Theriogenology 84 (2015) 524–530
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Effect of primary culture medium type for culture of canine fibroblasts on production of cloned dogs Geon A Kim a, Hyun Ju Oh a, Min Jung Kim a, Young Kwang Jo a, Jin Choi a, Jin Wook Kim b, Tae Hee Lee c, Byeong Chun Lee a, * a b c
Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Korea College of Veterinary Medicine, Chungbuk National University, Cheongju, Korea College of Natural and Mathematical Sciences, University of Maryland Baltimore County, Baltimore, Maryland, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 January 2015 Received in revised form 24 March 2015 Accepted 11 April 2015
Fibroblasts are common source of donor cells for SCNT. It is suggested that donor cells’ microenvironment, including the primary culture, affects development of reconstructed embryos. To prove this, canine embryos were cloned with fibroblasts that were cultured in two different primary media (RCMEp vs. Dulbecco’s modified Eagle’s medium [DMEM]) and in vivo developments were compared with relative amount of stemness, reprogramming, apoptosis gene transcripts, and telomerase activity. Donor cells cultured in RCMEp contained a significantly higher amount of SOX2, NANOG, DPPA2, REXO1, HDAC, DNMT1, MECP2 and telomerase activity than those cultured in DMEM (P < 0.05). In vivo developmental potential of cloned embryos with donor cells cultured in RCMEp had a higher birth rate than that of embryos derived from DMEM (P < 0.05). The culture medium can induce changes in gene expression of donor cells and telomerase activity, and these alterations can also affect in vivo developmental competence of the cloned embryos. Ó 2015 Elsevier Inc. All rights reserved.
Keywords: Culture medium Dog cloning Primary culture SCNT
1. Introduction Various treatment protocols for preparation of donor cells have been developed to improve SCNT efficiency in mammals [1,2]. In donor cells, intrinsic factors such as differentiation status and modifying culture conditions can affect nucleus reprogramming efficiency of cloned embryos [3,4]. Cell culture condition can induce changes of gene expression patterns of nuclear donor cells [5,6]. The culture medium used for donor cells affects the development of cloned bovine embryos [7,8]. It also affects the preimplantation development of horse nuclear transfer embryos [9]. However in canines, little attention has been focused on effects of the primary culture medium on donor cells for dog cloning.
* Corresponding author. Tel.: þ82 2 880 1269; fax: þ82 2 873 1269. E-mail address: [email protected] (B.C. Lee). 0093-691X/$ – see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2015.04.007
Global epigenetic reprogramming of donor cells has been reported as a major event that occurs after SCNT, regulating the success of cloning [10–12]. Previous studies reported that differentiated somatic cells in a highly methylated state appear to be incompletely reprogrammed in cloned embryos [13,14]. Highly methylated somatic donor cells are used to generate cloned embryos, in turn, have been shown to be abnormally hypermethylated [15,16]. Cell characteristics including morphology, function such as overexpression of cytokines, gene expression patterns, resistance to apoptosis, and telomere length can all be changed by in vitro culture (IVC) conditions [17]. It is also reported that gene expression level of pluripotency genes in donor cells is linked with cloning efficiency [18,19]. The change of methylation or acetylation status induced by extract or chemical treatments of oocytes also resulted in pluripotency gene expression changes [20,21]. For the present study, we used two culture media, one is Dulbecco’s modified Eagle’s medium (DMEM) with 10%
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
fetal bovine serum (FBS) used as the standard medium for culture of fibroblasts, another is RCMEp that is used as establishing for human mesenchymal stem cells. Therefore, the objective of this study is to investigate whether the primary culture medium for canine somatic cells can alter expression of pluripotent state, reprogramming state, apoptosis and the effect on telomerase activity in canine adult fibroblast donor cells; consecutively, altered donor cell will affect canine cloned embryos development. 2. Materials and methods 2.1. Somatic cell culture and preparation Primary cultures of fibroblasts were established as described in our previous studies with minor modification [22]. In brief, abdominal full-thickness skin was excised from 7- to 9-year-old male beagles under general anesthesia. Immediately after collection, the skin fragments were placed in PBS (Invitrogen, Carlsbad, CA, USA) on ice and transported to the laboratory. After all the fat tissue and blood vessels were removed from the skin with scissors, skin tissues were trimmed to 0.5 cm 0.5 cm fragments and finely minced into small pieces (w1 mm 1 mm) which were evenly distributed onto the bottom of a tissue culture dish for culture. Two culture media were used: DMEM (high glucose; Invitrogen) supplemented with 