsland, South Korea) was extracted three times using a 10 : 1 ratio of methanol : powder, and the resulting liquid was concentrated using a vacuum rotary evaporator. MeOH extract was partitioned with organic solvents to yield the n-hexane, dichloromethane and ethyl acetate (EA) fractions. Dioxinodehydroeckol was isolated from the EA fraction of E. cava.8 The collected extract, fractions and compound were dissolved in dimethyl sulfoxide (Sigma Chemical Co., St. Louis, MO, USA), and kept at 20 °C until used. Isolation and culture of human hair follicles
Specimens were taken from the nonbalding areas on the occipital scalps of male patients undergoing hair transplantation surgery. A previously described method with minor modifications was used for isolation and culture of hair follicles.19,20 Isolated
ª 2013 British Association of Dermatologists
hair follicles were maintained in Williams E media (Sigma Chemical Co.) supplemented with 2 mmol/L L-glutamine, 100 U/mL streptomycin and 10 ng/mL hydrocortisone. Culture of dermal papilla cells and outer root sheath keratinocytes
DP were isolated from bulbs of dissected hair follicles and transferred onto plastic dishes coated with bovine type 1 collagen, then cultured in Dulbecco modified Eagle medium supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin and 20% heat-inactivated fetal bovine serum (FBS) at 37 °C in a humidified atmosphere of 5% CO2. The explants were left for 7 days, and the medium was changed every 3 days. Once cell outgrowth had become subconfluent, cells were harvested with 0.25% trypsin/ 10 mmol/L EDTA in Hank balanced salt solution, and subcultured with a split ratio of 1 : 3. DPCs were maintained in DMEM supplemented with 10% FBS, For the culture of ORS cells, the hair-shaft and hair-bulb regions of the hair follicle were cut off to prevent contamination by other cell types. The trimmed hair follicles were immersed in DMEM supplemented with 20% FBS. On day 3 of culture, the medium was changed to Epilife medium (Gibco BRL, Gaithersburg, MD, USA) containing 100 U/mL penicillin, 100 mg/mL streptomycin and 250 ng/mL fungizone. After subculture, the ORS cells maintained in Epilife medium and cells from the second passage were used for further study. MTT assay
To investigate the effect of E. cava on hair growth, we first assessed the proliferation activity of E. cava in DPCs and ORS cells. To determine the optimal solvent solution for use in the extraction and fractionation of E. cava, DPCs were treated with the methanolextracted and the solvent-soluble fractions of E. cava, including the n-hexane, dichloromethane and EA layers. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was performed for measurement of cell viability. DPCs (104 cells/well) and ORS cells (104 cells/well) were seeded into 96-well plates for 1 day. The medium was then changed to serum-free medium, and cells were treated with various concentrations of samples for 3 days, before MTT solution (70 lg/well) was added for 3 h. The formazan produced was solubilized with DMSO, and the optical density was measured at 570 nm.
Clinical and Experimental Dermatology (2013) 38, pp904–910
905
Ecklonia cava promotes hair growth S. S. Bak et al.
RNA extraction and reverse transcriptase PCR analysis
Total RNA was isolated (TRIzol reagent; Invitrogen, Carlsbad, CA, USA), and synthesis of cDNA from 3 lg total RNA was performed using a cDNA synthesis kit (ImProm-IITM; Promega, Madison, WI, USA) containing reverse transcriptase and oligo-dT primers, in accordance with the manufacturer’s instructions. cDNA (1 lL) was amplified using gene-specific sense and antisense primers (Table 1). We used 35 cycles (1 min at 94 °C, 45 s at 58 °C and 45 s at 72 °C) of amplification for IGF-1, and 22 cycles (1 min at 94 °C, 1 min at 58 °C and 1 min at 72 °C) for b-actin. The PCR products were separated by electrophoresis in a 1% agarose gel, and visualized under ultraviolet light. Enzyme-linked immunosorbent assay
ELISA of IGF-1 was performed with a commercial kit (Quantikine ELISA; R & D Systems Inc., Minneapolis, MN, USA) in accordance with the manufacturer’s protocol. Briefly, 50 lL of culture-conditioned media was loaded per well into titre plates coated with IGF-1, antibody and incubated at 4 °C for 3 h, then washed three times with 400 lL of wash buffer for 5 min, and incubated with IGF-1 conjugate at 4 °C for 2 h, after which 200 lL of substrate solution was added and the plates incubated for 30 min at room temperature. Optical density was measured on an ELISA microplate reader (VERSAmax; Molecular Devices, Silicon Valley, CA, USA) at 450 nm.
