Original Paper
Intervirology 1992;33:197-203
Imperial College of Science, Technology and Medicine, London, UK
DsRNA Cloning and Diagnosis of Beet Pseudo-Yellows Virus by PCR and Nucleic Acid Hybridization
Key Words
Summary
Beet pseudo-yellows virus Closterovirus Double-stranded RNA Polymerase chain reaction
DsRNA has been extracted from beet pseudo-yellows virus infected cucumber plants, purified to homogeneity, and cDNA clones to it produced. The clones are of insufficient sensitivity to detect infection-specific RNA in dot and northern blots of crude nucleic acid extracts. However, a knowledge of the sequence of these clones has been used to synthesize oligonucleotides that have been used for polymerase chain reaction amplification of specific sequences from both purified dsRNA and from infected plants and used as a previously unavailable highly sensitive diagnostic probe. The method of cDNA synthesis has been shown to be generally applicable to some other plant viral dsRNAs and should be of use in the production of cDNA clones when virion RNA is unavailable.
Introduction
Beet pseudo-yellows virus (BPYV) is a plant RNA virus with an unusually large host range which is exclusively transmitted by the glass house whitefly Trialeurodes vaporariorum. It was first identified and named in California in 1965 [1] where it was found to cause characteris tic symptoms of yellowing and stunting similar to various mineral deficiencies or beet yellows virus (BYV) infection [2,3] in a variety of crop, weed, and ornamental plants. The virus has
Received : October 22,1991 Accepted : December 4,1991
subsequently become widespread in glasshouse-grown crops in Europe [4-9] to such an extent that in southern Spain the commercial viability of melon crops is threatened [DiazRuiz, personal commun.]. Similar viruses have also been reported in Japan [10] and Australasia [11]. BPYV has tentatively been classified as a closterovirus by its particle morphology and mode of transmission [10, 12], but due to the labile nature of the virus and its tendency to aggregate with host material, together with its low titre in infected plants, attempts at purifica-
R.S. Coffin Imperial College of Science Technology and Medicine Prince Consort Road London SW7 2BB (UK)
©1992 S. Karger AG, Basel 0300-5526/92/ 0334-0197S2.75/0
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
R. S. Coffin R. H. A. Coutts
198
Coffin/Coutts
plate together with the use of PCR as a sensitive dignostic probe for BPYV infection in crude plant extracts.
Material and Methods DsRNA Extraction Cucumber seedlings (Cucumis sativis cv Ashley) were artificially infected using viruliferous T. varporariorum and harvested when showing the first signs of infection. DsRNA was extracted by a modification of the method of Valverde et al. [23]: 100 g of infected leaf material was frozen in liquid nitrogen, ground to a fine powder, and thawed into a mixture containing 150 ml GPS (200 mM glycine, 100 m.W Na2P H 04, 600 m M NaCl, pH 9.5), 150 ml GPS-saturated phenol, 150 ml chloroform/isoamyl alcohol (24:1), 15 ml 10% SDS, and 1.5 ml p-mercaptoethanol and stirred at 4° for 1 h. After separation of the phases ethanol was added to the aqueous phase to 16.5% (v/v) together with 3 g What man CF-1I cellulose and stirred at room temperature for 30 min. The cellulose was pelleted (1,500 g, 5 min) and resuspended in 50 ml STE (100 m M NaCl, 50 m M Tris-HCl. I m M EDTA, pH 7.5) plus 16.5% ethanol, shaken for 5 min, and recentrifuged. The resuspension and centrifigugation steps were repeated five times after which the dsRNA was eluted with 4 x 3 ml STE and precipitated with ethanol. The RNA was resuspended in 8.35 ml STE and 1,65 ml ethanol added together with 0.5 g CF-11 cellulose and the binding/washing/elution steps repeated. The final pellet was resuspended in 400 pl200mAiNaCl,50mM NaOAc(pH 4.5), I mA/ZnS04, and 0.5% glycerol and digested with 400 U SI nuclease and 40 U DNAse I (both Pharmacia) at 37° for 60 min. After phenol extraction the sample was applied to a NACS column (BRL) according to the manufacturers’ instructions, eluted, and concentrated/washed with 6 ml TE (10 m M Tris-HCl, pH 7.5, 1 m M EDTA) in a Centricon microconcentrator (Amicon). cDNA Cloning 500 ng of dsRNA, estimated by fluorescence in ethidium bromide stained 1% agarose gels, was dena tured in a total volume of 10 pi of 40 m M CH3HgOH containing 0.8 mg/ml pd(N)(,(Boehringer) at room tem perature for 20 min, warmed to 37° and 150 pi of a reaction mix containing 500 uM each dNTP. 160 pg/ml pd(N),„ lx MMLV RT buffer (BRL), and 800 U MMLV reverse transcriptase(BRL), pre-warmed to 37°, added, and incubated at 37° for 20 min. Following
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
tion have largely been unsuccessful [2,5]. Prep arations of the Californian isolate have been produced which contain long flexuous par ticles, 12 nm in diameter and 1,500 to 1,800 nm in length [13], and have allowed the production of an antiserum suitable for indirect ELISA tests; however, no antiserum is generally available. Closteroviruses have previously been di vided into three subgroups A-C according to their particle length. These are represented, re spectively, by apple chlorotic leaf spot virus (730 nm), BYV (1,250-1,450 nm), and citrus tristeza virus (1,650-2,000 nm) [14], but, due to the differing particle structure and expression strategies of these viruses [15-19], it has been suggested that they should be divided into three separate groups [18]. Plants infected with BPYV contain a single species of double-stranded (ds) RNA of MW 7.5 x 106 daltons [20] which is consistent in size with the clostero-subgroup B viruses. However, plants infected with such viruses as well as containing a genomic-length dsRNA also con tain smaller dsRN As [21], suggesting a different expression strategy to BPYV. The subgroup C closteroviruses, while being more similar than subgroup B closteroviruses to BPYV in particle length, also produce multiple dsRNA in in fected plants [22]. Thus, at present, BPYV does not fall easily into any of the proposed closterovirus subgroups. Whether the apparent dif ference in probable expression strategy of BPYV is genuine or whether smaller subgenomic dsRNAs are present in low abun dance and have not yet been detected, and if, therefore, BPYV should in fact be classified with the closteroviruses remain to be seen. Here we report a reliable method of cloning BPYV from its associated dsRNA and have shown the method to be applicable to other plant viral dsRNAs. We also examine the potential use of these clones in diagnosis and show a method for polymerase chain reaction (PCR) amplification using dsRNA as a tem
198
Coffin/Coutts
plate together with the use of PCR as a sensitive dignostic probe for BPYV infection in crude plant extracts.