10% FBS (Invitrogen), penicillin–streptomycin (Invitrogen); and RCMEp (K-stem cell bio media for adipose-derived stem cells culture; K-stem cell Ltd, Seoul, Korea). RCMEp is DMEM (Invitrogen)-based medium containing 0.2 mmol/L of ascorbic acid, 10 ng/mL of fibroblast growth factor (FGF), 1% nonessential amino acid (Invitrogen), and 10% FBS. All samples were cultured in 60-mm2 tissue culture dishes at 39 C in air containing 5% CO2, and fresh medium was added every 3 to 4 days till confluence. The number of days required to achieve confluence of the primary culture was recorded for each sample (for only primary confluence). After retrieving the cells from each primary culture medium, cells were cultured and passaged at confluence in each primary culture medium. Cells at passage 0 were harvested by incubation for 2.5 minutes at 39 C with 0.25% trypsin in 0.01% EDTA and collected by centrifugation; then, they were cryopreserved. Before SCNT, cells at passages 2 to 4 were disaggregated by treatment with trypsin-EDTA. For measuring the size of donor cells, an automated cell counter (Countess, Invitrogen) was used. Diluted donor cells were suspended in PBS (Invitrogen) containing 0.1% FBS (Invitrogen). Suspension solution including donor cells was mixed with the 0.4% trypan blue (Invitrogen) of the same volume. After mixing gently by pipetting, 10 mL of the sample mixture was transferred to the chamber ports on one side of the Countess cell-counting chamber slide. The slide was inserted completely into the instrument, and the mean viable cell size was automatically recorded. 2.2. Canine oocyte collection, somatic cell nuclear transfer, and embryo transfer For recovery of in vivo–matured oocytes, the plasma progesterone concentration of candidate oocyte donor
525
bitches was monitored by an IMMULITE 1000 (Siemens Healthcare Diagnostics Inc., Flanders, NJ, USA). Elevation of plasma progesterone concentration in candidate oocyte donor bitches to 4 ng/mL or higher was considered as the ovulation day [23,24]. Three days after ovulation, in vivo– matured oocytes were collected by flushing oviducts using HEPES-buffered tissue culture medium-199 (Invitrogen) supplemented with 10% (v:v) BSA (Invitrogen) and 2-mM NaHCO3. Nuclear transfer was performed as described earlier [22]. After collection, in vivo–matured oocytes were denuded of cumulus cells in tissue culture medium-199 supplemented with 0.1% (v:v) hyaluronidase, and oocytes with extruded first polar bodies were selected and exposed to cytochalasin B (5 mg/mL) and Hoechst 33342 (5 mg/mL). The metaphase chromosomes were removed under ultraviolet light by aspiration with a fine needle pipette. Single donor fibroblast cells that had been cultured in each medium were transferred into the perivitelline space of oocytes. Each donor cell–cytoplast couplet was induced to fuse two pulses of DC 72 V for 15 ms, using an Electro-Cell Fusion apparatus (NEPA GENE Co., Chiba, Japan) in 0.26-M mannitol solution containing 0.1mM MgSO4, 0.5-mM HEPES, and 0.05% (wt/vol) BSA [1,22,25]. Chemical activation was performed by incubating reconstructed embryos in modified synthetic oviductal fluid medium containing 10-mM calcium ionophore for 4 minutes at 38.5 C. Cloned embryos were transferred into 40 mL of modified synthetic oviductal fluid with 1.9-mM 6-dimethylaminopurine for 4 hours in an atmosphere of 39 C, 5% CO2, 5% O2, and 90% N2. Reconstructed cloned embryos were transferred into oviducts of synchronized canine recipients. Under general anesthesia, embryos were inserted into the ampullary portion of the oviduct using a 3.5-Fr Tom-Cat catheter (Sherwood, St. Louis, MO, USA). 2.3. Determination of relative abundance of genes in donor cells by quantitative PCR Cultured cells at passages 2 to 4 were disaggregated by treatment with trypsin-EDTA. After trypsin-EDTA treatment, donor cells were collected and washed in sterile PBS. Total RNA was extracted by using the easy-spin (DNA free) Total RNA Extraction Kit (iNtRON Biotechnology, Inc., Kyunggi, Korea) from donor cells cultured in each of the two primary culture media. To synthesize complementary DNA of each sample, reverse transcription was carried out at 50 C for 50 minutes using random hexamer and SuperScript III Reverse Transcriptase (Invitrogen) in a 20-mL reaction volume. Real-time quantitative polymerase chain reaction (PCR) was done according to the Takara Bio Inc. (Shiga, Japan) guidelines. A total PCR reaction volume of 20 mL was made by adding 2 mL of complementary DNA, 1mL forward primer, 1-mL reverse primer, 8-mL SYBR Premix Ex Taq, 0.4 mL of ROX Reference (Takara Bio Inc.), and 7.6 mL of Nuclease-free water (Ambion Inc., Austin, TX, USA). The reaction was carried out using a 7300 Real-Time PCR Cycler System (Applied Biosystems, Foster City, CA, USA). The thermal profile for reverse transcription quantitative PCR was 95 C for 10 minutes, followed by 40 cycles of 95 C for 10 seconds, 60 C for 20 seconds, and 72 C for 40 seconds.
526
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
Table 1 List of primers used for real-time polymerase chain reaction. Gene
Accession no.
