Cell Biochem Biophys (2015) 71:299–305 DOI 10.1007/s12013-014-0198-8
ORIGINAL PAPER
Effect of Different Iodine Concentrations on Well-Differentiated Thyroid Cancer Cell Behavior and its Inner Mechanism Jun Xiang • Xuemei Wang • Zhuoying Wang Yi Wu • Duanshu Li • Qiang Shen • Tuanqi Sun • Qing Guan • Yunjun Wang
•
Published online: 14 August 2014 Ó Springer Science+Business Media New York 2014
Abstract High iodine intake might be an important factor in the promotion of thyroid cancer and the incidence of thyroid carcinoma has increased obviously these years especially in area of high iodine intake, though the mechanism of which remains unknown. The aim of present study was to gain more insight into the influence of different iodine concentrations on cell behavior, such as proliferation and migration, and to further investigate its molecular mechanism using two well-differentiated thyroid cancer cell lines. Our study evaluated the effect of different iodine concentrations on cell behavior and investigated relevant molecules involved. The results indicated that iodine in vitro could promote the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Such effect may be related to signaling pathways as Akt and Erk and cytokine VEGF-A. Keywords High iodine intake Thyroid cancer Thyroid carcinoma Iodine concentration on cell behavior Akt Erk Cytokine VEGF-A
J. Xiang Z. Wang (&) Y. Wu D. Li Q. Shen T. Sun Q. Guan Y. Wang Department of Head and Neck Surgery, Shanghai Cancer Center (FUSCC), Fudan University, Shanghai 200032, China e-mail: [email protected] J. Xiang Z. Wang Y. Wu D. Li Q. Shen T. Sun Q. Guan Y. Wang Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, China X. Wang Department of Ultrasound, Obstetrics and Gynecology Hospital of Fudan University, Shanghai 200011, China
Background Thyroid carcinoma, the most common endocrine malignancy, is mainly composed of four subtypes: papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), medullary thyroid cancer (MTC), and anaplastic thyroid cancer (ATC), 95 % of which correspond to the differentiated thyroid cancer (including PTC and FTC) [1]. Recent epidemiological surveys show that the incidence of thyroid carcinoma has increased obviously these years in many regions and countries especially in coastal area of East Asia, an area of high iodine intake [2–7]. Although there were mounting evidences demonstrating similar patterns of increase, the detailed mechanism of such phenomenon is still relatively unknown [8]. Some of the epidemiological surveys indicate that high iodine intake might be an important factor in the promotion of thyroid cancer, especially PTC [9]. Iodine plays an important role in the normal thyroid physiology as regulate the differentiation and proliferation of thyroid cells. Such element is helpful for the maintenance of the normalcy of thyroid tissues and the synthesis of thyroid hormones. However, the impact of iodine on the progression of thyroid cancer is controversial. Whether iodine actually promotes or prevents the progression of thyroid cancer remains unclear. On one hand, iodine may prevent thyroid cancer development by inducing the death of tumor cells via apoptosis. Moreover, iodine could also prevent the transformation from differentiated thyroid cancer (DTC) to ATC [10–12]. On the other hand, an increase in the prevalence of thyroid disease has been found with increasing iodine intake. For example, in Korea and Shenyang, China, after universal salt iodization, the detection rate of thyroid cancer increased significantly [13, 14].
123
300
However, there has been little research on the molecular biology effect of iodine on the promotion of thyroid cancer. Much of the current research focuses on the epidemiological survey, mostly benign thyroid diseases. In the present study, we aim to explore the mechanism responsible for iodine-induced biological cell behavior of thyroid cancer cells. This study analyzes the effect of different iodine concentrations on thyroid cancer cell culture, and the result may helpful for understanding the role that iodine plays on the progression of thyroid cancer.
Materials and Methods Cell Culture and Reagents The well-differentiated human PTC cell line W3 and human FTC cell line FTC133 were obtained from the Chinese Academy of Sciences, Shanghai, China. The two cell lines were cultured in DMEM medium (Gibco, Grand Island, NY, USA) supplemented with 10 % fetal bovine serum (Hyclone, Logan, UT, USA) in a humidified atmosphere of 5 % CO2 at 37 °C. These cells were sub-cultured by adding 0.05 % trypsin– 0.01 % EDTA (Gibco) when the cells reached 80 % confluence. Iodine was purchased from Sigma Aldrich, St. Louis, MO, USA. The antibodies against p-Akt, t-Akt,p-Erk,t-Erk, p-NF-jB, and t-NF-jB were purchased from Cell Signaling Technology, Danvers, MA, USA. The anti-GAPDH antibody was purchased from KangChen Bio Co., Shanghai, China. Cell Proliferation Assay Sulforhodamine B (SRB) was used to detect the effect of iodine on the proliferation of thyroid cancer cells. The two cancer cell line cells (3.0 9 103 cells per well in 100 ll medium) were seeded in 96-well plates overnight. The next day, the cells were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. The culture medium was changed daily to maintain the concentration of iodine. After 72 h, 50 ll of 30 % trichloroacetic acid (TSA) was added in 96-well plate for 60 min at 4 °C. After washing and drying the plate, 100 ll of 0.4 % SRB was added for 30 min. Next, the plate was rinsed with 0.1 % acetic acid and air dried, and 100 ll of Tris base (10 mmol/L) was added before shaking the plate for 5 min. The SRB value was measured at a wavelength of 490 nm. The experiment was performed in quintuplicate and repeated three times. Western Blotting Analysis W3 cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of
123
Cell Biochem Biophys (2015) 71:299–305
each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-3, and 1.0 9 10-5 mM, respectively. After 72 h, the control and treated cells were washed with PBS and then lysed with RIPA solution (Beyotime Institute of Biotechnology, Haimen, Jiangsu, China). The lysate was cleared by centrifugation at 12,000 rpm for 30 min, and the protein was then quantified by the bicinchoninic acid (BCA) (Beyotime Institute of Biotechnology) method. Proteins (30 lg/lane) were separated using 10–15 % SDS-PAGE and transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). Following blocking with 5 % BSA-TBST for 2 h at room temperature, the membrane was incubated with the primary antibodies overnight at 4 °C. The membrane was then incubated with HRP–conjugated secondary antibodies (Beyotime Institute of Biotechnology; 1:5,000) for 1 h at room temperature. Protein bands were visualized by ECL (PerkinElmer, Waltham, MA, USA), with GAPDH as a loading control. Real-Time PCR Analysis The two cancer cell line cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. After 72 h, the total cellular RNA was extracted from the cell pellets using Trizol (Invitrogen, Carlsbad, CA, USA) and then transcribed into cDNA with a RevertAidTM first strand cDNA synthesis kit (Fermentas, Lithuania) using 2 lg of total RNA and oligo(dT) primers. The quantitative PCR reactions included 2 ll of cDNA and 10 ll of SYBR Green Master Mix (TaKaRa, Dalian, Liaoning, China) with a pair of primers. The reactions were monitored on the ABI PRISM 7500 sequence system (Applied Biosystems, Foster City, CA, USA). mRNA level of VEGF-A and TGF-b1 was calculated using the equation 2DDCt and normalized to human GAPDH mRNA levels. The primer sequences for specific mRNA are shown in Table 1.