Material and Methods DsRNA Extraction Cucumber seedlings (Cucumis sativis cv Ashley) were artificially infected using viruliferous T. varporariorum and harvested when showing the first signs of infection. DsRNA was extracted by a modification of the method of Valverde et al. [23]: 100 g of infected leaf material was frozen in liquid nitrogen, ground to a fine powder, and thawed into a mixture containing 150 ml GPS (200 mM glycine. 100 mM Na:PHOj, 600 mM NaCl, pH 9.5), 150 ml GPS-saturated phenol, 150 ml chloroform/isoamyl alcohol (24:1), 15 ml 10% SDS, and 1.5 ml (3-mercaptoethanol and stirred at 4° for I h. After separation of the phases ethanol was added to the aqueous phase to 16.5% (v/v) together with 3 g What man CF-ll cellulose and stirred at room temperature for 30 min. The cellulose was pelleted (1,500 g, 5 min) and resuspended in 50 ml STE (100 mM NaCl, 50 mM Tris-HCl. 1 mM EDTA, pH 7.5) plus 16.5% ethanol, shaken for 5 min, and recentrifuged. The resuspension and centrifigugation steps were repeated five times after which the dsRNA was eluted with 4 x 3 ml STE and precipitated with ethanol. The RNA was resuspended in 8.35 ml STE and 1,65 ml ethanol added together with 0.5 g CF-ll cellulose and the binding/washing/elution steps repeated. The final pellet was resuspended in 400 pi 200 m M NaCl, 50 m M NaOAc (pH 4.5), 1m M ZnS04, and 0.5% glycerol and digested with 400 U SI nuclease and 40 U DNAse I (both Pharmacia) at 37° for 60 min. After phenol extraction the sample was applied to a NACS column (BRL) according to the manufacturers' instructions, eluted, and concentrated/washed with 6 ml TE (10 mM Tris-HCl, pH 7.5, 1 m M EDTA) in a Centricon microconcentrator (Amicon). cDNA Cloning 500 ng of dsRNA, estimated by fluorescence in ethidium bromide stained 1% agarose gels, was dena tured in a total volume of 10 pi of 40 mM CH,HgOH containing 0.8 mg/ml pd(N)6(Boehringer) at room tem perature for 20 min, warmed to 37° and 150 pi of a reaction mix containing 500 pM each dNTP, 160 pg/ml pd(N)fr, lx MMLV RT buffer (BRL), and 800 U MMLV reverse transcriptase (BRL), pre-warmed to 37°, added, and incubated at 37° for 20 min. Following
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
tion have largely been unsuccessful [2,5]. Prep arations of the Californian isolate have been produced which contain long flexuous par ticles, 12 nm in diameter and 1,500 to 1,800 nm in length [13], and have allowed the production of an antiserum suitable for indirect ELISA tests; however, no antiserum is generally available. Closteroviruses have previously been di vided into three subgroups A-C according to their particle length. These are represented, re spectively, by apple chlorotic leaf spot virus (730 nm), BYV (1,250-1,450 nm), and citrus tristeza virus (1,650-2,000 nm) [14], but, due to the differing particle structure and expression strategies of these viruses [15-19], it has been suggested that they should be divided into three separate groups [18]. Plants infected with BPYV contain a single species of double-stranded (ds) RNA of MW 7.5 x 106 daltons [20] which is consistent in size with the clostero-subgroup B viruses. However, plants infected with such viruses as well as containing a genomic-length dsRNA also con tain smaller dsRN As [21], suggesting a different expression strategy to BPYV. The subgroup C closteroviruses, while being more similar than subgroup B closteroviruses to BPYV in particle length, also produce multiple dsRNA in in fected plants [22], Thus, at present, BPYV does not fall easily into any of the proposed closterovirus subgroups. Whether the apparent dif ference in probable expression strategy of BPYV is genuine or whether smaller subgenomic dsRNAs are present in low abun dance and have not yet been detected, and if, therefore, BPYV should in fact be classified with the closteroviruses remain to be seen. Here we report a reliable method of cloning BPYV from its associated dsRNA and have shown the method to be applicable to other plant viral dsRNAs. We also examine the potential use of these clones in diagnosis and show a method for polymerase chain reaction (PCR) amplification using dsRNA as a tem
200
Coffin/Coutts
1 2
3
4
w->
w
Fig. 2. Analysis of first-strand cDNA reaction prod ucts under various reaction conditions. Complete firststrand cDNA reactions, performed as described in the text or with one omission or addition and containing 10 pCi [aHP]dCTP, were phenol extracted and ethanol/ ammonium acetate precipitated [32] prior to electro phoresis in a 1% agarose gel. Following electrophoresis the gel was dried and autoradiographed. In lane 1 the primers were only added to the denaturing mix, in lane 2 the reaction was performed with no modification, in lane 3 P-mercaptoethanol was added to the reaction mixture at a final concentration of 40 m A/, and in lane 4 the enzyme was added to the reaction 2 min after the other components. The arrow-labelled W represents the position on the gel of the wells and that labelled DF the position of the bromophenol blue dye front.