Primer sequence (50 –30 )
Product size (bp)
b-actin
NM_001003349
173
SOX2
XM_545216
NANOG
XM_543828.2
REXO1
XM_533958.2
DPPA2
XM_843766.2
HDAC
XM_859623
DNMT1
XM_533919.3
DNMT3a
XM_540110.2
DNMT3b
XM_003433245.1
MECP2
XM_003435553.1
BAX
AB080230.1
BCL2
NM_001031635.2
F: GCTACGTCGCCCTGGA R: AGCGGTTCCGCTGCCC F: CAGACCTACATGAACGGCTCGC R: CCCACTCCAGGGCGCCCTGCC F: CTCAGTCTCCAGCAGATGC R: GCCAATCCTGGAGCAGCCACTC F: GTATGACCCTCTGTCCAACTTCTCT R: CATCATCATCTGAGTCTGAGAACCT F: TACCCATGGCCGAAAAATAG R: AAATCTTGGCCACCATCTTG F: GCTGCACCATGCAAAGAAGT R: TCGCCGTGGTGAATATCAAT F: GGAGAAACTGAATCTCTTGCAT R: TAGCCAGGTAGCCCTCCTCT F: CAAAGAAGTTTACACAGACATGTGG R: GCAGAAGTGCCGGAACATCGAGG F: TTGACTTGGTGATTGGTGGA R: TTTCTTCTCGGCCGGACAT F: AAGCCTTTCGCTCTAAAGTGG R: TGGGAGATTTGGGCTTCTTA F: TCAAGGCCCTGTGTACCAA R: ACGTGGGTGTCCCAAAGTAG F: CAGGGCTGGGTCCTAAGAG R: TAGCCTGGATGGCAGCTC
157 301 130 152 129 115 178 134 150 143 130
Abbreviations: F, forward; R, reverse.
The forward and reverse primers were designed using the Primer Express 2.0 software program (Applied Biosystems). The sequences of primers and approximate size of the amplified fragments are listed in Table 1. The level of all tested gene transcription was normalized to b-actin expression levels.
Fig. 1. The average time (days) to reach primary confluence for fibroblast cell cultures derived from two culture media. The length of time until confluence increased significantly, which is longer when cultured in than those in RCMEp. * P < 0.05. Data are presented as the mean standard error of the mean of at least three replicates.
2.4. Telomerase activity assay The Telomerase PCR ELISA kit (Roche Molecular Biochemicals, Mannheim, Germany) based on the telomeric repeat amplification protocol (TRAP) was used to measure telomerase activity of donor cells cultured in each of the primary culture media. Two million cells at passage from 2 to 4 were pelleted at 150 g for 10 minutes in a refrigerated centrifuge at 4 C. Then, lysis buffer (PRO-PREP protein extraction solution; iNtRON Biotechnology, Inc.) was added
Fig. 2. Cell size of donor cells cultured in RCMEp and DMEM (A) during from passage 1 to 4. Cell size was examined before SCNT and analyzed using an automated cell counter Countess. Relative abundance ratio of BAX and BCL2 apoptotic genes (B) during from passage 1 to 4 were examined using realtime quantitative polymerase chain reaction. Data are presented as the mean standard error of the mean of at least three replicates.
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
and incubated on ice for 30 minutes. The supernatant was collected, and protein concentrations were determined by the Bradford assay using NanoDrop 2000 (Thermo Fisher Scientific, Seoul, Korea). When performing the TRAP assay, equal amount of cell protein derived from each primary culture media was analyzed according to the manufacturer’s instructions.
2.5. Statistical analysis Statistical analysis was done using GraphPad Prism 4.02 (GraphPad Software Inc, San Diego, CA, USA). The data were analyzed by an unpaired t test with Welch’s correction. Significance was determined when the P value was less than 0.05. 3. Results 3.1. Length of time to reach primary confluence The numbers of days needed for dissociated cells to become confluent monolayers are shown for the two cell culture media (DMEM and RCMEp) in Figure 1. Cells cultured in DMEM primary medium required significantly more than 15 days to achieve confluence compared to 7 days needed in RCMEp primary culture medium.
527
3.2. Cell size and apoptotic gene expression level of donor cells primary cultured in DMEM and RCMEp No differences were found in cell size between donor cells derived from the two cultured media (Fig. 2A). There were also no significant differences for apoptosis-related genes, the ratio of BAX and BCL2 (Fig. 2B). 3.3. Gene expression profiles and relative telomerase activities in canine fibroblasts after primary culture in DMEM and RCMEp The relative abundance of gene transcripts in donor cells cultured in each medium and relative telomerase activities are shown in Figure 3. Donor cells cultured in DMEM show significantly lower relative telomerase activities than those of RCMEp-cultured cells as shown in Figure 3A. Compared with RCMEp, cells cultured in DMEM had significantly decreased expression levels of SOX2, NANOG, DPPA2, REXO1, HDAC, DNMT1, and MECP2 (P < 0.05) as shown in Figure 3B, C. 3.4. In vivo development of embryos from donor cells cultured in different primary media As shown in Table 2, when donor cells cultured in DMEM or RCMEp as the primary medium were used for
Fig. 3. Selected genes expression and telomerase activities for characterization of donor cells primarily cultured in two culture media. Expression of genes in fibroblasts cultured in RCMEp and Dulbecco’s modified Eagle’s medium (DMEM) were assessed using real-time quantitative polymerase chain reaction. Relative abundance of SOX2, NANOG, DPPA2, and REXO1 (A) and HDAC, DNMT1, DNMT3a, DNMT3b, and MECP2 (C) was presented. Relative telomerase activities in donor cells after primary culture in RCMEp or DMEM (B) were examined by TRAP assay. Data are presented as the mean standard error of the mean of at least six replicates. Asterisk (*) indicate a significant difference (P < 0.05).