Table 1 Primer sequences for specific genes Gene
Primer pair sequences (50 –30 )
VEGF-A
F primer: AATCATCACGAAGTGGTGAAG R primer: AATCTGCATGGTGATGTTGGA
TGF-b1
F primer: CAACAATTCCTGGCGATACCT
GAPDH
F primer: TTCACCACCATGGAGAAGGCTG R primer: TTCCACGATACCAAAGTTGTCA
R primer: GCTAAGGCGAAAGCCCTCAAT
Cell Biochem Biophys (2015) 71:299–305
301
Enzyme-Linked Immunosorbent Assay (ELISA) The two cancer cell line cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. Supernatants were harvested after 72 h and centrifuged at 20009g to measure the concentration of VEGF-A and TGF-b1 secreted by the thyroid cancer cells via ELISA according to the manufacturer’s instructions for the ELISA kit(R&D Systems, Minneapolis, MN, USA). Migration Analysis The transwell system (24-well insert; pore size, 8 mm; Corning Costar, Lowell, MA, USA) was used to explore the effect of different iodine concentrations on the invasiveness of thyroid cancer cells. The inserts were coated with 30 ll of Matrigel (BD Biosciences, San Jose, CA, USA). 600 ll complete medium supplemented with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-3, and 1.0 9 10-5 mM, respectively was added to the lower well of the chamber. The two thyroid cancer cell line cells were suspended in 0.2 ml of fresh medium without fetal bovine serum at a concentration
Fig. 2 The mRNA level of cytokine VEGF-A and TGF-b1 of thyroid cancer cells incubated with different iodine concentrations was analyzed by Real-time PCR. The mRNA level of VEGF-A was upregulated in the two thyroid cancer cell lines W3 and FTC133 incubated with low iodine concentration (1.0 9 10-5, 1.0 9 10-4,
Fig. 1 Iodine of low concentration had a positive effect, while iodine of high concentration had a negative effect on the proliferation of thyroid cancer cells. Thyroid cancer cell lines W3 and FTC133 were used to examine the effects of different iodine concentrations (0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM) after incubation for 72 h. Cell proliferation evaluated by SRB suggested that cells incubated with iodine at concentration of 1.0 9 10-3 mM increased most greatly. Moreover, cells incubated with iodine at concentration of 1.0 9 10-1 mM grew more slowly than that of control group. (**P \ 0.01, *P \ 0.05)
and 1.0 9 10-3 mM) and downregulated in that with high iodine concentration (1.0 9 10-2, 1.0 9 10-1 mM) after 72 h incubation. However, different iodine concentrations had slight influence on the mRNA level of TGF-b1; a W3, b FTC133, c W3, d FTC133. (**P \ 0.01, *P \ 0.05)
123
302
Cell Biochem Biophys (2015) 71:299–305
Fig. 3 The level of cytokine VEGF-A and TGF-b1 secreted in culture supernatant by thyroid cancer cells incubated with different iodine concentrations was analyzed by ELISA. The level of VEGF-A was upregulated in the two thyroid cancer cell lines W3 and FTC133 incubated with low concentration of iodine (1.0 9 10-5, 1.0 9 10-4,
and 1.0 9 10-3 mM) and downregulated in that with high concentration of iodine (1.0 9 10-2, 1.0 9 10-1 mM) after 72 h incubation. However, different iodine concentrations had slight influence on the level of TGF-b1; a W3, b FTC133, c W3, d FTC133. (**P \ 0.01, *P \ 0.05)
of 1 9 104 cells. Cell suspensions were then added to the upper well of the chamber. After incubation at 37 °C in 5 % CO2-humidified atmosphere for 24 h, the cells on the upper surface of the membrane were swiped with cotton swabs. Non-migrating cells on the upper surface were scraped gently and washed out with PBS 3 times. The cells adhering to the lower surface of the inserts were then fixed and stained with hematoxylin. Six representative fields of each insert were randomly counted using an Olympus light microscope.
proliferation evaluated by SRB suggested that cells incubated with iodine at concentration of 1.0 9 10-3 mM increased most greatly. Iodine below such concentration could promote, while iodine higher than such concentration could inhibit the growth of thyroid cancer cells. Moreover, cells incubated with iodine at concentration of 1.0 9 10-1 mM grew more slowly than that of control group (Fig. 1) (**P \ 0.01, *P \ 0.05).