every day for 37 days. Minoxidil 3% (MinoxylTM; Hyundai Pharm. Co. Ltd, Cheonan, South Korea) was used as a positive control. Statistical analysis
Data were expressed as mean SEM. The Student t-test was performed for assessment of differences between the means of individual groups.
Results Effects of Ecklonia cava on cell proliferation and hair-shaft elongation in cultured human hair follicles, and on insulin-like growth factor-1 expression in dermal papilla cells
EAFE induced the highest proliferation activity in DPCs, compared with the vehicle-treated control and other fractions (Fig. 1). At concentrations of 0.01 and 0.1 lg/mL EAFE treatment, proliferation was increased in DPCs by 130.6% and 138.6%, respectively (Fig. 2a), and in ORS by 121.8% and 118.7%, respectively (Fig. 2b), compared with the vehicle-treated control. In addition, we examined hair-shaft elongation using an organ culture of human hair follicles. Human scalp hair follicles were incubated with EAFE for 6 days. At concentrations of 0.01 and 0.1 lg/mL, elongation (1.26 and 1.52 mm, respectively), was seen (Fig. 2c). The vehicle-treated control was found to promote elongation of the hair shaft by 0.93 mm.
Animal study
Eight-week-old female C57BL/6 mice (Orient Bio Inc.; Seongnam, South Korea) were used in the study, when they were in the telogen stages of the hair cycle.21 After the mice had been allowed time to adapt to their new environment, the dorsal area of each mouse was shaved with a clipper. From the following day (day 1), 150 lL of the EA fraction of E. cava (EAFE), at two dilutions (10 and 100 lg/mL in 50% ethanol), were applied topically to the shaved skin Table 1 Primers used for PCR.
Figure 1 Proliferation effect of Ecklonia cava in cultured dermal Sequence 5′?3′
Insulin-like growth factor-1 b-actin
906
TCAACAAGCCACAGGGTAT ACTCGTGCAGAGCAAAGGAT GGGAAATCGTGCGTGACATT GGAGTTGAAGGTAGTTTCGT
Clinical and Experimental Dermatology (2013) 38, pp904–910
papilla cells (DPCs), which were incubated in serum-free medium in the presence of various fractions of E. cava for 3 days. Values indicate the mean SEM of five determinations per experiment in four independent experiments. *P < 0.05, †P < 0.001, compared with control (Student t-test). DC, dichloromethane fraction; EA, ethyl acetate fraction; H, n-hexane fraction; M, methanol extract.
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
(a)
(c)
(b)
(d)
(e)
Figure 2 (a,b) Proliferation effect of the ethyl acetate fraction of Ecklonia cava (EAFE) on (a) cultured dermal papilla cells (DPCs) and
(b) outer root sheath (ORS) keratinocytes. Values indicate the mean SEM of five determinations per experiment in four independent experiments. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control. (c) Hair-shaft elongation in isolated human hair follicles cultured for 6 days in the absence or presence of 0.01 or 0.1 lg/mL EAFE. Data are mean SD of seven determinations per experiment from three experiments. (d) Cultured DPCs treated with EAFE for 48 h, with insulin-like growth factor (IGF)-1 expression measured by reverse transcriptase PCR, and b-actin used as an internal control. Data are from three independent experiments. (e) The concentration of IGF-1 in conditioned media after EAFE treatment for 48 h was measured by ELISA. Data are expressed as the mean SD of four determinations. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control (Student t-test).