termini of an approximately 500-base clone (5' - ACTGCGTCACTCCCGTTCTA and 5' CGGTGGCGAATTACTTGCTT). The 420bp fragment amplified from purified BPYV-associated dsRNA using these primers can also be amplified from total plant nucleic acid and is both infection specific and extremely sensitive. It appears that the template for amplification from plant extracts is virion ssRN A as denatur-
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
but none of these produced cDNA that was detectable by autoradiography. However, the use of elevated primer and CH 3HgOH con centrations together with the dilution into a relatively large reaction volume and omis sion of sulfhydryl compounds such as (I-mercaptoethanol, often used to inactivate the CH3HgOH, did allow relatively efficient syn thesis of cDNA (fig. 2). Using this method, a single reaction produced a sufficient quantity of cDNA to generate approximately 80 clones which varied in size between 100 and 750 bases. The importance of prewarming the reaction components to 37° to obtain maximum yield of cDNA is shown by the fact that no detectable cDNA is produced if reverse transcriptase is added to the reaction mixture only 2 min after the other componentts (fig. 2, lane 4) and illus trates the extremely rapid renaturation times of the separated dsRN A strands. It is important to note, however, that the cDNA has been run on a non-denaturing gel, so the apparently large products shown in figure 2 (lane 2) probably represent short cDNAs hybridized to the RNA template. The procedure shown has also been successful in the production of clones to dsRNA extracted from beet soil-borne virus and tobacco mosaic virus infected plants; the smaller the dsRNA species used as a template, the more efficient appears to be the production of cDNA (data not shown). The initial purpose of producing clones specific to BPYV was as a diagnostic aid, but although these clones will hybridize with purified dsRNA, they are of insufficient sensi tivity to detect viral sequences in total nucleic acid extracts either by northern or dot blotting carried out under conditions suitable for either single-stranded (ss ; 0.05 M NaOH) or ds (0.25 M NaOH) RNA transfer (data not shown). A number of the clones generated in this investigation have been sequenced and some of the information produced used to synthesize opposing oligonucleotides from the
lane 2 diluted into a total nucleic acid extract rom 10 mg of a healthy cucumber plant. Lane 7 shows the amplifi cation products from healthy material alone. Figures to the left indicate sizes, in base pairs, using of the BRL kilobase ladder, b A Southern blot of a probed with the labelled clone (as in figure I) from which the oligonucle otides were derived, c 2 pi of the PCRs shown in a dot blotted onto Hybond N + and probed with the [y?:P]ATP labelled [25] internal oligonucleotide specified in the text. Numbering is as for the lanes in a and b.
ation and high primer concentrations during reverse transcription are unnecessary, whereas when using purified dsRNA as a template the same denaturation and primer concentrations are necessary as are needed to produce cDNA for cloning. In sensitivity tests material extracted from infected cucumber plants was diluted into that extracted from healthy plants to mimic the sit uation when detecting very low levels of natural infection. By gel visualization of the amplifica tion products, infection could be identified using nucleic acid from 1mg of infected cucum
ber plants diluted into nucleic acid from 10 mg of healthy material (fig. 3a), and by Southern blots probed with the labeled clone from which the oligonucleotides were derived, from 100 Ltg (also in 10 mg: fig. 3); the blot is deliberately overexposed to show the signal from high dilu tions. Dot blots of PCRs, when probed with a labelled oligonucleotide internal to that used for amplification (5'-ACTGACCAGGTGGCCAATGC), can be used to provide a more rapid confirma tion of amplification specificity and provide an equal degree of sensitivity to that provided by Southern blots (fig. 3c). None of the oligonucle
201
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
Fig. 3. Analysis of PCR products, a 10 pi of PCRs, performed as indicated in the text, were electrophoresed in a 4% Nusieve agarose (FMC) gel. Lanes I and 8 show amplification products using purified dsRNA as a tem plate (in lane 1 only 2 pi of the reaction was loaded to allow a rough estimation of the degree of amplification, in comparison with lane 8, of the products in the other lanes), lane 2 using total nucleic acid from 10 mg of an infected cucumber plant, and lanes 3-6 using a serial dilution (1 in 10' to 1 in 104) of the nucleic acid used in
otides when used as a labelled probe would detect infection by northern or dot blotting in total nucleic acid extracts from infected plants (results not shown).
Discussion
An obstacle that has been encountered in the molecular analysis of several plant RNA viral diseases, including infection by BPYV and similar viruses, is the unavailability of suitably purified viral preparations that can be used for the extraction of RNA and subsequent cDNA synthesis and cloning. Although dsRNA is often easily obtained from infected plants and can often be used for the diagnosis of a viral infection, this RNA frequently proves to be resistant to attempts to synthesize cDNA, and any clones which are produced tend to be con taminated with host-derived sequences due to remaining host nucleic acid in the dsRNA preparation. The difficulty in producing cDNA to dsRNA may not only be due to the probably artifactual nature of its production [33], but that dsRNA, unlike the B double-helical form usually adopted by dsRNA, adopts the more compact and significantly more stable A form of double helix [34]. This stability increases with the length of the molecule, as, therefore, does the rate of renaturation after melting, and the difficulty in inducing strand separation for long enough to allow the synthesis of cDNA. The method presented here partially over
comes these obstacles, allowing the production of cDN As of moderate length in the systems for which it has been tested, and there is no reason to suppose that it should not be generally ap plicable to other plant viral dsRN As. The meth odology is currently allowing a more thorough molecular study of BPYV and will hopefully in the future allow similar studies to be under taken on other viruses which are of an as yet intractable nature. BPYV has caused considerable economic damage to growers of glasshouse crops in the UK and Europe, but currently there is no gen erally available means of diagnosis of infection other than by laborious and far from rapid backtransmission tests using the whitefiy vec tor. This simple and rapid PC'R protocol should allow the efficient diagnosis of BPYV infection and should also help in the confirmation of the relatedness or otherwise of the various viral diseases suspected to be caused by it or by other viruses transmitted in a similar manner and producing similar symptoms in infected plants.
Acknowledgments We would like to thank Dr. Peter Seller and Dr. S.A. Hill at the MAFF Harpenden Laboratories, UK for respectively, providing access to infected material and suggesting the project. The Hybaid Thermal Reactor was provided by a grant from the Royal Society, and R.S.C. is in receipt of a MAFF postgraduate student ship. This work was carried out under MAFF licence number PHF 1250/81.
References
202
2 von Dorst HJM, Huijberts N. Bos L: Yellows of glasshouse vegetables, transmitted by Trialeurodes vapo rariorum. Neth J Plant Pathol 1983: 89:171-174.