Statistical Analysis All data were subjected to statistical analysis and were reported as the mean ± standard deviation. The criterion for statistical significance was taken as P \ 0.05 using a two-tailed t test. The analyses were performed using SPSS 15.0 software.
Results Effect of Iodine Different Concentrations on Thyroid Cancer Cell Growth Thyroid cancer cell lines W3 and FTC133 were used to examine the effects of iodine in cell culture. Cell
123
Effect of Different Iodine Concentrations on mRNA Level and Secretion of Cytokine VEGF-A and TGF-b1 of Thyroid Cancer Cells To understand the mechanisms involved in the growth of thyroid cancer cells under different iodine concentrations, we performed molecule studies on cytokine VEGF-A and TGF-b1 using Real-time PCR and ELISA. We found that after 72 h, the mRNA level of VEGF-A was upregulated in the two thyroid cancer cell line cells incubated with low iodine concentration (1.0 9 10-5, 1.0 9 10-4, and 1.0 9 10-3 mM) and downregulated in that with high iodine concentration (1.0 9 10-2, 1.0 9 10-1 mM). However, there was no significant difference in the mRNA level of TGF-b1 between the iodine treated and untreated group (Fig. 2). In addition, the similar change was found in ELISA test used to assay the level of cytokine VEGF-A
Cell Biochem Biophys (2015) 71:299–305
303
average number of migrating thyroid cancer cells in group of low iodine concentration (1.0 9 10-5, 1.0 9 10-3 mM) upregulated and that number of high concentration iodine group (1.0 9 10-1) downregulated (Fig. 5) (**P\0.01, *P\0.05).
Discussion
Fig. 4 The mechanism of different iodine concentrations on signaling pathways of thyroid cancer cell growth was analyzed by Western Blotting. In thyroid cancer cell line W3, low iodine concentration activated, while high iodine concentration inhibited Akt and Erk signaling pathway. However, in W3, different concentrations of iodine had no obvious effect on the regulation of NF-jB signaling pathways
and TGF-b1 secreted in culture supernatant (Fig. 3) (**P\0.01, *P\0.05). Effect of Different Iodine Concentrations on Signaling Pathways of Thyroid Cancer Cell Growth To understand the mechanism of iodine on signaling pathways of thyroid cancer cell growth, we performed a Western Blotting analysis of W3 cells untreated or different iodine concentrations treated. Figure 4 presents the results analyzed by Western Blotting. We found that iodine of low concentration activated Akt and Erk signaling pathway while iodine of high concentration inhibited Akt and Erk signaling pathway in thyroid cancer cells. However, different iodine concentrations had no obvious effect on the regulation of NF-jB signaling pathways in thyroid cancer cells (Fig. 4). Effect of Different Iodine Concentrations on Migration of Thyroid Cancer Cells To determine the effect of iodine on thyroid cancer cell migration, we carried out matrigel invasion assays in the presence of different iodine concentrations. We found that the
Our present study identifies that iodine promotes the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Iodine is currently attracting attention as it correlates closely to the thyroid physiology. Interestingly, iodine is also tied up with thyroid cancer, though whether such element plays positive or negative role in the initiation and progression of thyroid cancer is still unclear. Iodine is now well known for preventing thyroid cancer dedifferentiation and inducing tumor cells death, probably in the form of apoptosis. However, there were few reports describing its pro-tumor activity. Only epidemiologic data support such point of view, for example, in China after universal salt iodization, the incidence of thyroid cancer increased rapidly with a prominent increase in PTC [14, 15]. A follow-up study of China also indicated that high iodine intake was linked to a high incidence of thyroid cancer [9], though the internal mechanism is still unclear. In this study, we confirmed the effect of iodine on thyroid cancer cell growth and migration and further investigated the mechanism of this effect. Our results indicated that iodine had a dual role in the growth and migration of thyroid cancer cells in vitro. The concentration of iodine below 1.0 9 10-3 mM could promote, while iodine higher than such concentration could inhibit cell growth and migration of thyroid cancer cells. Iodine has antibacterial function itself and that may explain why higher iodine concentration inhibits cell growth and migration in vitro. However, considering the iodine concentration in human thyroid gland within 1.0 9 10-6 to 1.0 9 10-5 mM, high concentration of iodine in vivo may promote the growth and migration of thyroid cancer cells. Moreover, we found that iodine targeted signaling pathway such as Akt and Erk. The trend in cell growth was consistent with signaling molecules as pAkt and pErk. The activity of PI3K/Akt is proved to be required at multiple points during the cell cycle, moreover, Erk pathway is also an important signaling to promote cellular proliferation and migration in response to growth factors [16], exerting an important impact on the cell proliferation and migration. In addition, we found that iodine was connected with vascular endothelial growth factor (VEGF-A) secretion into the culture supernatant of thyroid cancer cells. VEGFA could mediate solid cancers to acquire an independent blood supply to enlarge and develop metastases, which is
123
304
Cell Biochem Biophys (2015) 71:299–305
Fig. 5 The effect of different iodine concentrations on thyroid cancer cell migration was analyzed by matrigel invasion assays. In the two thyroid cancer cell lines W3 and FTC133, the number of migrating thyroid cancer cells incubated with low concentration of iodine
(1.0 9 10-5, 1.0 9 10-3 mM) upregulated and that number of cells incubated with high concentration iodine (1.0 9 10-1 mM) downregulated.; a W3, b FTC133. (**P \ 0.01, *P \ 0.05)
called tumor angiogenesis and vascular remodeling [17]. The VEGF expression in tumor is significantly correlated with microvessel density (MVD) and poor prognosis in human cancers [18, 19]. VEGF activates VEGFR-1 and VEGFR-2 located in the endothelium, which leads to stimulation of endothelial migration, proliferation, permeability, and survival [20]. PI3K/Akt pathway is known to upregulate VEGF-A expression, consistent with the cell proliferation assay and ELISA test in our present study. The rising thyroid cancer rate is related with many factors such as environmental pollution, radioactive contamination, and escalating levels of diagnostic scrutiny. High iodine intake may only be one of them. In addition, though our present study revealed that iodine could promote thyroid cancer cell growth in a specific concentration range in vitro, the effect of iodine on the thyroid cancer cells is quite complex and affected by a number of factors, and besides, it is also hard to verify the feed-back mechanism of multiple hormones in vitro. Therefore, further
studies are required to explore the detailed effect of iodine on the thyroid cancer cells in vivo. In conclusion, iodine in vitro could promote the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Such effect of iodine on cell growth may be related to signaling pathways as Akt and Erk and cytokine VEGF-A. Considering a number of hormones are involved in vivo, further animal experiment is required to investigate the regulation of iodine on thyroid cell growth.