528
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
Table 2 Effect of primary culture medium of donor cells on the birth rate of healthy cloned pups. Culture medium type
No. recipients
No. transferred cloned embryos
No. pregnant recipients (%)c
No. cloned pups (%)d
DMEM RCMEp
11 11
183 181
2 (18.18)a 4 (36.36)b
2 (1.09)a 8 (4.41)b
a,b
Different superscripts indicate significant difference (P < 0.05). Pregnancy rate was calculated by the total number of pregnant recipients/total number of recipients. Birth rate was calculated by the total number of delivered live pups/total number of transferred cloned embryos.
c
d
cloning, two and four recipients, respectively, became pregnant. The recipients pregnant with cloned embryos derived from cells that were cultured in DMEM as primary medium gave birth to two cloned pups (1.09%, births per embryos transferred, Table 2). This birth rate represented by the number of delivered pups to the number of transferred embryos was significantly lower than the RCMEpderived cells (4.41%, P < 0.05). All cloned dogs showed no abnormality, and their identity were confirmed by parentage analysis (data not shown).
4. Discussion The rationale of our present study was to investigate the effect of primary culture medium on canine fibroblasts with respect to gene expression levels, telomerase activity of cells grown in vitro, and their subsequent birth rate as evidenced by the number of produced pups after embryo transfer. Culture conditions can significantly affect the proliferative life span of cells in vitro [26]. In our study, the primary culture medium had an effect on the time required to achieve primary confluence. Rapidly outgrowing and dividing cells were only obtained from culture in RCMEp medium. Cell cultures in DMEM required over 15 days forming a confluent monolayer. The difference resulting from two medium may be due to the components of the culture medium. Fibroblasts are commonly cultured using DMEM containing 10% FBS, which promotes adequate cell growth. However, our results indicate that fibroblasts first grown to confluence in RCMEp, which is supplemented with ascorbic acid, FBS, nonessential amino acid, and FGF, display increased proliferation rates for achieving confluence. RCMEp medium was made by modifying an optimized medium for culture of human mesenchymal stem cells intended for use in cell therapies [27]. This application requires rapid expansion of cells to collect large populations quickly. The FBS concentrations of RCMEp (5%, v:v) is the same compared to those of culture medium which can induce the gene expression change of cultured cells [28]. FGF is a well-established mitogen for fibroblasts [10]. Interestingly, some studies reported that FGF can be used as culture supplements to optimize the proliferative capacity of human adipose-derived stem cells [29,30]. Ascorbic acid also plays a role as an important cofactor for collagen biosynthesis [31,32]. Consistent with our result, culture with ascorbic acid promoted proliferation of cells in primary culture [33]. With respect to cell morphology, no differences in cell size were observed. These observations were similar for all passages of fibroblasts examined. Our results indicated that the primary culture medium does not affect
morphology or size of fibroblasts, but it affected the time to reach confluence. With this in mind, we next investigated that differential gene expression responses were observed between fibroblasts cultured in RCMEp as the primary medium versus those derived from culture in DMEM. These results imply differential regulation of specific genes by serum and/or growth factors and are also in agreement with differential gene expression responses of various cell types according to culture condition [34]. SOX2, NANOG, DPPA2, and REXO1 are transcription factors with essential functions in maintaining pluripotency, all of which were upregulated by primary culture in RCMEp. These upregulations of pluripotency transcripts were previously observed in canine mesenchymal stem cells that were characterized by high levels of proliferative capacity and pluripotency [11]. Changes in telomerase activities also occurred in fibroblasts cultured first with RCMEp. It was reported that telomerase activity is upregulated in cells that undergo rapid expansion, such as committed hematopoietic progenitor cells [35]. These observations along with evidence from previous studies suggest that the telomerase activity of a cell culture is directly related to its pluripotency potential [36,37], and it is linked with efficacy of human somatic cell reprogramming [38,39]. Therefore, using RCMEp as the primary culture medium can be a method for establishing canine fibroblasts with high levels of pluripotency, telomerase activities and for achieving primary fibroblasts more quickly than DMEM primary culture. It also may affect the cloning efficiency in dogs. RCMEp primary culture led to an increase in the levels of HDAC1, DNMT1, MECP2 when compared to cells primary cultured in DMEM; however, there was no difference in activities of DNMT3a and DNMT3b. It is well accepted that increasing the global acetylation of histone or demethylation alleviates transcriptional repression by facilitating chromatin remodeling [40,41]. All the HDAC1, DNMT1, MECP2 gene expression levels of fibroblasts cultured with RCMEp were increased, which may facilitate chromatin remodeling and allow reprogramming-related factors access to nucleosomes, thereby enhancing the developmental potential of SCNT embryos. To enhance the developmental competence of cloned embryos, epigenetic modulators such as HDAC inhibitor were used [25]. In the same way of epigenetic modulators, cloned dog embryos have to undergo a well-orchestrated series of DNA methylation and histone modification changes that are believed to be permissive to reprogramming during the in vivo development. This finding indicates that primarily cultured cells using RCMEp have higher expression level of reprogramming genes, and these alterations could influence to the birth rate of cloned dogs.