Treatment with 0.1 lg/mL EAFE resulted in a significantly increased level of IGF-1 mRNA expression, which was 2.17-fold higher than in the vehicle-treated control (P < 0.01) (Fig. 2d). Consistent with this, treatment with EAFE resulted in a significantly increased level of IGF-1 in conditioned media (Fig. 2e). Effects of the ethyl acetate-soluble fraction of Ecklonia cava on anagen induction
In the C57BL/6 mouse model, the newly growing hair shafts were visible on the dorsal skin of mice in the groups treated with EAFE or minoxidil (positive control), whereas hair growth was rare in the control group by day 37 of treatment. After 37 days of treatment, histological examination of dorsal skin tissues showed an increase in the size, depth and length of hair follicles in the EAFE and minoxidil-treated groups. Whereas the hair follicles of the control group were still in the telogen stage, those in the EAFE and minoxidiltreated groups were in the anagen stage (Fig. 3).
ª 2013 British Association of Dermatologists
Effects of dioxinodehydroeckol on cell proliferation, hair-shaft elongation, and insulin-like growth factor-1 expression in dermal papilla cells
To investigate the question of which isolated compounds from E. cava are responsible for the hairgrowth-promoting activity of EAFE, we first assessed the proliferation activity of dioxinodehydroeckol, one of the main components of E. cava,9 in DPCs and ORS cells. Cells were treated with various concentrations of dioxinodehydroeckol. Treatment with dioxinodehydroeckol resulted in significantly increased proliferation of DPCs at concentrations of 0.01 lmol/L (P < 0.01), 0.1 lmol/L (P < 0.01) and 1 lmol/L (P = 0.03) (Fig. 4a). Proliferation of ORS cells was also seen with 1 lmol/L of dioxinodehydroeckol (Fig. 4b). In addition, treatment with dioxinodehydroeckol at concentrations of 0.1 and 1 lmol/L resulted in hairshaft elongation of 1.43 and 1.36 mm, respectively, whereas elongation in the vehicle-treated control was only 0.93 mm (Fig. 4c). Compared with the vehicle-
Clinical and Experimental Dermatology (2013) 38, pp904–910
907
Ecklonia cava promotes hair growth S. S. Bak et al.
Figure 3 Effects of the ethyl acetate fraction of Ecklonia cava (EAFE) on anagen induction in C57BL/6 mice, after the dorsal skin was shaved at 8 weeks of age (telogen stage), followed by treatment every day with vehicle control (50% ethanol), EAFE at 10 or 100 lg/mL, or 3% minoxidil for 37 days. Representative sections of tissue are shown in the bottom panel (haematoxylin and eosin, original magnification 9 10).
(a)
(c)
(b)
(d)
(e)
Figure 4 (a,b) Proliferation effect of dioxinodehydroeckol on (a) cultured dermal papilla cells (DPCs) and (b) outer root sheath (ORS)
keratinocytes. Values indicate the mean SEM of five determinations per experiment in four independent experiments. (c) Hair-shaft elongation in isolated human hair follicles cultured for 6 days in the absence or presence of 0.1 or 1 lmol/L dioxinodehydroeckol. Data are mean SD of seven determinations per experiment from three experiments. (d) Cultured DPCs treated with dioxinodehydroeckol for 48 h, with insulin-like growth factor (IGF)-1 expression measured by reverse transcriptase PCR, with b-actin used as an internal control. Data are from three independent experiments. (e) The concentration of IGF-1 in conditioned media after dioxinodehydroeckol treatment for 48 h was measured by ELISA. Data are expressed as the mean SD of four determinations. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control (Student t-test).