123
Acknowledgments This work has been supported by Grants from the Major Project of Shanghai Municipal Science and Technology Commission (11DJ1400203).
References 1. Morris Luc, G., Sikora Andrew, G., Tosteson Tor, D., et al. (2013). The increasing incidence of thyroid cancer: the influence of access to care. Thyroid, 23(7), 886–892.
Cell Biochem Biophys (2015) 71:299–305 2. Olaleye, O., Ekrikpo, U., Moorthy, R., et al. (2011). Increasing incidence of differentiated thyroid cancer in South East England: 1987–2006. European Archives of Oto-Rhino-Laryngology, 268(6), 899–906. 3. Enewold, L., Zhu, K., Ron, E., et al. (2009). Rising thyroid cancer incidence in the United States by demographic and tumor characteristics, 1980–2005. Cancer Epidemiology Biomarkers and Prevention, 18(3), 784–791. 4. Davies, L., & Welch, H. G. (2006). Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA, 295(18), 2164–2167. 5. Liu, S., Semenciw, R., Ugnat, A. M., et al. (2001). Increasing thyroid cancer incidence in Canada, 1970–1996: Time trends and age-period-cohort effects. British Journal of Cancer, 85(9), 1335–1339. 6. Burgess, J. R. (2002). Temporal trends for thyroid carcinoma in Australia: an increasing incidence of papillary thyroid carcinoma (1982–1997). Thyroid, 12(2), 141–149. 7. Jung, K. W., Park, S., Kong, H. J., et al. (2012). Cancer statistics in Korea: incidence, mortality, survival, and prevalence in 2009. Cancer Research and Treatment, 44(1), 11–24. 8. Leenhardt, L., Grosclaude, P., & Cherie-Challine, L. (2004). Increased incidence of thyroid carcinoma in france: a true epidemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid, 14(12), 1056–1060. 9. Teng, W., Shan, Z., Teng, X., et al. (2006). Effect of iodine intake on thyroid disease in China. The New England Journal of Medicine, 354(26), 2783–2793. 10. Dal Maso, L., Bosetti, C., La Vecchia, C., et al. (2009). Risk factors for thyroid cancer: an epidemiological review focused on nutritional factors. Cancer Causes and Control, 20(1), 75–86. 11. Dijkstra, B., Prichard, R. S., Lee, A., et al. (2007). Changing patterns of thyroid carcinoma. Irish Journal of Medical Science, 176(2), 87–90.
305 12. Maier, J., van Steeg, H., van Oostrom, C., et al. (2007). Iodine deficiency activates antioxidant genes and causes DNA damage in the thyroid gland of rats and mice. Biochimica et Biophysica Acta, 1773(6), 990–999. 13. Cho, B. Y., Choi, H. S., Park, Y. J., et al. (2013). Changes in the clinicopathological characteristics and outcomes of thyroid cancer in Korea over the past four decades. Thyroid, 23(7), 797–804. 14. Dong, W., Zhang, H., Zhang, P., et al. (2013). The changing incidence of thyroid carcinoma in Shenyang, China before and after universal salt iodization. Medical Science Monitor, 19, 49–53. 15. Liu, Y. Q., Zhang, S. Q., Chen, W. Q., et al. (2012). Trend of incidence and mortality on thyroid cancer in China during 2003–2007. Zhonghua liuxingbingxue zazhi, 33(10), 1044–1048. 16. Shaul, Y. D., & Seger, R. (2007). The MEK/ERK cascade: from signaling specificity to diverse functions. Biochimica et Biophysica Acta, 1773(8), 1213–1226. 17. Dvorak, H. F. (2002). Vascular permeability factor/vascular endothelial growth factor: a critical cytokine in tumor angiogenesis and a potential target for diagnosis and therapy. Journal of Clinical Oncology, 20(21), 4368–4380. 18. Ferrara, N., Gerber, H. P., & LeCouter, J. (2003). The biology of VEGF and its receptors. Nature Medicine, 9(6), 669–676. 19. Toi, M., Matsumoto, T., & Bando, H. (2001). Vascular endothelial growth factor: Its prognostic, predictive, and therapeutic implications. Lancet Oncology, 2(11), 667–673. 20. Zhou, Y., Guan, X., Yu, M., et al. (2014). Angiogenic/osteogenic response of BMMSCs on bone-derived scaffold: Effect of hypoxia and role of PI3K/Akt-mediated VEGF-VEGFR pathway. Journal of Biotechnology, 9(7), 944–953.