Coffin/Coutts
3 Russel GE, Duffus JE: An aphidtransmitted yellowing virus disease of lettuce in England. Plant Pathol 1970;19:148-149.
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
I Duffus JE: Beet pseudo-yellows virus, transmitted by the greenhouse whitefiy (Trialeurodes vaporariorum). Phytopathology 1965:55:450-453.
15 Yoshikawa N, Takahashi T : Properties of the RNAs and proteins of apple stem grooving and apple chlo rotic leaf spot viruses. J Gen Virol 1988;69:241-245. 16 Dulieu P, Bar-Joseph M: In vitro translation of citrus tristeza virus coat protein from a 0.8 kbp doublestranded RNA segment. J Gen Virol 1990;71:443-447. 17 Karesev AV, Agranovsky AA, Rogov VV, Miroshnichenko NA, Dolja VV, Atabekov JG: Virion RNA of beet yellows closterovirus: Cell free trans lation and some properties. J Gen Virol 1989:70:241-245. 18 Agranovsky AA, Boyko VP, Karesev AV, Lunina NA, Koonin EV, Dolja W : Nucleotide sequence of the 3'terminal half of beet yellows clostero virus RNA genome: Unique arrange ment of eight virus genes. J Gen Virol 1991;72:15-23. 19 German S, CandresseT, Lanneau M, Huet JC, Pemollel JC, DunezJ: Nu cleotide sequence and genomic or ganisation of apple chlorotic leaf spot closterovirus. Virology 1990 ; 179:104-112. 20 Coffin RS, Coutts RHA: The recent occurrence of beet pseudo-yellows virus in England. Plant Pathol 1990;39:632-635. 21 Hiebert E, Dougherty WG: Organisation and expression of the viral genomes; in Milne RG (ed): The Plant Viruses. New York, Plenum Press, 1988, vol 4, pp 172-174. 22 Dodds JA, Jordan RL, Roistacher CN, Jarupat T: Diversity of citrus tristeza virus isolates indicated by dsRNA analysis. Intervirology 1987: 27:177-188. 23 Valverde RA, Dodds JA, Heick JA: Double-stranded ribonucleic acid from plants infected with viruses hav ing elongated paticles and undivided genomes. Phytopathology 1986;76: 459-465. 24 GublerU, Hoffman BJ: A simple and very efficient method for generating cDNA libraries. Gene 1983 ;25: 263-268.
25 Sambrook J, Fritsch EF, ManiatisT: Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor, Cold Spring Harbor Laboratory. 1989. 26 Lichtenstein CP. Draper J : Genetic engineering of plants; in Glover DM (ed): DNA Cloning: A Practical Ap proach. Oxford, 1RL Press, 1985, vol II. p 110. 27 Antoniw JF, Linthorst HJM, White RF, Bol J F: The molecular cloning of the double stranded RNA o f beet cryptic virus. J Gen Virol 1986:67: 2047-2051. 28 Asamizu T, Summers D, Motika M B. Anzola JV, Nuss DL: Molecular cloning and characterisation of the genome of wound tumor virus: A tumor inducing plant reovirus. Viro logy 1985;144:398-409. 29 Cashdollar LM, Esparza J. Hudson GR, Chmelo R, Lee PWK, Joklik WK: Cloning the double-stranded genes of reovirus: Sequence of the cloned S2 gene. Proc Natl Acad Sci USA 1982;79:7644-7648. 30 Azad AA. Barrett SA, Fahey K J: The characterisation and molecular clon ing of the double-stranded RNA genome of an Australian strain of infectious bursal disease virus. Viro logy 1985:143:35-44. 31 Jelkmann W, Martin RR. Maiss E: Cloning of four plant viruses from small quantities of double-stranded RNA. Phytopathology 1989:79: 1250-1253. 32 Okayama H, Berg P: High efficiency cloning of full length cDNA. Mol Cell Biol 1982:2:161-168. 33 Gamier M, Mamoun R. Bove JM: TYMV RNA replication in vivo: replicative intermediate is mainly single stranded. Virology 1980:104: 357-374. 34 Lewin B, Genes, ed 4. Oxford, Ox ford University Press, 1990.
203
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
4 van Dorsl HJM. Huijberts N, Bos L: A whitefly-transmitted disease of glasshouse vegetables, a novelty for Europe. Neth J Plant Pathol 1980:86: 311-313. 5 Lot H, Omillon JC, Lecoq H: Une nouvelle maladie à virus de la laitue de serre: La jaunisse transmise par la mouche blanche. PHM Rev 1980: 31-34. 6 Ragozzino A, Picirillo P: 1 «giallume» della lattuga in Campania. Atti G Fitopatol San Remo 1982 (suppl 15-18): 15—19. 7 Esteva J, Nuez F, Cuartero J: A yel lowing disease of melon in the south east coast o f Spain; in RisserG, Pitrat M (eds): Cucurbitaceae. Paris, INRA Publications, 1988, vol 88, p 208. 8 Hristova DP, Jankulova MD, Natskova VS: 'Chlorosis’ in cucumbers: A new viral disease in Bulgaria. C R Acad BuIgSci 1983 ;36:1093-1096. 9 Hristova DP, Natskova VS: Interre lation between Trialeiirodes vuporariorum W. and the virus causing infectious chlorosis in cucumbers. C R Acad Bulg Sci 1986:39:105-108. 10 Yamashita S, Doi Y, Yora K, Yoshino M: Cucumber yellows virus: Its transmission by the green house whitefly. Trialeiirodes vaporariorum (Westwood), and the yel lowing disease of cucumber and muskmelon caused by the virus. Ann Phytopathol Soc Jpn 1979; 45:484-496. 11 Duffus JE, Johnstone GR: Beet pseudo-yellows virus in Tasmania. The first report of a whitefly trans mitted virus in Australia. Aust Plant Pathol 1981;10:68-69. 12 Lot H, Delecolle B, Lecoq B, Lecoq H : A whitefly transmitted virus caus ing muskmelon yellows in France. Acta Horticult 1983:127:175-182. 13 Liu H, Duffus JE: Beet pseudo-yel lows virus : Purification and serology. Phytopathology 1990:80:866-869. 14 Bar-JosephM, Murant AF:Closterovirus group. CMI/AAB Descriptions of Plant Viruses 1982, No 260.
