Bioresource Technology 186 (2015) 25–33

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Effect of pH buffering capacity and sources of dietary sulfur on rumen fermentation, sulfide production, methane production, sulfate reducing bacteria, and total Archaea in in vitro rumen cultures Hao Wu a,b, Qingxiang Meng a, Zhongtang Yu b,⇑ a b

College of Animal Science and Technology and State Key Laboratory of Animal Nutrition, China Agricultural University, Beijing 100193, China Department of Animal Sciences, The Ohio State University, Columbus, OH 43210-1094, USA

h i g h l i g h t s  Effects of dietary sulfur on in vitro fermentation were source dependent.  A relative high culture pH helped improve fermentation and decrease H2S production.  More sulfur in the substrate increased sulfate reducing bacteria abundance.  Effects of culture pH on population of SRB were species dependent.  CH4 production, but not population of total archaea, was inhibited by DDGS.

a r t i c l e

i n f o

Article history: Received 29 December 2014 Received in revised form 24 February 2015 Accepted 27 February 2015 Available online 14 March 2015 Keywords: Buffering capacity Dietary sulfur Hydrogen sulfide Methane Sulfate reducing bacteria

a b s t r a c t The effects of three types of dietary sulfur on in vitro fermentation characteristics, sulfide production, methane production, and microbial populations at two different buffer capacities were examined using in vitro rumen cultures. Addition of dry distilled grain with soluble (DDGS) generally decreased total gas production, degradation of dry matter and neutral detergent fiber, and concentration of total volatile fatty acids, while increasing ammonia concentration. High buffering capacity alleviated these adverse effects on fermentation. Increased sulfur content resulted in decreased methane emission, but total Archaea population was not changed significantly. The population of sulfate reducing bacteria was increased in a sulfur type-dependent manner. These results suggest that types of dietary sulfur and buffering capacity can affect rumen fermentation and sulfide production. Diet buffering capacity, and probably alkalinity, may be increased to alleviate some of the adverse effects associated with feeding DDGS at high levels. Ó 2015 Elsevier Ltd. All rights reserved.

1. Introduction Sulfur is essential for all animals because S-containing compounds, such as amino acids, hormones, B-vitamins, and co-enzymes, are required for normal metabolic, structural, and regulatory functions of all living organisms (Goodrich and Garrett, 1986). The sulfur concentration for the diets of beef cattle recommends by the National Research Council is 0.15% (w/w, on dry matter basis) of the diet, while the maximum tolerable level of dietary sulfur has been based only on the percentage of the

⇑ Corresponding author at: Department of Animal Sciences, The Ohio State University, 2029 Fyffe Road, Columbus, OH 43210, USA. Tel.: +1 (614) 292 3057; fax: +1 (614) 292 2929. E-mail address: [email protected] (Z. Yu). http://dx.doi.org/10.1016/j.biortech.2015.02.110 0960-8524/Ó 2015 Elsevier Ltd. All rights reserved.

forage in the diet. Most of the dietary sulfur ingested by ruminant animals is converted to sulfide by rumen microbes, primarily rumen bacteria, with S-containing amino acids being fermented to sulfide while sulfate being reduced to sulfide by ruminal sulfate-reducing bacteria (SRB) (Coleman, 1960). Although being a small guild of bacteria in the rumen, SRB can have significant impact in cattle fed diets with high sulfur content, such as dried distiller grain with soluble (DDGS). In the last few years, DDGS has become abundantly available and cost competitive as a feed ingredient because of the expansion of bioethanol industry in the United States and beyond. In 2013, the US had nearly 200 bioethanol plants in operation that churned out an estimated nearly 35 million tonnes of distillers grain (mostly corn-based). Corn-based DDGS contains, on average, 30% crude protein (CP), of which 55% is ruminally undegradable, and