123
ORIGINAL PAPER
Effect of Different Iodine Concentrations on Well-Differentiated Thyroid Cancer Cell Behavior and its Inner Mechanism Jun Xiang • Xuemei Wang • Zhuoying Wang Yi Wu • Duanshu Li • Qiang Shen • Tuanqi Sun • Qing Guan • Yunjun Wang
•
Published online: 14 August 2014 Ó Springer Science+Business Media New York 2014
Abstract High iodine intake might be an important factor in the promotion of thyroid cancer and the incidence of thyroid carcinoma has increased obviously these years especially in area of high iodine intake, though the mechanism of which remains unknown. The aim of present study was to gain more insight into the influence of different iodine concentrations on cell behavior, such as proliferation and migration, and to further investigate its molecular mechanism using two well-differentiated thyroid cancer cell lines. Our study evaluated the effect of different iodine concentrations on cell behavior and investigated relevant molecules involved. The results indicated that iodine in vitro could promote the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Such effect may be related to signaling pathways as Akt and Erk and cytokine VEGF-A. Keywords High iodine intake Thyroid cancer Thyroid carcinoma Iodine concentration on cell behavior Akt Erk Cytokine VEGF-A
J. Xiang Z. Wang (&) Y. Wu D. Li Q. Shen T. Sun Q. Guan Y. Wang Department of Head and Neck Surgery, Shanghai Cancer Center (FUSCC), Fudan University, Shanghai 200032, China e-mail: [email protected] J. Xiang Z. Wang Y. Wu D. Li Q. Shen T. Sun Q. Guan Y. Wang Department of Oncology, Shanghai Medical College, Fudan University, Shanghai 200032, China X. Wang Department of Ultrasound, Obstetrics and Gynecology Hospital of Fudan University, Shanghai 200011, China
Background Thyroid carcinoma, the most common endocrine malignancy, is mainly composed of four subtypes: papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), medullary thyroid cancer (MTC), and anaplastic thyroid cancer (ATC), 95 % of which correspond to the differentiated thyroid cancer (including PTC and FTC) [1]. Recent epidemiological surveys show that the incidence of thyroid carcinoma has increased obviously these years in many regions and countries especially in coastal area of East Asia, an area of high iodine intake [2–7]. Although there were mounting evidences demonstrating similar patterns of increase, the detailed mechanism of such phenomenon is still relatively unknown [8]. Some of the epidemiological surveys indicate that high iodine intake might be an important factor in the promotion of thyroid cancer, especially PTC [9]. Iodine plays an important role in the normal thyroid physiology as regulate the differentiation and proliferation of thyroid cells. Such element is helpful for the maintenance of the normalcy of thyroid tissues and the synthesis of thyroid hormones. However, the impact of iodine on the progression of thyroid cancer is controversial. Whether iodine actually promotes or prevents the progression of thyroid cancer remains unclear. On one hand, iodine may prevent thyroid cancer development by inducing the death of tumor cells via apoptosis. Moreover, iodine could also prevent the transformation from differentiated thyroid cancer (DTC) to ATC [10–12]. On the other hand, an increase in the prevalence of thyroid disease has been found with increasing iodine intake. For example, in Korea and Shenyang, China, after universal salt iodization, the detection rate of thyroid cancer increased significantly [13, 14].
123
300
However, there has been little research on the molecular biology effect of iodine on the promotion of thyroid cancer. Much of the current research focuses on the epidemiological survey, mostly benign thyroid diseases. In the present study, we aim to explore the mechanism responsible for iodine-induced biological cell behavior of thyroid cancer cells. This study analyzes the effect of different iodine concentrations on thyroid cancer cell culture, and the result may helpful for understanding the role that iodine plays on the progression of thyroid cancer.
Materials and Methods Cell Culture and Reagents The well-differentiated human PTC cell line W3 and human FTC cell line FTC133 were obtained from the Chinese Academy of Sciences, Shanghai, China. The two cell lines were cultured in DMEM medium (Gibco, Grand Island, NY, USA) supplemented with 10 % fetal bovine serum (Hyclone, Logan, UT, USA) in a humidified atmosphere of 5 % CO2 at 37 °C. These cells were sub-cultured by adding 0.05 % trypsin– 0.01 % EDTA (Gibco) when the cells reached 80 % confluence. Iodine was purchased from Sigma Aldrich, St. Louis, MO, USA. The antibodies against p-Akt, t-Akt,p-Erk,t-Erk, p-NF-jB, and t-NF-jB were purchased from Cell Signaling Technology, Danvers, MA, USA. The anti-GAPDH antibody was purchased from KangChen Bio Co., Shanghai, China. Cell Proliferation Assay Sulforhodamine B (SRB) was used to detect the effect of iodine on the proliferation of thyroid cancer cells. The two cancer cell line cells (3.0 9 103 cells per well in 100 ll medium) were seeded in 96-well plates overnight. The next day, the cells were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. The culture medium was changed daily to maintain the concentration of iodine. After 72 h, 50 ll of 30 % trichloroacetic acid (TSA) was added in 96-well plate for 60 min at 4 °C. After washing and drying the plate, 100 ll of 0.4 % SRB was added for 30 min. Next, the plate was rinsed with 0.1 % acetic acid and air dried, and 100 ll of Tris base (10 mmol/L) was added before shaking the plate for 5 min. The SRB value was measured at a wavelength of 490 nm. The experiment was performed in quintuplicate and repeated three times. Western Blotting Analysis W3 cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of
123
Cell Biochem Biophys (2015) 71:299–305
each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-3, and 1.0 9 10-5 mM, respectively. After 72 h, the control and treated cells were washed with PBS and then lysed with RIPA solution (Beyotime Institute of Biotechnology, Haimen, Jiangsu, China). The lysate was cleared by centrifugation at 12,000 rpm for 30 min, and the protein was then quantified by the bicinchoninic acid (BCA) (Beyotime Institute of Biotechnology) method. Proteins (30 lg/lane) were separated using 10–15 % SDS-PAGE and transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). Following blocking with 5 % BSA-TBST for 2 h at room temperature, the membrane was incubated with the primary antibodies overnight at 4 °C. The membrane was then incubated with HRP–conjugated secondary antibodies (Beyotime Institute of Biotechnology; 1:5,000) for 1 h at room temperature. Protein bands were visualized by ECL (PerkinElmer, Waltham, MA, USA), with GAPDH as a loading control. Real-Time PCR Analysis The two cancer cell line cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. After 72 h, the total cellular RNA was extracted from the cell pellets using Trizol (Invitrogen, Carlsbad, CA, USA) and then transcribed into cDNA with a RevertAidTM first strand cDNA synthesis kit (Fermentas, Lithuania) using 2 lg of total RNA and oligo(dT) primers. The quantitative PCR reactions included 2 ll of cDNA and 10 ll of SYBR Green Master Mix (TaKaRa, Dalian, Liaoning, China) with a pair of primers. The reactions were monitored on the ABI PRISM 7500 sequence system (Applied Biosystems, Foster City, CA, USA). mRNA level of VEGF-A and TGF-b1 was calculated using the equation 2DDCt and normalized to human GAPDH mRNA levels. The primer sequences for specific mRNA are shown in Table 1.