Intervirology 1992;33:197-203
Imperial College of Science, Technology and Medicine, London, UK
DsRNA Cloning and Diagnosis of Beet Pseudo-Yellows Virus by PCR and Nucleic Acid Hybridization
Key Words
Summary
Beet pseudo-yellows virus Closterovirus Double-stranded RNA Polymerase chain reaction
DsRNA has been extracted from beet pseudo-yellows virus infected cucumber plants, purified to homogeneity, and cDNA clones to it produced. The clones are of insufficient sensitivity to detect infection-specific RNA in dot and northern blots of crude nucleic acid extracts. However, a knowledge of the sequence of these clones has been used to synthesize oligonucleotides that have been used for polymerase chain reaction amplification of specific sequences from both purified dsRNA and from infected plants and used as a previously unavailable highly sensitive diagnostic probe. The method of cDNA synthesis has been shown to be generally applicable to some other plant viral dsRNAs and should be of use in the production of cDNA clones when virion RNA is unavailable.
Introduction
Beet pseudo-yellows virus (BPYV) is a plant RNA virus with an unusually large host range which is exclusively transmitted by the glass house whitefly Trialeurodes vaporariorum. It was first identified and named in California in 1965 [1] where it was found to cause characteris tic symptoms of yellowing and stunting similar to various mineral deficiencies or beet yellows virus (BYV) infection [2,3] in a variety of crop, weed, and ornamental plants. The virus has
Received : October 22,1991 Accepted : December 4,1991
subsequently become widespread in glasshouse-grown crops in Europe [4-9] to such an extent that in southern Spain the commercial viability of melon crops is threatened [DiazRuiz, personal commun.]. Similar viruses have also been reported in Japan [10] and Australasia [11]. BPYV has tentatively been classified as a closterovirus by its particle morphology and mode of transmission [10, 12], but due to the labile nature of the virus and its tendency to aggregate with host material, together with its low titre in infected plants, attempts at purifica-
R.S. Coffin Imperial College of Science Technology and Medicine Prince Consort Road London SW7 2BB (UK)
©1992 S. Karger AG, Basel 0300-5526/92/ 0334-0197S2.75/0
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
R. S. Coffin R. H. A. Coutts
198
Coffin/Coutts
plate together with the use of PCR as a sensitive dignostic probe for BPYV infection in crude plant extracts.
Material and Methods DsRNA Extraction Cucumber seedlings (Cucumis sativis cv Ashley) were artificially infected using viruliferous T. varporariorum and harvested when showing the first signs of infection. DsRNA was extracted by a modification of the method of Valverde et al. [23]: 100 g of infected leaf material was frozen in liquid nitrogen, ground to a fine powder, and thawed into a mixture containing 150 ml GPS (200 mM glycine, 100 m.W Na2P H 04, 600 m M NaCl, pH 9.5), 150 ml GPS-saturated phenol, 150 ml chloroform/isoamyl alcohol (24:1), 15 ml 10% SDS, and 1.5 ml p-mercaptoethanol and stirred at 4° for 1 h. After separation of the phases ethanol was added to the aqueous phase to 16.5% (v/v) together with 3 g What man CF-1I cellulose and stirred at room temperature for 30 min. The cellulose was pelleted (1,500 g, 5 min) and resuspended in 50 ml STE (100 m M NaCl, 50 m M Tris-HCl. I m M EDTA, pH 7.5) plus 16.5% ethanol, shaken for 5 min, and recentrifuged. The resuspension and centrifigugation steps were repeated five times after which the dsRNA was eluted with 4 x 3 ml STE and precipitated with ethanol. The RNA was resuspended in 8.35 ml STE and 1,65 ml ethanol added together with 0.5 g CF-11 cellulose and the binding/washing/elution steps repeated. The final pellet was resuspended in 400 pl200mAiNaCl,50mM NaOAc(pH 4.5), I mA/ZnS04, and 0.5% glycerol and digested with 400 U SI nuclease and 40 U DNAse I (both Pharmacia) at 37° for 60 min. After phenol extraction the sample was applied to a NACS column (BRL) according to the manufacturers’ instructions, eluted, and concentrated/washed with 6 ml TE (10 m M Tris-HCl, pH 7.5, 1 m M EDTA) in a Centricon microconcentrator (Amicon). cDNA Cloning 500 ng of dsRNA, estimated by fluorescence in ethidium bromide stained 1% agarose gels, was dena tured in a total volume of 10 pi of 40 m M CH3HgOH containing 0.8 mg/ml pd(N)(,(Boehringer) at room tem perature for 20 min, warmed to 37° and 150 pi of a reaction mix containing 500 uM each dNTP. 160 pg/ml pd(N),„ lx MMLV RT buffer (BRL), and 800 U MMLV reverse transcriptase(BRL), pre-warmed to 37°, added, and incubated at 37° for 20 min. Following
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
tion have largely been unsuccessful [2,5]. Prep arations of the Californian isolate have been produced which contain long flexuous par ticles, 12 nm in diameter and 1,500 to 1,800 nm in length [13], and have allowed the production of an antiserum suitable for indirect ELISA tests; however, no antiserum is generally available. Closteroviruses have previously been di vided into three subgroups A-C according to their particle length. These are represented, re spectively, by apple chlorotic leaf spot virus (730 nm), BYV (1,250-1,450 nm), and citrus tristeza virus (1,650-2,000 nm) [14], but, due to the differing particle structure and expression strategies of these viruses [15-19], it has been suggested that they should be divided into three separate groups [18]. Plants infected with BPYV contain a single species of double-stranded (ds) RNA of MW 7.5 x 106 daltons [20] which is consistent in size with the clostero-subgroup B viruses. However, plants infected with such viruses as well as containing a genomic-length dsRNA also con tain smaller dsRN As [21], suggesting a different expression strategy to BPYV. The subgroup C closteroviruses, while being more similar than subgroup B closteroviruses to BPYV in particle length, also produce multiple dsRNA in in fected plants [22]. Thus, at present, BPYV does not fall easily into any of the proposed closterovirus subgroups. Whether the apparent dif ference in probable expression strategy of BPYV is genuine or whether smaller subgenomic dsRNAs are present in low abun dance and have not yet been detected, and if, therefore, BPYV should in fact be classified with the closteroviruses remain to be seen. Here we report a reliable method of cloning BPYV from its associated dsRNA and have shown the method to be applicable to other plant viral dsRNAs. We also examine the potential use of these clones in diagnosis and show a method for polymerase chain reaction (PCR) amplification using dsRNA as a tem
198
Coffin/Coutts
plate together with the use of PCR as a sensitive dignostic probe for BPYV infection in crude plant extracts.