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
4.1. Conclusions In conclusion, the type of culture medium used for primary culture of donor cells could not only change the time required for achieving confluence and affect the level of reprogramming, pluripotency genes’ transcripts, and telomerase activities, but also that these alterations in donor cells can improve the production efficiency of SCNT dogs. Acknowledgments The authors thank Dr Barry D. Bavister for his valuable editing of the article. This study was financially supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (#311062-04-3-SB010), Rural Development Administration (PJ010928032015), Nature Cell, Research Institute for Veterinary Science, TS Corporation, LOTTE-Nestle Korea Co. Ltd. References [1] Jang G, Oh HJ, Kim MK, Fibrianto YH, Hossein MS, Kim HJ, et al. Improvement of canine somatic cell nuclear transfer procedure. Theriogenology 2008;69:146–54. [2] Jeong YW, Kim JJ, Hossein MS, Hwang KC, Hwang IS, Hyun SH, et al. Influence of somatic cell donor breed on reproductive performance and comparison of prenatal growth in cloned canines. Theriogenology 2014;81:1207–1213 e1. [3] Yamanaka K, Sakatani M, Kubota K, Balboula AZ, Sawai K, Takahashi M. Effects of downregulating DNA methyltransferase 1 transcript by RNA interference on DNA methylation status of the satellite I region and in vitro development of bovine somatic cell nuclear transfer embryos. J Reprod Dev 2011;57:393–402. [4] Heindryckx B, Van der Elst J, Dhont M. Culture medium preferences of pre-implantation cloned mouse embryos. Methods Mol Biol 2006;348:59–78. [5] Giraldo AM, Hylan DA, Ballard CB, Purpera MN, Vaught TD, Lynn JW, et al. Effect of epigenetic modifications of donor somatic cells on the subsequent chromatin remodeling of cloned bovine embryos. Biol Reprod 2008;78:832–40. [6] Kim GA, Oh HJ, Lee TH, Lee JH, Oh SH, Kim JW, et al. Effect of culture medium type on canine adipose-derived mesenchymal stem cells and developmental competence of interspecies cloned embryos. Theriogenology 2014;81:243–9. [7] Powell AM, Talbot NC, Wells KD, Kerr DE, Pursel VG, Wall RJ. Cell donor influences success of producing cattle by somatic cell nuclear transfer. Biol Reprod 2004;71:210–6. [8] Giraldo AM, Lynn JW, Godke RA, Bondioli KR. Proliferative characteristics and chromosomal stability of bovine donor cells for nuclear transfer. Mol Reprod Dev 2006;73:1230–8. [9] Lagutina I, Lazzari G, Duchi R, Colleoni S, Ponderato N, Turini P, et al. Somatic cell nuclear transfer in horses: effect of oocyte morphology, embryo reconstruction method and donor cell type. Reproduction 2005;130:559–67. [10] Gritti A, Frolichsthal-Schoeller P, Galli R, Parati EA, Cova L, Pagano SF, et al. Epidermal and fibroblast growth factors behave as mitogenic regulators for a single multipotent stem cell-like population from the subventricular region of the adult mouse forebrain. J Neurosci 1999;19:3287–97. [11] Oh HJ, Park EJ, Lee SY, Soh JW, Kong IS, Choi SW, et al. Comparison of cell proliferation and epigenetic modification of gene expression patterns in canine foetal fibroblasts and adipose tissue-derived mesenchymal stem cells. Cell Prolif 2012;45:438–44. [12] Blelloch R, Wang Z, Meissner A, Pollard S, Smith A, Jaenisch R. Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 2006;24:2007–13. [13] Zhang M, Wang F, Kou Z, Zhang Y, Gao S. Defective chromatin structure in somatic cell cloned mouse embryos. J Biol Chem 2009; 284:24981–7.
529
[14] Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28:173–7. [15] Niemann H, Tian XC, King WA, Lee RS. Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning. Reproduction 2008;135:151–63. [16] Yang F, Hao R, Kessler B, Brem G, Wolf E, Zakhartchenko V. Rabbit somatic cell cloning: effects of donor cell type, histone acetylation status and chimeric embryo complementation. Reproduction 2007; 133:219–30. [17] Campisi J, Dimri GP, Nehlin JO, Testori A, Yoshimoto K. Coming of age in culture. Exp Gerontol 1996;31:7–12. [18] Hai T, Hao J, Wang L, Jouneau A, Zhou Q. Pluripotency maintenance in mouse somatic cell nuclear transfer embryos and its improvement by treatment with the histone deacetylase inhibitor TSA. Cell Reprogram 2011;13:47–56. [19] Wakayama