26

H. Wu et al. / Bioresource Technology 186 (2015) 25–33

11–17% ether extracts. All of these make DDGS a cost competitive alternative feedstuff for livestock. However, DDGS contains more sulfur than corn, ranging from 0.3% to greater than 1% (Felix et al., 2011), and the high sulfur content in DDGS limits the level of DDGS that can be added to feed. It has been reported that when included at low levels in diet DDGS can be beneficial for both beef (Felix et al., 2011) and dairy cattle (Benchaar et al., 2013; Kurokawa et al., 2013). However, when large amounts of DDGS are included in the ration of ruminant animals, rumen acidosis can result that reduces dry matter intake (DMI) and feed digestibility because DDGS contains sulfuric acid, which is used in controlling pH during ethanol fermentation and in the cleaning process of bioethanol production. Increased DDGS content in diet also increases sulfide production by rumen SRB, increasing the risk of sulfide-associated polioencephalomalacia (PEM) (Felix et al., 2011). Because of these risks, DDGS inclusion is limited to 40% of dry matter (DM) in finishing diets of beef cattle. A large number of studies have been conducted to reduce the risks associated with inclusion of DDGS in diets fed to ruminant animals. Forage-to-concentrate ratio had little effect on DMI or sulfide concentration in the rumen (Amat et al., 2014). The effect of monensin on sulfur metabolism in the rumen is mixed, with one study demonstrating decreased ruminal gaseous sulfide (H2S gas) production and increasing pH (Felix and Loerch, 2011), while another study showing no effect on ruminal H2S gas or aqueous sulfide concentrations or pH (Felix et al., 2012b). Pre-treatment of DDGS with 2% NaOH was shown to increase rumen pH and decrease H2S gas production in feedlot cattle (Felix et al., 2012c). The inverse association between ruminal pH and H2S gas production from DDGS was attributed to increased protonation of aqueous sulfide (Felix et al., 2012c). It was hypothesized that maintaining a relatively high ruminal pH by increasing pH-buffering capacity could decrease ruminal H2S gas production, lowering the risk of sulfur-induced PEM, while improving fiber digestion and rumen fermentation when DDGS is fed. It was also hypothesized that elevated rumen pH would reduce the population of SRB because increased aqueous sulfide concentration can inhibit SRB (Hao et al., 1996). As demonstrated recently (Uwituze et al., 2011a,b), different dietary sulfur sources can also affect ruminal H2S gas production and animal productivity. The objective of this study is to determine the effect of dietary sulfur sources, pH buffering capacity, and their interactions on feed fermentation, fiber digestibility, sulfide production, and abundance of rumen SRB using in vitro rumen cultures as a model.

2. Methods 2.1. Experimental procedures Three sulfur sources, including DDGS, sulfuric acid (SA), and sodium sulfate (SS), and two pH-buffering capacities were evaluated in a 3  2 factorial design (Section 3.1), while the three sulfur sources and three extra (with respect to the sulfur contained in the basal substrates, see below) sulfur addition levels (0%, 0.32%, and 0.64% for Na2SO4 and H2SO4; 0%, 0.3% and 0.5% for DDGS) were evaluated in a 3  3 (Section 3.2) factorial design for this in vitro study. Fresh rumen fluid was collected at approximately 3 h after morning feeding from 2 cannulated lactating Jersey cows that were fed a total mixed ration (TMR) composed (% of DM) of corn silage (39%), a mixture of alfalfa and grass hay (35%), and a concentrate mixture (26%). The cows were fed the TMR (19.0 kg) twice a day at 500 and 1700 h. The cows were cared and handled following the protocols approved by The Ohio State University Animal Care and Use Committee. From each of the two cows, about 250 mL of rumen fluid was collected and combined into a 500 mL bottle,

leaving no headspace in the sample bottle. The sample were brought to the laboratory within 10 min (about 1.5 mile away) and then placed into an anaerobic chamber containing an atmosphere of N2 (85%), H2 (10%), and CO2 (5%). Large feed particles were removed by squeezing the rumen content through four layers of cheesecloth. This fresh rumen fluid preparation was used as the inoculum of the in vitro cultures. 2.2. In vitro ruminal culture incubations The in vitro fermentation was carried out in 120-mL serum bottles in triplicate for each treatment. In order to provide 0.32% (of DM) extra dietary sulfur, 1.39% and 0.97% (of DM) of Na2SO4 and H2SO4, respectively, were added to the basal substrates, which consisted of ground corn (72.9%), soy hulls (15.1%), soybean meal (7.4%), urea (0.4%), and a mineral vitamin mixture (4.2%). For the DDGS treatments, DDGS (60.0%), ground corn (20.0%), soy hulls (15.4%), and the mineral vitamin mixture (4.6%) were used as the substrates. The artificial saliva was prepared anaerobically as described by Menke (1979) but with two different buffering capacities, with the low buffering capacity (LBC) saliva containing half of the amount of the buffering reagent (carbonate) used by Menke (1979), while the high buffering capacity (HBC) saliva containing twice as much carbonate as used by Menke (1979). Inside the anaerobic chamber, 30 mL of the anaerobic artificial saliva and 10 mL of the fresh rumen fluid inoculum were dispensed to each of the serum bottles containing 0.4 g of the substrates. After being sealed with butyl rubbers and crimped with aluminum seals, the serum bottles were incubated at 39 °C for 36 h in a water bath with occasional manual shaking. The batch fermentation cultures (10 mL each) were consecutively transferred into the same medium (30 mL) containing the same amount of substrates and incubated as aforementioned four times to enrich SRB. 2.3. Sampling and chemical analyses At the end of the 36 h incubation of the last transfer, gas pressure in the bottles was measured using a TraceableÒ manometer (Fisher Scientific, Pittsburgh, PA, USA) to determine total gas production. Then, 25 mL of headspace gas was withdrawn from each culture bottle to determine H2S gas concentration using SensidyneÒ precision gas detector tubes (Sensidyne, St. Petersburg, FL, USA). Then, 4 mL of headspace gas from each bottle was collected into a sealed glass tube, which was filled with distilled water, by displacement for analysis of methane concentration. The pH values and aqueous sulfide concentrations of the in vitro cultures were measured using an AccumetÒ Dual Channel pH/Ion Meter (Fisher Scientific, Suwanee, GA, USA) that is equipped with a silver/sulfide combination electrode. From each bottle, 1.5 mL of culture was sampled into an Eppendorf tube and immediately stored at 20 °C for DNA extraction and microbial analysis. Another 1.5 mL of each culture was centrifuged at 16,000g for 5 min at 4 °C, and the supernatant was subjected to analysis for volatile fatty acid (VFA) and ammonia. The remaining culture was mixed and filtered through filter bags (Ankom Technology, Macedon, NY, USA) to determine the DM and the neutral detergent fiber (NDF) degradability of the added substrates. The VFA concentration and methane concentration of each sample were analyzed by gas chromatography (HP 5890 II series, Agilent Technologies, Santa Clara, CA, USA) fitted with a flame ionization detector (FID) and a Chromosorb W AW packed-glass column (Supelco) (Patra and Yu, 2013). The injector and the detector were set at 150 and 180 °C, respectively, while the oven temperature of the gas chromatograph was maintained at 118 °C for 16 min, ramped to 178 °C at a rate of 15 °C/min, and held at 178 °C for another 5 min. The concentration of ammonia in the