Material and Methods DsRNA Extraction Cucumber seedlings (Cucumis sativis cv Ashley) were artificially infected using viruliferous T. varporariorum and harvested when showing the first signs of infection. DsRNA was extracted by a modification of the method of Valverde et al. [23]: 100 g of infected leaf material was frozen in liquid nitrogen, ground to a fine powder, and thawed into a mixture containing 150 ml GPS (200 mM glycine. 100 mM Na:PHOj, 600 mM NaCl, pH 9.5), 150 ml GPS-saturated phenol, 150 ml chloroform/isoamyl alcohol (24:1), 15 ml 10% SDS, and 1.5 ml (3-mercaptoethanol and stirred at 4° for I h. After separation of the phases ethanol was added to the aqueous phase to 16.5% (v/v) together with 3 g What man CF-ll cellulose and stirred at room temperature for 30 min. The cellulose was pelleted (1,500 g, 5 min) and resuspended in 50 ml STE (100 mM NaCl, 50 mM Tris-HCl. 1 mM EDTA, pH 7.5) plus 16.5% ethanol, shaken for 5 min, and recentrifuged. The resuspension and centrifigugation steps were repeated five times after which the dsRNA was eluted with 4 x 3 ml STE and precipitated with ethanol. The RNA was resuspended in 8.35 ml STE and 1,65 ml ethanol added together with 0.5 g CF-ll cellulose and the binding/washing/elution steps repeated. The final pellet was resuspended in 400 pi 200 m M NaCl, 50 m M NaOAc (pH 4.5), 1m M ZnS04, and 0.5% glycerol and digested with 400 U SI nuclease and 40 U DNAse I (both Pharmacia) at 37° for 60 min. After phenol extraction the sample was applied to a NACS column (BRL) according to the manufacturers' instructions, eluted, and concentrated/washed with 6 ml TE (10 mM Tris-HCl, pH 7.5, 1 m M EDTA) in a Centricon microconcentrator (Amicon). cDNA Cloning 500 ng of dsRNA, estimated by fluorescence in ethidium bromide stained 1% agarose gels, was dena tured in a total volume of 10 pi of 40 mM CH,HgOH containing 0.8 mg/ml pd(N)6(Boehringer) at room tem perature for 20 min, warmed to 37° and 150 pi of a reaction mix containing 500 pM each dNTP, 160 pg/ml pd(N)fr, lx MMLV RT buffer (BRL), and 800 U MMLV reverse transcriptase (BRL), pre-warmed to 37°, added, and incubated at 37° for 20 min. Following
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
tion have largely been unsuccessful [2,5]. Prep arations of the Californian isolate have been produced which contain long flexuous par ticles, 12 nm in diameter and 1,500 to 1,800 nm in length [13], and have allowed the production of an antiserum suitable for indirect ELISA tests; however, no antiserum is generally available. Closteroviruses have previously been di vided into three subgroups A-C according to their particle length. These are represented, re spectively, by apple chlorotic leaf spot virus (730 nm), BYV (1,250-1,450 nm), and citrus tristeza virus (1,650-2,000 nm) [14], but, due to the differing particle structure and expression strategies of these viruses [15-19], it has been suggested that they should be divided into three separate groups [18]. Plants infected with BPYV contain a single species of double-stranded (ds) RNA of MW 7.5 x 106 daltons [20] which is consistent in size with the clostero-subgroup B viruses. However, plants infected with such viruses as well as containing a genomic-length dsRNA also con tain smaller dsRN As [21], suggesting a different expression strategy to BPYV. The subgroup C closteroviruses, while being more similar than subgroup B closteroviruses to BPYV in particle length, also produce multiple dsRNA in in fected plants [22], Thus, at present, BPYV does not fall easily into any of the proposed closterovirus subgroups. Whether the apparent dif ference in probable expression strategy of BPYV is genuine or whether smaller subgenomic dsRNAs are present in low abun dance and have not yet been detected, and if, therefore, BPYV should in fact be classified with the closteroviruses remain to be seen. Here we report a reliable method of cloning BPYV from its associated dsRNA and have shown the method to be applicable to other plant viral dsRNAs. We also examine the potential use of these clones in diagnosis and show a method for polymerase chain reaction (PCR) amplification using dsRNA as a tem
200
Coffin/Coutts
1 2
3
4
w->
w
Fig. 2. Analysis of first-strand cDNA reaction prod ucts under various reaction conditions. Complete firststrand cDNA reactions, performed as described in the text or with one omission or addition and containing 10 pCi [aHP]dCTP, were phenol extracted and ethanol/ ammonium acetate precipitated [32] prior to electro phoresis in a 1% agarose gel. Following electrophoresis the gel was dried and autoradiographed. In lane 1 the primers were only added to the denaturing mix, in lane 2 the reaction was performed with no modification, in lane 3 P-mercaptoethanol was added to the reaction mixture at a final concentration of 40 m A/, and in lane 4 the enzyme was added to the reaction 2 min after the other components. The arrow-labelled W represents the position on the gel of the wells and that labelled DF the position of the bromophenol blue dye front.