S, Mizutani E, Wakayama T. Production of cloned mice from somatic cells, ES cells, and frozen bodies. Methods Enzymol 2010;476:151–69. [20] Miyamoto K, Tsukiyama T, Yang Y, Li N, Minami N, Yamada M, et al. Cell-free extracts from mammalian oocytes partially induce nuclear reprogramming in somatic cells. Biol Reprod 2009;80: 935–43. [21] Wang Y, Su J, Wang L, Xu W, Quan F, Liu J, et al. The effects of 5-aza2’- deoxycytidine and trichostatin A on gene expression and DNA methylation status in cloned bovine blastocysts. Cell Reprogram 2011;13:297–306. [22] Kim GA, Oh HJ, Park JE, Kim MJ, Park EJ, Lim SH, et al. Employing mated females as recipients for transfer of cloned dog embryos. Reprod Fertil Dev 2013;25:700–6. [23] Hewitt DA, England GC. Effect of preovulatory endocrine events upon maturation of oocytes of domestic bitches. J Reprod Fertil Suppl 1997;51:83–91. [24] Wildt DE, Panko WB, Chakraborty PK, Seager SW. Relationship of serum estrone, estradiol-17beta and progesterone to LH, sexual behavior and time of ovulation in the bitch. Biol Reprod 1979;20:648–58. [25] Oh HJ, Hong SG, Park JE, Kang JT, Kim MJ, Kim MK, et al. Improved efficiency of canine nucleus transfer using roscovitine-treated canine fibroblasts. Theriogenology 2009;72:461–70. [26] Balin AK, Fisher AJ, Anzelone M, Leong I, Allen RG. Effects of establishing cell cultures and cell culture conditions on the proliferative life span of human fibroblasts isolated from different tissues and donors of different ages. Exp Cell Res 2002; 274:275–87. [27] Ra JC, Shin IS, Kim SH, Kang SK, Kang BC, Lee HY, et al. Safety of intravenous infusion of human adipose tissue-derived mesenchymal stem cells in animals and humans. Stem Cells Dev 2011;20: 1297–308. [28] Bieback K, Ha VA, Hecker A, Grassl M, Kinzebach S, Solz H, et al. Altered gene expression in human adipose stem cells cultured with fetal bovine serum compared to human supplements. Tissue Eng Part A 2010;16:3467–84. [29] Hebert TL, Wu X, Yu G, Goh BC, Halvorsen YD, Wang Z, et al. Culture effects of epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) on cryopreserved human adipose-derived stromal/ stem cell proliferation and adipogenesis. J Tissue Eng Regen Med 2009;3:553–61. [30] Hu F, Wang X, Liang G, Lv L, Zhu Y, Sun B, et al. Effects of epidermal growth factor and basic fibroblast growth factor on the proliferation and osteogenic and neural differentiation of adipose-derived stem cells. Cell Reprogram 2013;15:224–32. [31] Otsuka E, Kato Y, Hirose S, Hagiwara H. Role of ascorbic acid in the osteoclast formation: induction of osteoclast differentiation factor with formation of the extracellular collagen matrix. Endocrinology 2000;141:3006–11. [32] Chung JH, Youn SH, Kwon OS, Cho KH, Youn JI, Eun HC. Regulations of collagen synthesis by ascorbic acid, transforming growth factorbeta and interferon-gamma in human dermal fibroblasts cultured in three-dimensional collagen gel are photoaging- and aging-independent. J Dermatol Sci 1997;15:188–200. [33] Shima N, Kimoto M, Yamaguchi M, Yamagami S. Increased proliferation and replicative lifespan of isolated human corneal endothelial cells with L-ascorbic acid 2-phosphate. Invest Ophthalmol Vis Sci 2011;52:8711–7. [34] Koellensperger E, Gramley F, Preisner F, Leimer U, Germann G, Dexheimer V. Alterations of gene expression and proteins synthesis in co-cultured adipose tissue-derived stem cells and squamous cellcarcinoma cells: consequences for clinical applications. Stem Cell Res Ther 2014;5:65.
530
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
[35] Haik S, Gauthier LR, Granotier C, Peyrin JM, Lages CS, Dormont D, et al. Fibroblast growth factor 2 upregulates telomerase activity in neural precursor cells. Oncogene 2000;19:2957–66. [36] Low KC, Tergaonkar V. Telomerase: central regulator of all of the hallmarks of cancer. Trends Biochem Sci 2013;38:426–34. [37] Ninagawa N, Murakami R, Isobe E, Tanaka Y, Nakagawa H, Torihashi S. Mesenchymal stem cells originating from ES cells show high telomerase activity and therapeutic benefits. Differentiation 2011;82:153–64. [38] Xu T, Xu Y, Liao CP, Lau R, Goldkorn A. Reprogramming murine telomerase rapidly inhibits the growth of mouse cancer cells in vitro and in vivo. Mol Cancer Ther 2010;9:438–49.