908
Clinical and Experimental Dermatology (2013) 38, pp904–910
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
treated control, the increase in IGF-1 mRNA expression with 0.1 lmol/L dioxinodehydroeckol was 2.70-fold higher than controls (Fig. 4d). Consistent with this, treatment with dioxinodehydroeckol resulted in a significantly increased level of IGF-1 in the conditioned medium (P
CED
Clinical and Experimental Dermatology
Ecklonia cava promotes hair growth S. S. Bak,1 B. N. Ahn,2 J. A. Kim,1 S. H. Shin,3 J. C. Kim,3 M. K. Kim,3 Y. K. Sung3 and S. K. Kim1,2 1
Marine Bioprocess Research Center and 2Department of Chemistry, Pukyong National University, Busan, Korea; and 3Department of Immunology, School of Medicine, Kyungpook National University, Daegu, Korea doi:10.1111/ced.12120
Summary
Background. Previous studies have reported the protective effects on skin elasticity of the edible marine seaweed Ecklonia cava, which acts through regulation of both antioxidative and anti-inflammatory responses. Aim. We evaluated the effect of E. cava and one of its components, dioxinodehydroeckol, on hair-shaft growth in cultured human hair follicles and on hair growth in mice. Methods. The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to check cell viability of human dermal papilla cells (DPCs) and outer root sheath (ORS) cells after treatment with E. cava and its metabolite, dioxinodehydroeckol. Hair-shaft growth was measured using the in vitro hair-follicle organ-culture system, in the presence or absence of E. cava and dioxinodehydroeckol. Anagen induction activity was examined by topical application of E. cava to the dorsal skin of C57BL/6 mice. Insulin-like growth factor (IGF)-1 expression was measured by reverse transcriptase PCR and ELISA. Results. The proliferation activity was found to be highest for the ethyl acetatesoluble fraction of E. cava (EAFE) in DPCs and in ORS cells. Treatment with EAFE resulted in elongation of the hair shaft in cultured human hair follicles, and promoted transition of the hair cycle from the telogen to the anagen phase in the dorsal skin of C57BL/6 mice. In addition, EAFE induced an increase in IGF-1 expression in DPCs. Dioxinodehydroeckol, a component of E. cava, induced elongation of the hair shaft, an increase in proliferation of DPCs and ORS cells, and an increase in expression of IGF-1 in DPCs. Conclusions. These results suggest that E. cava containing dioxinodehydroeckol promotes hair growth through stimulation of DPCs and ORS cells.
Introduction Marine algae (seaweeds) are a rich source of bioactive compounds and nutrients. From ancient times, the beautiful long hair of East Asian women has been Correspondence: Dr Se-Kwon Kim, Department of Chemistry, Pukyong National University, 45, Yongso-ro, Nam-gu, Busan, 608-737, Korea E-mail: [email protected] Conflict of interest: none declared. The last two authors were the senior authors and contributed equally to this work. Accepted for publication 14 November 2012
904
Clinical and Experimental Dermatology (2013) 38, pp904–910
associated with seaweed consumption, as seen in the tale of Genji, written in the 11th century.1 Based on this tradition, there is a belief in Japan that seaweed is helpful to the quality or growth of hair,1 although no scientific evidence of a correlation between alopecia and seaweed intake has been published. The brown algae have attracted particular interest, especially the edible seaweed Ecklonia cava.2 Details of the bioactivity of this alga, including its antioxidant, anti-inflammatory, anticancer and anticoagulant abilities, and its ability to prevent adipocyte differentiation, have been reported.3–9 Hair follicles contain several different types of cells, including the dermal sheath, dermal papilla (DP), outer
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
root sheath (ORS), inner root sheath and matrix cells.10 The DP is the mesenchymal component of the hair follicle, known to play an essential role in induction of anagen phase and maintenance of hair growth. Various growth factors from the DP are believed to affect proliferation and differentiation of epithelial cells during production of the hair shaft, which leads to promotion of hair growth.10 These growth factors include fibroblast growth factor-7,11 insulin-like growth factor (IGF)1,12,13 hepatocyte growth factor,14 keratinocyte growth factor,15 and vascular endothelial growth factor.16 DP cells (DPCs) also produce androgen-inducible negative regulators, include transforming growth factor-b1, Dickkopf-related protein 1 and interleukin-6.17–19 In the present study, we investigated the effects of E. cava and one of its components, dioxinodehydroeckol, on hair growth. The hair growth-promoting effects of E. cava and its components were assessed by investigation of proliferation in DPCs and ORS cells, hair-shaft elongation in cultured human scalp hair follicles, and induction of anagen from telogen in C57BL/6 mice.