termini of an approximately 500-base clone (5' - ACTGCGTCACTCCCGTTCTA and 5' CGGTGGCGAATTACTTGCTT). The 420bp fragment amplified from purified BPYV-associated dsRNA using these primers can also be amplified from total plant nucleic acid and is both infection specific and extremely sensitive. It appears that the template for amplification from plant extracts is virion ssRN A as denatur-
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
but none of these produced cDNA that was detectable by autoradiography. However, the use of elevated primer and CH 3HgOH con centrations together with the dilution into a relatively large reaction volume and omis sion of sulfhydryl compounds such as (I-mercaptoethanol, often used to inactivate the CH3HgOH, did allow relatively efficient syn thesis of cDNA (fig. 2). Using this method, a single reaction produced a sufficient quantity of cDNA to generate approximately 80 clones which varied in size between 100 and 750 bases. The importance of prewarming the reaction components to 37° to obtain maximum yield of cDNA is shown by the fact that no detectable cDNA is produced if reverse transcriptase is added to the reaction mixture only 2 min after the other componentts (fig. 2, lane 4) and illus trates the extremely rapid renaturation times of the separated dsRN A strands. It is important to note, however, that the cDNA has been run on a non-denaturing gel, so the apparently large products shown in figure 2 (lane 2) probably represent short cDNAs hybridized to the RNA template. The procedure shown has also been successful in the production of clones to dsRNA extracted from beet soil-borne virus and tobacco mosaic virus infected plants; the smaller the dsRNA species used as a template, the more efficient appears to be the production of cDNA (data not shown). The initial purpose of producing clones specific to BPYV was as a diagnostic aid, but although these clones will hybridize with purified dsRNA, they are of insufficient sensi tivity to detect viral sequences in total nucleic acid extracts either by northern or dot blotting carried out under conditions suitable for either single-stranded (ss ; 0.05 M NaOH) or ds (0.25 M NaOH) RNA transfer (data not shown). A number of the clones generated in this investigation have been sequenced and some of the information produced used to synthesize opposing oligonucleotides from the
lane 2 diluted into a total nucleic acid extract rom 10 mg of a healthy cucumber plant. Lane 7 shows the amplifi cation products from healthy material alone. Figures to the left indicate sizes, in base pairs, using of the BRL kilobase ladder, b A Southern blot of a probed with the labelled clone (as in figure I) from which the oligonucle otides were derived, c 2 pi of the PCRs shown in a dot blotted onto Hybond N + and probed with the [y?:P]ATP labelled [25] internal oligonucleotide specified in the text. Numbering is as for the lanes in a and b.
ation and high primer concentrations during reverse transcription are unnecessary, whereas when using purified dsRNA as a template the same denaturation and primer concentrations are necessary as are needed to produce cDNA for cloning. In sensitivity tests material extracted from infected cucumber plants was diluted into that extracted from healthy plants to mimic the sit uation when detecting very low levels of natural infection. By gel visualization of the amplifica tion products, infection could be identified using nucleic acid from 1mg of infected cucum
ber plants diluted into nucleic acid from 10 mg of healthy material (fig. 3a), and by Southern blots probed with the labeled clone from which the oligonucleotides were derived, from 100 Ltg (also in 10 mg: fig. 3); the blot is deliberately overexposed to show the signal from high dilu tions. Dot blots of PCRs, when probed with a labelled oligonucleotide internal to that used for amplification (5'-ACTGACCAGGTGGCCAATGC), can be used to provide a more rapid confirma tion of amplification specificity and provide an equal degree of sensitivity to that provided by Southern blots (fig. 3c). None of the oligonucle
201
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
Fig. 3. Analysis of PCR products, a 10 pi of PCRs, performed as indicated in the text, were electrophoresed in a 4% Nusieve agarose (FMC) gel. Lanes I and 8 show amplification products using purified dsRNA as a tem plate (in lane 1 only 2 pi of the reaction was loaded to allow a rough estimation of the degree of amplification, in comparison with lane 8, of the products in the other lanes), lane 2 using total nucleic acid from 10 mg of an infected cucumber plant, and lanes 3-6 using a serial dilution (1 in 10' to 1 in 104) of the nucleic acid used in
otides when used as a labelled probe would detect infection by northern or dot blotting in total nucleic acid extracts from infected plants (results not shown).
Discussion
An obstacle that has been encountered in the molecular analysis of several plant RNA viral diseases, including infection by BPYV and similar viruses, is the unavailability of suitably purified viral preparations that can be used for the extraction of RNA and subsequent cDNA synthesis and cloning. Although dsRNA is often easily obtained from infected plants and can often be used for the diagnosis of a viral infection, this RNA frequently proves to be resistant to attempts to synthesize cDNA, and any clones which are produced tend to be con taminated with host-derived sequences due to remaining host nucleic acid in the dsRNA preparation. The difficulty in producing cDNA to dsRNA may not only be due to the probably artifactual nature of its production [33], but that dsRNA, unlike the B double-helical form usually adopted by dsRNA, adopts the more compact and significantly more stable A form of double helix [34]. This stability increases with the length of the molecule, as, therefore, does the rate of renaturation after melting, and the difficulty in inducing strand separation for long enough to allow the synthesis of cDNA. The method presented here partially over
comes these obstacles, allowing the production of cDN As of moderate length in the systems for which it has been tested, and there is no reason to suppose that it should not be generally ap plicable to other plant viral dsRN As. The meth odology is currently allowing a more thorough molecular study of BPYV and will hopefully in the future allow similar studies to be under taken on other viruses which are of an as yet intractable nature. BPYV has caused considerable economic damage to growers of glasshouse crops in the UK and Europe, but currently there is no gen erally available means of diagnosis of infection other than by laborious and far from rapid backtransmission tests using the whitefiy vec tor. This simple and rapid PC'R protocol should allow the efficient diagnosis of BPYV infection and should also help in the confirmation of the relatedness or otherwise of the various viral diseases suspected to be caused by it or by other viruses transmitted in a similar manner and producing similar symptoms in infected plants.
Acknowledgments We would like to thank Dr. Peter Seller and Dr. S.A. Hill at the MAFF Harpenden Laboratories, UK for respectively, providing access to infected material and suggesting the project. The Hybaid Thermal Reactor was provided by a grant from the Royal Society, and R.S.C. is in receipt of a MAFF postgraduate student ship. This work was carried out under MAFF licence number PHF 1250/81.
References
202
2 von Dorst HJM, Huijberts N. Bos L: Yellows of glasshouse vegetables, transmitted by Trialeurodes vapo rariorum. Neth J Plant Pathol 1983: 89:171-174.
Coffin/Coutts
3 Russel GE, Duffus JE: An aphidtransmitted yellowing virus disease of lettuce in England. Plant Pathol 1970;19:148-149.
Cloning and Diagnosis of BPYV
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
I Duffus JE: Beet pseudo-yellows virus, transmitted by the greenhouse whitefiy (Trialeurodes vaporariorum). Phytopathology 1965:55:450-453.