[39] Marusic L, Anton M, Tidy A, Wang P, Villeponteau B, Bacchetti S. Reprogramming of telomerase by expression of mutant telomerase RNA template in human cells leads to altered telomeres that correlate with reduced cell viability. Mol Cell Biol 1997;17:6394–401. [40] Kumar BM, Maeng GH, Lee YM, Lee JH, Jeon BG, Ock SA, et al. Epigenetic modification of fetal fibroblasts improves developmental competency and gene expression in porcine cloned embryos. Vet Res Commun 2013;37:19–28. [41] Mason K, Liu Z, Aguirre-Lavin T, Beaujean N. Chromatin and epigenetic modifications during early mammalian development. Anim Reprod Sci 2012;134:45–55.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Effect of primary culture medium type for culture of canine fibroblasts on production of cloned dogs Geon A Kim a, Hyun Ju Oh a, Min Jung Kim a, Young Kwang Jo a, Jin Choi a, Jin Wook Kim b, Tae Hee Lee c, Byeong Chun Lee a, * a b c
Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, Seoul, Korea College of Veterinary Medicine, Chungbuk National University, Cheongju, Korea College of Natural and Mathematical Sciences, University of Maryland Baltimore County, Baltimore, Maryland, USA
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 January 2015 Received in revised form 24 March 2015 Accepted 11 April 2015
Fibroblasts are common source of donor cells for SCNT. It is suggested that donor cells’ microenvironment, including the primary culture, affects development of reconstructed embryos. To prove this, canine embryos were cloned with fibroblasts that were cultured in two different primary media (RCMEp vs. Dulbecco’s modified Eagle’s medium [DMEM]) and in vivo developments were compared with relative amount of stemness, reprogramming, apoptosis gene transcripts, and telomerase activity. Donor cells cultured in RCMEp contained a significantly higher amount of SOX2, NANOG, DPPA2, REXO1, HDAC, DNMT1, MECP2 and telomerase activity than those cultured in DMEM (P < 0.05). In vivo developmental potential of cloned embryos with donor cells cultured in RCMEp had a higher birth rate than that of embryos derived from DMEM (P < 0.05). The culture medium can induce changes in gene expression of donor cells and telomerase activity, and these alterations can also affect in vivo developmental competence of the cloned embryos. Ó 2015 Elsevier Inc. All rights reserved.
Keywords: Culture medium Dog cloning Primary culture SCNT
1. Introduction Various treatment protocols for preparation of donor cells have been developed to improve SCNT efficiency in mammals [1,2]. In donor cells, intrinsic factors such as differentiation status and modifying culture conditions can affect nucleus reprogramming efficiency of cloned embryos [3,4]. Cell culture condition can induce changes of gene expression patterns of nuclear donor cells [5,6]. The culture medium used for donor cells affects the development of cloned bovine embryos [7,8]. It also affects the preimplantation development of horse nuclear transfer embryos [9]. However in canines, little attention has been focused on effects of the primary culture medium on donor cells for dog cloning.
* Corresponding author. Tel.: þ82 2 880 1269; fax: þ82 2 873 1269. E-mail address: [email protected] (B.C. Lee). 0093-691X/$ – see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2015.04.007
Global epigenetic reprogramming of donor cells has been reported as a major event that occurs after SCNT, regulating the success of cloning [10–12]. Previous studies reported that differentiated somatic cells in a highly methylated state appear to be incompletely reprogrammed in cloned embryos [13,14]. Highly methylated somatic donor cells are used to generate cloned embryos, in turn, have been shown to be abnormally hypermethylated [15,16]. Cell characteristics including morphology, function such as overexpression of cytokines, gene expression patterns, resistance to apoptosis, and telomere length can all be changed by in vitro culture (IVC) conditions [17]. It is also reported that gene expression level of pluripotency genes in donor cells is linked with cloning efficiency [18,19]. The change of methylation or acetylation status induced by extract or chemical treatments of oocytes also resulted in pluripotency gene expression changes [20,21]. For the present study, we used two culture media, one is Dulbecco’s modified Eagle’s medium (DMEM) with 10%
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
fetal bovine serum (FBS) used as the standard medium for culture of fibroblasts, another is RCMEp that is used as establishing for human mesenchymal stem cells. Therefore, the objective of this study is to investigate whether the primary culture medium for canine somatic cells can alter expression of pluripotent state, reprogramming state, apoptosis and the effect on telomerase activity in canine adult fibroblast donor cells; consecutively, altered donor cell will affect canine cloned embryos development. 