Table 1 Primer sequences for specific genes Gene
Primer pair sequences (50 –30 )
VEGF-A
F primer: AATCATCACGAAGTGGTGAAG R primer: AATCTGCATGGTGATGTTGGA
TGF-b1
F primer: CAACAATTCCTGGCGATACCT
GAPDH
F primer: TTCACCACCATGGAGAAGGCTG R primer: TTCCACGATACCAAAGTTGTCA
R primer: GCTAAGGCGAAAGCCCTCAAT
Cell Biochem Biophys (2015) 71:299–305
301
Enzyme-Linked Immunosorbent Assay (ELISA) The two cancer cell line cells (5 9 105 cells per well in 2 ml medium) were seeded in 6-well plate overnight. The next day, the cells of each well were incubated with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM, respectively. Supernatants were harvested after 72 h and centrifuged at 20009g to measure the concentration of VEGF-A and TGF-b1 secreted by the thyroid cancer cells via ELISA according to the manufacturer’s instructions for the ELISA kit(R&D Systems, Minneapolis, MN, USA). Migration Analysis The transwell system (24-well insert; pore size, 8 mm; Corning Costar, Lowell, MA, USA) was used to explore the effect of different iodine concentrations on the invasiveness of thyroid cancer cells. The inserts were coated with 30 ll of Matrigel (BD Biosciences, San Jose, CA, USA). 600 ll complete medium supplemented with iodine at concentration of 0, 1.0 9 10-1, 1.0 9 10-3, and 1.0 9 10-5 mM, respectively was added to the lower well of the chamber. The two thyroid cancer cell line cells were suspended in 0.2 ml of fresh medium without fetal bovine serum at a concentration
Fig. 2 The mRNA level of cytokine VEGF-A and TGF-b1 of thyroid cancer cells incubated with different iodine concentrations was analyzed by Real-time PCR. The mRNA level of VEGF-A was upregulated in the two thyroid cancer cell lines W3 and FTC133 incubated with low iodine concentration (1.0 9 10-5, 1.0 9 10-4,
Fig. 1 Iodine of low concentration had a positive effect, while iodine of high concentration had a negative effect on the proliferation of thyroid cancer cells. Thyroid cancer cell lines W3 and FTC133 were used to examine the effects of different iodine concentrations (0, 1.0 9 10-1, 1.0 9 10-2, 1.0 9 10-3, 1.0 9 10-4, and 1.0 9 10-5 mM) after incubation for 72 h. Cell proliferation evaluated by SRB suggested that cells incubated with iodine at concentration of 1.0 9 10-3 mM increased most greatly. Moreover, cells incubated with iodine at concentration of 1.0 9 10-1 mM grew more slowly than that of control group. (**P \ 0.01, *P \ 0.05)
and 1.0 9 10-3 mM) and downregulated in that with high iodine concentration (1.0 9 10-2, 1.0 9 10-1 mM) after 72 h incubation. However, different iodine concentrations had slight influence on the mRNA level of TGF-b1; a W3, b FTC133, c W3, d FTC133. (**P \ 0.01, *P \ 0.05)
123
302
Cell Biochem Biophys (2015) 71:299–305
Fig. 3 The level of cytokine VEGF-A and TGF-b1 secreted in culture supernatant by thyroid cancer cells incubated with different iodine concentrations was analyzed by ELISA. The level of VEGF-A was upregulated in the two thyroid cancer cell lines W3 and FTC133 incubated with low concentration of iodine (1.0 9 10-5, 1.0 9 10-4,
and 1.0 9 10-3 mM) and downregulated in that with high concentration of iodine (1.0 9 10-2, 1.0 9 10-1 mM) after 72 h incubation. However, different iodine concentrations had slight influence on the level of TGF-b1; a W3, b FTC133, c W3, d FTC133. (**P \ 0.01, *P \ 0.05)
of 1 9 104 cells. Cell suspensions were then added to the upper well of the chamber. After incubation at 37 °C in 5 % CO2-humidified atmosphere for 24 h, the cells on the upper surface of the membrane were swiped with cotton swabs. Non-migrating cells on the upper surface were scraped gently and washed out with PBS 3 times. The cells adhering to the lower surface of the inserts were then fixed and stained with hematoxylin. Six representative fields of each insert were randomly counted using an Olympus light microscope.
proliferation evaluated by SRB suggested that cells incubated with iodine at concentration of 1.0 9 10-3 mM increased most greatly. Iodine below such concentration could promote, while iodine higher than such concentration could inhibit the growth of thyroid cancer cells. Moreover, cells incubated with iodine at concentration of 1.0 9 10-1 mM grew more slowly than that of control group (Fig. 1) (**P \ 0.01, *P \ 0.05).