15 Yoshikawa N, Takahashi T : Properties of the RNAs and proteins of apple stem grooving and apple chlo rotic leaf spot viruses. J Gen Virol 1988;69:241-245. 16 Dulieu P, Bar-Joseph M: In vitro translation of citrus tristeza virus coat protein from a 0.8 kbp doublestranded RNA segment. J Gen Virol 1990;71:443-447. 17 Karesev AV, Agranovsky AA, Rogov VV, Miroshnichenko NA, Dolja VV, Atabekov JG: Virion RNA of beet yellows closterovirus: Cell free trans lation and some properties. J Gen Virol 1989:70:241-245. 18 Agranovsky AA, Boyko VP, Karesev AV, Lunina NA, Koonin EV, Dolja W : Nucleotide sequence of the 3'terminal half of beet yellows clostero virus RNA genome: Unique arrange ment of eight virus genes. J Gen Virol 1991;72:15-23. 19 German S, CandresseT, Lanneau M, Huet JC, Pemollel JC, DunezJ: Nu cleotide sequence and genomic or ganisation of apple chlorotic leaf spot closterovirus. Virology 1990 ; 179:104-112. 20 Coffin RS, Coutts RHA: The recent occurrence of beet pseudo-yellows virus in England. Plant Pathol 1990;39:632-635. 21 Hiebert E, Dougherty WG: Organisation and expression of the viral genomes; in Milne RG (ed): The Plant Viruses. New York, Plenum Press, 1988, vol 4, pp 172-174. 22 Dodds JA, Jordan RL, Roistacher CN, Jarupat T: Diversity of citrus tristeza virus isolates indicated by dsRNA analysis. Intervirology 1987: 27:177-188. 23 Valverde RA, Dodds JA, Heick JA: Double-stranded ribonucleic acid from plants infected with viruses hav ing elongated paticles and undivided genomes. Phytopathology 1986;76: 459-465. 24 GublerU, Hoffman BJ: A simple and very efficient method for generating cDNA libraries. Gene 1983 ;25: 263-268.
25 Sambrook J, Fritsch EF, ManiatisT: Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor, Cold Spring Harbor Laboratory. 1989. 26 Lichtenstein CP. Draper J : Genetic engineering of plants; in Glover DM (ed): DNA Cloning: A Practical Ap proach. Oxford, 1RL Press, 1985, vol II. p 110. 27 Antoniw JF, Linthorst HJM, White RF, Bol J F: The molecular cloning of the double stranded RNA o f beet cryptic virus. J Gen Virol 1986:67: 2047-2051. 28 Asamizu T, Summers D, Motika M B. Anzola JV, Nuss DL: Molecular cloning and characterisation of the genome of wound tumor virus: A tumor inducing plant reovirus. Viro logy 1985;144:398-409. 29 Cashdollar LM, Esparza J. Hudson GR, Chmelo R, Lee PWK, Joklik WK: Cloning the double-stranded genes of reovirus: Sequence of the cloned S2 gene. Proc Natl Acad Sci USA 1982;79:7644-7648. 30 Azad AA. Barrett SA, Fahey K J: The characterisation and molecular clon ing of the double-stranded RNA genome of an Australian strain of infectious bursal disease virus. Viro logy 1985:143:35-44. 31 Jelkmann W, Martin RR. Maiss E: Cloning of four plant viruses from small quantities of double-stranded RNA. Phytopathology 1989:79: 1250-1253. 32 Okayama H, Berg P: High efficiency cloning of full length cDNA. Mol Cell Biol 1982:2:161-168. 33 Gamier M, Mamoun R. Bove JM: TYMV RNA replication in vivo: replicative intermediate is mainly single stranded. Virology 1980:104: 357-374. 34 Lewin B, Genes, ed 4. Oxford, Ox ford University Press, 1990.
203
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/28/2018 4:43:59 PM
4 van Dorsl HJM. Huijberts N, Bos L: A whitefly-transmitted disease of glasshouse vegetables, a novelty for Europe. Neth J Plant Pathol 1980:86: 311-313. 5 Lot H, Omillon JC, Lecoq H: Une nouvelle maladie à virus de la laitue de serre: La jaunisse transmise par la mouche blanche. PHM Rev 1980: 31-34. 6 Ragozzino A, Picirillo P: 1 «giallume» della lattuga in Campania. Atti G Fitopatol San Remo 1982 (suppl 15-18): 15—19. 7 Esteva J, Nuez F, Cuartero J: A yel lowing disease of melon in the south east coast o f Spain; in RisserG, Pitrat M (eds): Cucurbitaceae. Paris, INRA Publications, 1988, vol 88, p 208. 8 Hristova DP, Jankulova MD, Natskova VS: 'Chlorosis’ in cucumbers: A new viral disease in Bulgaria. C R Acad BuIgSci 1983 ;36:1093-1096. 9 Hristova DP, Natskova VS: Interre lation between Trialeiirodes vuporariorum W. and the virus causing infectious chlorosis in cucumbers. C R Acad Bulg Sci 1986:39:105-108. 10 Yamashita S, Doi Y, Yora K, Yoshino M: Cucumber yellows virus: Its transmission by the green house whitefly. Trialeiirodes vaporariorum (Westwood), and the yel lowing disease of cucumber and muskmelon caused by the virus. Ann Phytopathol Soc Jpn 1979; 45:484-496. 11 Duffus JE, Johnstone GR: Beet pseudo-yellows virus in Tasmania. The first report of a whitefly trans mitted virus in Australia. Aust Plant Pathol 1981;10:68-69. 12 Lot H, Delecolle B, Lecoq B, Lecoq H : A whitefly transmitted virus caus ing muskmelon yellows in France. Acta Horticult 1983:127:175-182. 13 Liu H, Duffus JE: Beet pseudo-yel lows virus : Purification and serology. Phytopathology 1990:80:866-869. 14 Bar-JosephM, Murant AF:Closterovirus group. CMI/AAB Descriptions of Plant Viruses 1982, No 260.