Methods Ethics approval
All of the studies described were approved by the medical ethics committee of Kyungpook National University Hospital (Korea), and informed written consent was obtained from all human participants. Preparation of seaweed fractions
Dried E. cava powder (Parajeju, Jeju lsland, South Korea) was extracted three times using a 10 : 1 ratio of methanol : powder, and the resulting liquid was concentrated using a vacuum rotary evaporator. MeOH extract was partitioned with organic solvents to yield the n-hexane, dichloromethane and ethyl acetate (EA) fractions. Dioxinodehydroeckol was isolated from the EA fraction of E. cava.8 The collected extract, fractions and compound were dissolved in dimethyl sulfoxide (Sigma Chemical Co., St. Louis, MO, USA), and kept at 20 °C until used. Isolation and culture of human hair follicles
Specimens were taken from the nonbalding areas on the occipital scalps of male patients undergoing hair transplantation surgery. A previously described method with minor modifications was used for isolation and culture of hair follicles.19,20 Isolated
ª 2013 British Association of Dermatologists
hair follicles were maintained in Williams E media (Sigma Chemical Co.) supplemented with 2 mmol/L L-glutamine, 100 U/mL streptomycin and 10 ng/mL hydrocortisone. Culture of dermal papilla cells and outer root sheath keratinocytes
DP were isolated from bulbs of dissected hair follicles and transferred onto plastic dishes coated with bovine type 1 collagen, then cultured in Dulbecco modified Eagle medium supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin and 20% heat-inactivated fetal bovine serum (FBS) at 37 °C in a humidified atmosphere of 5% CO2. The explants were left for 7 days, and the medium was changed every 3 days. Once cell outgrowth had become subconfluent, cells were harvested with 0.25% trypsin/ 10 mmol/L EDTA in Hank balanced salt solution, and subcultured with a split ratio of 1 : 3. DPCs were maintained in DMEM supplemented with 10% FBS, For the culture of ORS cells, the hair-shaft and hair-bulb regions of the hair follicle were cut off to prevent contamination by other cell types. The trimmed hair follicles were immersed in DMEM supplemented with 20% FBS. On day 3 of culture, the medium was changed to Epilife medium (Gibco BRL, Gaithersburg, MD, USA) containing 100 U/mL penicillin, 100 mg/mL streptomycin and 250 ng/mL fungizone. After subculture, the ORS cells maintained in Epilife medium and cells from the second passage were used for further study. MTT assay
To investigate the effect of E. cava on hair growth, we first assessed the proliferation activity of E. cava in DPCs and ORS cells. To determine the optimal solvent solution for use in the extraction and fractionation of E. cava, DPCs were treated with the methanolextracted and the solvent-soluble fractions of E. cava, including the n-hexane, dichloromethane and EA layers. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was performed for measurement of cell viability. DPCs (104 cells/well) and ORS cells (104 cells/well) were seeded into 96-well plates for 1 day. The medium was then changed to serum-free medium, and cells were treated with various concentrations of samples for 3 days, before MTT solution (70 lg/well) was added for 3 h. The formazan produced was solubilized with DMSO, and the optical density was measured at 570 nm.
Clinical and Experimental Dermatology (2013) 38, pp904–910
905
Ecklonia cava promotes hair growth S. S. Bak et al.
RNA extraction and reverse transcriptase PCR analysis
Total RNA was isolated (TRIzol reagent; Invitrogen, Carlsbad, CA, USA), and synthesis of cDNA from 3 lg total RNA was performed using a cDNA synthesis kit (ImProm-IITM; Promega, Madison, WI, USA) containing reverse transcriptase and oligo-dT primers, in accordance with the manufacturer’s instructions. cDNA (1 lL) was amplified using gene-specific sense and antisense primers (Table 1). We used 35 cycles (1 min at 94 °C, 45 s at 58 °C and 45 s at 72 °C) of amplification for IGF-1, and 22 cycles (1 min at 94 °C, 1 min at 58 °C and 1 min at 72 °C) for b-actin. The PCR products were separated by electrophoresis in a 1% agarose gel, and visualized under ultraviolet light. Enzyme-linked immunosorbent assay
ELISA of IGF-1 was performed with a commercial kit (Quantikine ELISA; R & D Systems Inc., Minneapolis, MN, USA) in accordance with the manufacturer’s protocol. Briefly, 50 lL of culture-conditioned media was loaded per well into titre plates coated with IGF-1, antibody and incubated at 4 °C for 3 h, then washed three times with 400 lL of wash buffer for 5 min, and incubated with IGF-1 conjugate at 4 °C for 2 h, after which 200 lL of substrate solution was added and the plates incubated for 30 min at room temperature. Optical density was measured on an ELISA microplate reader (VERSAmax; Molecular Devices, Silicon Valley, CA, USA) at 450 nm.