Statistical Analysis All data were subjected to statistical analysis and were reported as the mean ± standard deviation. The criterion for statistical significance was taken as P \ 0.05 using a two-tailed t test. The analyses were performed using SPSS 15.0 software.
Results Effect of Iodine Different Concentrations on Thyroid Cancer Cell Growth Thyroid cancer cell lines W3 and FTC133 were used to examine the effects of iodine in cell culture. Cell
123
Effect of Different Iodine Concentrations on mRNA Level and Secretion of Cytokine VEGF-A and TGF-b1 of Thyroid Cancer Cells To understand the mechanisms involved in the growth of thyroid cancer cells under different iodine concentrations, we performed molecule studies on cytokine VEGF-A and TGF-b1 using Real-time PCR and ELISA. We found that after 72 h, the mRNA level of VEGF-A was upregulated in the two thyroid cancer cell line cells incubated with low iodine concentration (1.0 9 10-5, 1.0 9 10-4, and 1.0 9 10-3 mM) and downregulated in that with high iodine concentration (1.0 9 10-2, 1.0 9 10-1 mM). However, there was no significant difference in the mRNA level of TGF-b1 between the iodine treated and untreated group (Fig. 2). In addition, the similar change was found in ELISA test used to assay the level of cytokine VEGF-A
Cell Biochem Biophys (2015) 71:299–305
303
average number of migrating thyroid cancer cells in group of low iodine concentration (1.0 9 10-5, 1.0 9 10-3 mM) upregulated and that number of high concentration iodine group (1.0 9 10-1) downregulated (Fig. 5) (**P\0.01, *P\0.05).
Discussion
Fig. 4 The mechanism of different iodine concentrations on signaling pathways of thyroid cancer cell growth was analyzed by Western Blotting. In thyroid cancer cell line W3, low iodine concentration activated, while high iodine concentration inhibited Akt and Erk signaling pathway. However, in W3, different concentrations of iodine had no obvious effect on the regulation of NF-jB signaling pathways
and TGF-b1 secreted in culture supernatant (Fig. 3) (**P\0.01, *P\0.05). Effect of Different Iodine Concentrations on Signaling Pathways of Thyroid Cancer Cell Growth To understand the mechanism of iodine on signaling pathways of thyroid cancer cell growth, we performed a Western Blotting analysis of W3 cells untreated or different iodine concentrations treated. Figure 4 presents the results analyzed by Western Blotting. We found that iodine of low concentration activated Akt and Erk signaling pathway while iodine of high concentration inhibited Akt and Erk signaling pathway in thyroid cancer cells. However, different iodine concentrations had no obvious effect on the regulation of NF-jB signaling pathways in thyroid cancer cells (Fig. 4). Effect of Different Iodine Concentrations on Migration of Thyroid Cancer Cells To determine the effect of iodine on thyroid cancer cell migration, we carried out matrigel invasion assays in the presence of different iodine concentrations. We found that the
Our present study identifies that iodine promotes the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Iodine is currently attracting attention as it correlates closely to the thyroid physiology. Interestingly, iodine is also tied up with thyroid cancer, though whether such element plays positive or negative role in the initiation and progression of thyroid cancer is still unclear. Iodine is now well known for preventing thyroid cancer dedifferentiation and inducing tumor cells death, probably in the form of apoptosis. However, there were few reports describing its pro-tumor activity. Only epidemiologic data support such point of view, for example, in China after universal salt iodization, the incidence of thyroid cancer increased rapidly with a prominent increase in PTC [14, 15]. A follow-up study of China also indicated that high iodine intake was linked to a high incidence of thyroid cancer [9], though the internal mechanism is still unclear. In this study, we confirmed the effect of iodine on thyroid cancer cell growth and migration and further investigated the mechanism of this effect. Our results indicated that iodine had a dual role in the growth and migration of thyroid cancer cells in vitro. The concentration of iodine below 1.0 9 10-3 mM could promote, while iodine higher than such concentration could inhibit cell growth and migration of thyroid cancer cells. Iodine has antibacterial function itself and that may explain why higher iodine concentration inhibits cell growth and migration in vitro. However, considering the iodine concentration in human thyroid gland within 1.0 9 10-6 to 1.0 9 10-5 mM, high concentration of iodine in vivo may promote the growth and migration of thyroid cancer cells. Moreover, we found that iodine targeted signaling pathway such as Akt and Erk. The trend in cell growth was consistent with signaling molecules as pAkt and pErk. The activity of PI3K/Akt is proved to be required at multiple points during the cell cycle, moreover, Erk pathway is also an important signaling to promote cellular proliferation and migration in response to growth factors [16], exerting an important impact on the cell proliferation and migration. In addition, we found that iodine was connected with vascular endothelial growth factor (VEGF-A) secretion into the culture supernatant of thyroid cancer cells. VEGFA could mediate solid cancers to acquire an independent blood supply to enlarge and develop metastases, which is
123
304
Cell Biochem Biophys (2015) 71:299–305
Fig. 5 The effect of different iodine concentrations on thyroid cancer cell migration was analyzed by matrigel invasion assays. In the two thyroid cancer cell lines W3 and FTC133, the number of migrating thyroid cancer cells incubated with low concentration of iodine
(1.0 9 10-5, 1.0 9 10-3 mM) upregulated and that number of cells incubated with high concentration iodine (1.0 9 10-1 mM) downregulated.; a W3, b FTC133. (**P \ 0.01, *P \ 0.05)
called tumor angiogenesis and vascular remodeling [17]. The VEGF expression in tumor is significantly correlated with microvessel density (MVD) and poor prognosis in human cancers [18, 19]. VEGF activates VEGFR-1 and VEGFR-2 located in the endothelium, which leads to stimulation of endothelial migration, proliferation, permeability, and survival [20]. PI3K/Akt pathway is known to upregulate VEGF-A expression, consistent with the cell proliferation assay and ELISA test in our present study. The rising thyroid cancer rate is related with many factors such as environmental pollution, radioactive contamination, and escalating levels of diagnostic scrutiny. High iodine intake may only be one of them. In addition, though our present study revealed that iodine could promote thyroid cancer cell growth in a specific concentration range in vitro, the effect of iodine on the thyroid cancer cells is quite complex and affected by a number of factors, and besides, it is also hard to verify the feed-back mechanism of multiple hormones in vitro. Therefore, further
studies are required to explore the detailed effect of iodine on the thyroid cancer cells in vivo. In conclusion, iodine in vitro could promote the growth of thyroid cancer cells with the increase of iodine concentration in a specific range. Such effect of iodine on cell growth may be related to signaling pathways as Akt and Erk and cytokine VEGF-A. Considering a number of hormones are involved in vivo, further animal experiment is required to investigate the regulation of iodine on thyroid cell growth.