27

H. Wu et al. / Bioresource Technology 186 (2015) 25–33

fermentation cultures were measured using a colorimetric method (Chaney and Marbach, 1962). A subsample of the original substrate and residues in the filter bags were dried in an oven for 18 h at 105 °C to determine the DM. Apparent DM degradability of the substrate was calculated as the difference between the initial substrate added and the residual substrate remained. The NDF content of the initial substrate and the residues were analyzed using the method described by van Soest et al. (1991), and NDF degradation were then calculated as the difference. Methane production was calculated from the methane concentration in the headspace and the volume of the total gas produced in each culture. 2.4. DNA extraction and real-time qPCR analysis The microbial biomass in each culture sample (1.5 mL) was harvested by centrifugation at 16,000g and 4 °C for 10 min. Metagenomic DNA was then extracted using the repeated bead beating and column purification (RBB + C) method (Yu and Morrison, 2004), which has high recovery efficiency of PCR-quality metagenomic DNA. The quality of the DNA extracts was examined using agarose gel (1%) electrophoresis, and the DNA concentrations were determined using a NanoDrop 2000 spectrophotometer (Fisher Scientific, Suwanee, GA, USA). The DNA samples were stored at 20 °C until analysis. The populations of total bacteria, SRB, the genus Desulfovibrio, and domains Archaea were quantified using specific real-time qPCR assays against respective qPCR standards prepared in this study. The genes targeted and the specific primers used are listed in Table 1. One samples-derived qPCR standard was prepared for each group of the microbes quantified using respective specific primers and a composite metagenomic DNA sample that consisted of an equal amount of DNA from all the DNA samples to be quantified (Yu et al., 2005b). Then, each of the standards was purified using a QIAquick PCR Purification Kit (QIAGEN, Inc., Valencia, CA) and quantified using a Quant-it™ dsDNA Broad Range Kit (Invitrogen Corporation, Carlsbad, CA, USA). For each qPCR standard, copy number concentration was calculated based on its length (bp) and the mass concentration. Tenfold serial dilutions (107–100 copies/lL) were prepared in Tris–EDTA (TE) buffer prior to qPCR assays. 2.5. Real-time qPCR analysis The population of total bacteria was quantified using the TaqMan assay as described by Nadkarni et al. (2002), while the population of methanogens was quantified using a SYBR Greenbased qPCR assays as described previously (Patra and Yu, 2013). For quantification of SRB and Desulfovibrio, the reaction mixture (25 lL each) included 2.5 lL 10 PCR buffer, 0.5 lL 3.36% bovine serum albumin (BSA), 0.5 lL of each template DNA, 3.0 mM (for Desulfovibrio) or 3.5 mM (for SRB) MgCl2, 200 lM each deoxynucleoside triphosphate (dNTP), 0.5 lM each of the forward and the