every day for 37 days. Minoxidil 3% (MinoxylTM; Hyundai Pharm. Co. Ltd, Cheonan, South Korea) was used as a positive control. Statistical analysis
Data were expressed as mean SEM. The Student t-test was performed for assessment of differences between the means of individual groups.
Results Effects of Ecklonia cava on cell proliferation and hair-shaft elongation in cultured human hair follicles, and on insulin-like growth factor-1 expression in dermal papilla cells
EAFE induced the highest proliferation activity in DPCs, compared with the vehicle-treated control and other fractions (Fig. 1). At concentrations of 0.01 and 0.1 lg/mL EAFE treatment, proliferation was increased in DPCs by 130.6% and 138.6%, respectively (Fig. 2a), and in ORS by 121.8% and 118.7%, respectively (Fig. 2b), compared with the vehicle-treated control. In addition, we examined hair-shaft elongation using an organ culture of human hair follicles. Human scalp hair follicles were incubated with EAFE for 6 days. At concentrations of 0.01 and 0.1 lg/mL, elongation (1.26 and 1.52 mm, respectively), was seen (Fig. 2c). The vehicle-treated control was found to promote elongation of the hair shaft by 0.93 mm.
Animal study
Eight-week-old female C57BL/6 mice (Orient Bio Inc.; Seongnam, South Korea) were used in the study, when they were in the telogen stages of the hair cycle.21 After the mice had been allowed time to adapt to their new environment, the dorsal area of each mouse was shaved with a clipper. From the following day (day 1), 150 lL of the EA fraction of E. cava (EAFE), at two dilutions (10 and 100 lg/mL in 50% ethanol), were applied topically to the shaved skin Table 1 Primers used for PCR.
Figure 1 Proliferation effect of Ecklonia cava in cultured dermal Sequence 5′?3′
Insulin-like growth factor-1 b-actin
906
TCAACAAGCCACAGGGTAT ACTCGTGCAGAGCAAAGGAT GGGAAATCGTGCGTGACATT GGAGTTGAAGGTAGTTTCGT
Clinical and Experimental Dermatology (2013) 38, pp904–910
papilla cells (DPCs), which were incubated in serum-free medium in the presence of various fractions of E. cava for 3 days. Values indicate the mean SEM of five determinations per experiment in four independent experiments. *P < 0.05, †P < 0.001, compared with control (Student t-test). DC, dichloromethane fraction; EA, ethyl acetate fraction; H, n-hexane fraction; M, methanol extract.
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
(a)
(c)
(b)
(d)
(e)
Figure 2 (a,b) Proliferation effect of the ethyl acetate fraction of Ecklonia cava (EAFE) on (a) cultured dermal papilla cells (DPCs) and
(b) outer root sheath (ORS) keratinocytes. Values indicate the mean SEM of five determinations per experiment in four independent experiments. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control. (c) Hair-shaft elongation in isolated human hair follicles cultured for 6 days in the absence or presence of 0.01 or 0.1 lg/mL EAFE. Data are mean SD of seven determinations per experiment from three experiments. (d) Cultured DPCs treated with EAFE for 48 h, with insulin-like growth factor (IGF)-1 expression measured by reverse transcriptase PCR, and b-actin used as an internal control. Data are from three independent experiments. (e) The concentration of IGF-1 in conditioned media after EAFE treatment for 48 h was measured by ELISA. Data are expressed as the mean SD of four determinations. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control (Student t-test).