123
Acknowledgments This work has been supported by Grants from the Major Project of Shanghai Municipal Science and Technology Commission (11DJ1400203).
References 1. Morris Luc, G., Sikora Andrew, G., Tosteson Tor, D., et al. (2013). The increasing incidence of thyroid cancer: the influence of access to care. Thyroid, 23(7), 886–892.
Cell Biochem Biophys (2015) 71:299–305 2. Olaleye, O., Ekrikpo, U., Moorthy, R., et al. (2011). Increasing incidence of differentiated thyroid cancer in South East England: 1987–2006. European Archives of Oto-Rhino-Laryngology, 268(6), 899–906. 3. Enewold, L., Zhu, K., Ron, E., et al. (2009). Rising thyroid cancer incidence in the United States by demographic and tumor characteristics, 1980–2005. Cancer Epidemiology Biomarkers and Prevention, 18(3), 784–791. 4. Davies, L., & Welch, H. G. (2006). Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA, 295(18), 2164–2167. 5. Liu, S., Semenciw, R., Ugnat, A. M., et al. (2001). Increasing thyroid cancer incidence in Canada, 1970–1996: Time trends and age-period-cohort effects. British Journal of Cancer, 85(9), 1335–1339. 6. Burgess, J. R. (2002). Temporal trends for thyroid carcinoma in Australia: an increasing incidence of papillary thyroid carcinoma (1982–1997). Thyroid, 12(2), 141–149. 7. Jung, K. W., Park, S., Kong, H. J., et al. (2012). Cancer statistics in Korea: incidence, mortality, survival, and prevalence in 2009. Cancer Research and Treatment, 44(1), 11–24. 8. Leenhardt, L., Grosclaude, P., & Cherie-Challine, L. (2004). Increased incidence of thyroid carcinoma in france: a true epidemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid, 14(12), 1056–1060. 9. Teng, W., Shan, Z., Teng, X., et al. (2006). Effect of iodine intake on thyroid disease in China. The New England Journal of Medicine, 354(26), 2783–2793. 10. Dal Maso, L., Bosetti, C., La Vecchia, C., et al. (2009). Risk factors for thyroid cancer: an epidemiological review focused on nutritional factors. Cancer Causes and Control, 20(1), 75–86. 11. Dijkstra, B., Prichard, R. S., Lee, A., et al. (2007). Changing patterns of thyroid carcinoma. Irish Journal of Medical Science, 176(2), 87–90.
305 12. Maier, J., van Steeg, H., van Oostrom, C., et al. (2007). Iodine deficiency activates antioxidant genes and causes DNA damage in the thyroid gland of rats and mice. Biochimica et Biophysica Acta, 1773(6), 990–999. 13. Cho, B. Y., Choi, H. S., Park, Y. J., et al. (2013). Changes in the clinicopathological characteristics and outcomes of thyroid cancer in Korea over the past four decades. Thyroid, 23(7), 797–804. 14. Dong, W., Zhang, H., Zhang, P., et al. (2013). The changing incidence of thyroid carcinoma in Shenyang, China before and after universal salt iodization. Medical Science Monitor, 19, 49–53. 15. Liu, Y. Q., Zhang, S. Q., Chen, W. Q., et al. (2012). Trend of incidence and mortality on thyroid cancer in China during 2003–2007. Zhonghua liuxingbingxue zazhi, 33(10), 1044–1048. 16. Shaul, Y. D., & Seger, R. (2007). The MEK/ERK cascade: from signaling specificity to diverse functions. Biochimica et Biophysica Acta, 1773(8), 1213–1226. 17. Dvorak, H. F. (2002). Vascular permeability factor/vascular endothelial growth factor: a critical cytokine in tumor angiogenesis and a potential target for diagnosis and therapy. Journal of Clinical Oncology, 20(21), 4368–4380. 18. Ferrara, N., Gerber, H. P., & LeCouter, J. (2003). The biology of VEGF and its receptors. Nature Medicine, 9(6), 669–676. 19. Toi, M., Matsumoto, T., & Bando, H. (2001). Vascular endothelial growth factor: Its prognostic, predictive, and therapeutic implications. Lancet Oncology, 2(11), 667–673. 20. Zhou, Y., Guan, X., Yu, M., et al. (2014). Angiogenic/osteogenic response of BMMSCs on bone-derived scaffold: Effect of hypoxia and role of PI3K/Akt-mediated VEGF-VEGFR pathway. Journal of Biotechnology, 9(7), 944–953.
123