reverse primers, 0.625 units Taq DNA polymerase, 0.03 lM Rox and SYBR Green (final concentration 0.136 and sterile water). The qPCR cycling conditions for SRB and Desulfovibrio were as follows: 95 °C for 10 min followed by 40 °C cycles of 95 °C for 40 s, 58 °C (for SRB) or 62 °C (for Desulfovibrio) for 1 min, 72 °C for 30 s, and 86 °C for 16 s. In order to eliminate impact of possible primer dimers, the fluorescence signal was collected at 86 °C, at which primer dimers completely denature while the PCR product do not. A final melt-curve analysis was performed after completion of all the cycles, with fluorescence acquired at 0.5 °C intervals between 56 and 95 °C to verify that only the expected target gene was amplified. All the qPCR assays were done in triplicate for both the standards and each of the extracted metagenomic DNA samples on the same plates. An Mx3000p real-time system (Stratagene, La Jolla, CA) and the MaxPro QPCR Software were used to perform all the qPCR assays and data analysis. The qPCR products for total bacteria, which were quantified using a TaqMan assay, were examined by melting curve analysis to verify the product. Finally, all the qPCR products were confirmed by agarose gel (1%) electrophoresis. Abundance was expressed as copies of each target gene per mL of culture samples, while relative abundance of aps gene and Desulfovibrio was calculated as % of total bacterial 16S rRNA genes. 2.6. Statistical analysis The qPCR data were log transformed to improve normality. All the data were analyzed using the mixed model procedure of SAS (SAS Institute, Cary, NC) in both 3  2 (sulfur sources  buffer capacities) and 3  3 (sulfur sources  doses) factorial design. Orthogonal polynomial contrasts were used to examine the linear and quadratic effects of the increasing doses of sulfur. Significance was declared at P 6 0.05. 3. Results and discussion 3.1. Experiment 1: effects of sulfur sources and pH buffering capacity 3.1.1. In vitro fermentation Different sulfur sources showed significant effects (P < 0.01) on all the fermentation parameters measured except NDF degradation (P > 0.05) (Table 2). Both culture pH and ammonia concentration of the DDGS treatment were higher (P < 0.01) than those of SA, SS, and the control, which is in agreement with a previous study (Uwituze et al., 2011a). The higher pH might be attributable to the increased ammonia concentrations (P < 0.01) and lower VFA concentrations (P < 0.01) resulted from lower DM digestibility in the DDGS treatment. The increase in ammonia concentration in the DDGS treatment noted in the present study indicates that the N present in DDGS is more digestible than that from grain or soybean meal. Indeed, Kleinschmit et al. (2007) found that the protein in DDGS is highly digestible (70–85%) by dairy cattle. However,

Table 1 Specific PCR primers, target genes, annealing temperature, and amplicon length.

*

Primer

Sequence (50 ? 30 )

Target gene

Annealing (°C)

Amplicon length (bp)

References

Eub358f Eub806r APS3f APS2r DSV691f DSV826r ARC787f ARC1059r

TCCTACGGGAGGCAGCAGT GGACTACCAGGGTATCTAATCCTGTT TGGCAGATCATGWTYAAYGG GGGCCGTAACCRTCYTTRAA CCGTAGATATCTGGAGGAACATCAG ACATCTAGCATCCATCGTTTACAGC ATTAGATACCCSBGTAGTCC GCCATGCACCWCCTCT

16S rRNA gene of bacteria

60

467

Nadkarni et al. (2002)

apsA* of SBR

58

396

Christophersen et al. (2011)

16S rRNA gene of Desulfovibrio

62

135

Fite et al. (2004)

16S rRNA gene of archaea

56

273

Yu et al. (2005a)

apsA, the gene coding for the alpha subunit of adenosine 50 -phosphosulfate reductase.

28

H. Wu et al. / Bioresource Technology 186 (2015) 25–33

Table 2 Effects of different sulfur sources and buffer capacities on in vitro fermentation and sulfide production. Parameter

Sourcesa CON

Fermentation characteristics pHb 6.29b Gas production 39.10a (mL) Ammonia (mg/ 17.45b mL) DM degradation 62.95b (%) 39.47 NDF degradation (%) Sulfide production Headspace (mL)c 0.23b Aq. conc. (ppm)d 70.2b Total sulfide 3.14b (mg)

SEM

P value

CON

DDGS

SA

SS

HBC

LBC

HBC

LBC

HBC

LBC

HBC

LBC

SEM

P value

DDGS

SA

SS

6.77a 27.05c

6.32b 36.89b

6.46b 38.11ab

0.043 0.483

Effect of pH buffering capacity and sources of dietary sulfur on rumen fermentation, sulfide production, methane production, sulfate reducing bacteria, and total Archaea in in vitro rumen cultures.

The effects of three types of dietary sulfur on in vitro fermentation characteristics, sulfide production, methane production, and microbial populatio...
521KB Sizes 0 Downloads 7 Views