Treatment with 0.1 lg/mL EAFE resulted in a significantly increased level of IGF-1 mRNA expression, which was 2.17-fold higher than in the vehicle-treated control (P < 0.01) (Fig. 2d). Consistent with this, treatment with EAFE resulted in a significantly increased level of IGF-1 in conditioned media (Fig. 2e). Effects of the ethyl acetate-soluble fraction of Ecklonia cava on anagen induction
In the C57BL/6 mouse model, the newly growing hair shafts were visible on the dorsal skin of mice in the groups treated with EAFE or minoxidil (positive control), whereas hair growth was rare in the control group by day 37 of treatment. After 37 days of treatment, histological examination of dorsal skin tissues showed an increase in the size, depth and length of hair follicles in the EAFE and minoxidil-treated groups. Whereas the hair follicles of the control group were still in the telogen stage, those in the EAFE and minoxidiltreated groups were in the anagen stage (Fig. 3).
ª 2013 British Association of Dermatologists
Effects of dioxinodehydroeckol on cell proliferation, hair-shaft elongation, and insulin-like growth factor-1 expression in dermal papilla cells
To investigate the question of which isolated compounds from E. cava are responsible for the hairgrowth-promoting activity of EAFE, we first assessed the proliferation activity of dioxinodehydroeckol, one of the main components of E. cava,9 in DPCs and ORS cells. Cells were treated with various concentrations of dioxinodehydroeckol. Treatment with dioxinodehydroeckol resulted in significantly increased proliferation of DPCs at concentrations of 0.01 lmol/L (P < 0.01), 0.1 lmol/L (P < 0.01) and 1 lmol/L (P = 0.03) (Fig. 4a). Proliferation of ORS cells was also seen with 1 lmol/L of dioxinodehydroeckol (Fig. 4b). In addition, treatment with dioxinodehydroeckol at concentrations of 0.1 and 1 lmol/L resulted in hairshaft elongation of 1.43 and 1.36 mm, respectively, whereas elongation in the vehicle-treated control was only 0.93 mm (Fig. 4c). Compared with the vehicle-
Clinical and Experimental Dermatology (2013) 38, pp904–910
907
Ecklonia cava promotes hair growth S. S. Bak et al.
Figure 3 Effects of the ethyl acetate fraction of Ecklonia cava (EAFE) on anagen induction in C57BL/6 mice, after the dorsal skin was shaved at 8 weeks of age (telogen stage), followed by treatment every day with vehicle control (50% ethanol), EAFE at 10 or 100 lg/mL, or 3% minoxidil for 37 days. Representative sections of tissue are shown in the bottom panel (haematoxylin and eosin, original magnification 9 10).
(a)
(c)
(b)
(d)
(e)
Figure 4 (a,b) Proliferation effect of dioxinodehydroeckol on (a) cultured dermal papilla cells (DPCs) and (b) outer root sheath (ORS)
keratinocytes. Values indicate the mean SEM of five determinations per experiment in four independent experiments. (c) Hair-shaft elongation in isolated human hair follicles cultured for 6 days in the absence or presence of 0.1 or 1 lmol/L dioxinodehydroeckol. Data are mean SD of seven determinations per experiment from three experiments. (d) Cultured DPCs treated with dioxinodehydroeckol for 48 h, with insulin-like growth factor (IGF)-1 expression measured by reverse transcriptase PCR, with b-actin used as an internal control. Data are from three independent experiments. (e) The concentration of IGF-1 in conditioned media after dioxinodehydroeckol treatment for 48 h was measured by ELISA. Data are expressed as the mean SD of four determinations. *P < 0.05, †P < 0.005; ‡P < 0.001 compared with the control (Student t-test).
908
Clinical and Experimental Dermatology (2013) 38, pp904–910
ª 2013 British Association of Dermatologists
Ecklonia cava promotes hair growth S. S. Bak et al.
treated control, the increase in IGF-1 mRNA expression with 0.1 lmol/L dioxinodehydroeckol was 2.70-fold higher than controls (Fig. 4d). Consistent with this, treatment with dioxinodehydroeckol resulted in a significantly increased level of IGF-1 in the conditioned medium (P