2. Materials and methods 2.1. Somatic cell culture and preparation Primary cultures of fibroblasts were established as described in our previous studies with minor modification [22]. In brief, abdominal full-thickness skin was excised from 7- to 9-year-old male beagles under general anesthesia. Immediately after collection, the skin fragments were placed in PBS (Invitrogen, Carlsbad, CA, USA) on ice and transported to the laboratory. After all the fat tissue and blood vessels were removed from the skin with scissors, skin tissues were trimmed to 0.5 cm 0.5 cm fragments and finely minced into small pieces (w1 mm 1 mm) which were evenly distributed onto the bottom of a tissue culture dish for culture. Two culture media were used: DMEM (high glucose; Invitrogen) supplemented with 10% FBS (Invitrogen), penicillin–streptomycin (Invitrogen); and RCMEp (K-stem cell bio media for adipose-derived stem cells culture; K-stem cell Ltd, Seoul, Korea). RCMEp is DMEM (Invitrogen)-based medium containing 0.2 mmol/L of ascorbic acid, 10 ng/mL of fibroblast growth factor (FGF), 1% nonessential amino acid (Invitrogen), and 10% FBS. All samples were cultured in 60-mm2 tissue culture dishes at 39 C in air containing 5% CO2, and fresh medium was added every 3 to 4 days till confluence. The number of days required to achieve confluence of the primary culture was recorded for each sample (for only primary confluence). After retrieving the cells from each primary culture medium, cells were cultured and passaged at confluence in each primary culture medium. Cells at passage 0 were harvested by incubation for 2.5 minutes at 39 C with 0.25% trypsin in 0.01% EDTA and collected by centrifugation; then, they were cryopreserved. Before SCNT, cells at passages 2 to 4 were disaggregated by treatment with trypsin-EDTA. For measuring the size of donor cells, an automated cell counter (Countess, Invitrogen) was used. Diluted donor cells were suspended in PBS (Invitrogen) containing 0.1% FBS (Invitrogen). Suspension solution including donor cells was mixed with the 0.4% trypan blue (Invitrogen) of the same volume. After mixing gently by pipetting, 10 mL of the sample mixture was transferred to the chamber ports on one side of the Countess cell-counting chamber slide. The slide was inserted completely into the instrument, and the mean viable cell size was automatically recorded. 2.2. Canine oocyte collection, somatic cell nuclear transfer, and embryo transfer For recovery of in vivo–matured oocytes, the plasma progesterone concentration of candidate oocyte donor
525
bitches was monitored by an IMMULITE 1000 (Siemens Healthcare Diagnostics Inc., Flanders, NJ, USA). Elevation of plasma progesterone concentration in candidate oocyte donor bitches to 4 ng/mL or higher was considered as the ovulation day [23,24]. Three days after ovulation, in vivo– matured oocytes were collected by flushing oviducts using HEPES-buffered tissue culture medium-199 (Invitrogen) supplemented with 10% (v:v) BSA (Invitrogen) and 2-mM NaHCO3. Nuclear transfer was performed as described earlier [22]. After collection, in vivo–matured oocytes were denuded of cumulus cells in tissue culture medium-199 supplemented with 0.1% (v:v) hyaluronidase, and oocytes with extruded first polar bodies were selected and exposed to cytochalasin B (5 mg/mL) and Hoechst 33342 (5 mg/mL). The metaphase chromosomes were removed under ultraviolet light by aspiration with a fine needle pipette. Single donor fibroblast cells that had been cultured in each medium were transferred into the perivitelline space of oocytes. Each donor cell–cytoplast couplet was induced to fuse two pulses of DC 72 V for 15 ms, using an Electro-Cell Fusion apparatus (NEPA GENE Co., Chiba, Japan) in 0.26-M mannitol solution containing 0.1mM MgSO4, 0.5-mM HEPES, and 0.05% (wt/vol) BSA [1,22,25]. Chemical activation was performed by incubating reconstructed embryos in modified synthetic oviductal fluid medium containing 10-mM calcium ionophore for 4 minutes at 38.5 C. Cloned embryos were transferred into 40 mL of modified synthetic oviductal fluid with 1.9-mM 6-dimethylaminopurine for 4 hours in an atmosphere of 39 C, 5% CO2, 5% O2, and 90% N2. Reconstructed cloned embryos were transferred into oviducts of synchronized canine recipients. Under general anesthesia, embryos were inserted into the ampullary portion of the oviduct using a 3.5-Fr Tom-Cat catheter (Sherwood, St. Louis, MO, USA). 2.3. Determination of relative abundance of genes in donor cells by quantitative PCR Cultured cells at passages 2 to 4 were disaggregated by treatment with trypsin-EDTA. After trypsin-EDTA treatment, donor cells were collected and washed in sterile PBS. Total RNA was extracted by using the easy-spin (DNA free) Total RNA Extraction Kit (iNtRON Biotechnology, Inc., Kyunggi, Korea) from donor cells cultured in each of the two primary culture media. To synthesize complementary DNA of each sample, reverse transcription was carried out at 50 C for 50 minutes using random hexamer and SuperScript III Reverse Transcriptase (Invitrogen) in a 20-mL reaction volume. Real-time quantitative polymerase chain reaction (PCR) was done according to the Takara Bio Inc. (Shiga, Japan) guidelines. A total PCR reaction volume of 20 mL was made by adding 2 mL of complementary DNA, 1mL forward primer, 1-mL reverse primer, 8-mL SYBR Premix Ex Taq, 0.4 mL of ROX Reference (Takara Bio Inc.), and 7.6 mL of Nuclease-free water (Ambion Inc., Austin, TX, USA). The reaction was carried out using a 7300 Real-Time PCR Cycler System (Applied Biosystems, Foster City, CA, USA). The thermal profile for reverse transcription quantitative PCR was 95 C for 10 minutes, followed by 40 cycles of 95 C for 10 seconds, 60 C for 20 seconds, and 72 C for 40 seconds.
526
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
Table 1 List of primers used for real-time polymerase chain reaction. Gene
Accession no.
Primer sequence (50 –30 )
Product size (bp)
b-actin
NM_001003349
173
SOX2
XM_545216
NANOG
XM_543828.2
REXO1
XM_533958.2
DPPA2
XM_843766.2
HDAC
XM_859623
DNMT1
XM_533919.3
DNMT3a
XM_540110.2
DNMT3b
XM_003433245.1
MECP2
XM_003435553.1
BAX
AB080230.1
BCL2
NM_001031635.2
F: GCTACGTCGCCCTGGA R: AGCGGTTCCGCTGCCC F: CAGACCTACATGAACGGCTCGC R: CCCACTCCAGGGCGCCCTGCC F: CTCAGTCTCCAGCAGATGC R: GCCAATCCTGGAGCAGCCACTC F: GTATGACCCTCTGTCCAACTTCTCT R: CATCATCATCTGAGTCTGAGAACCT F: TACCCATGGCCGAAAAATAG R: AAATCTTGGCCACCATCTTG F: GCTGCACCATGCAAAGAAGT R: TCGCCGTGGTGAATATCAAT F: GGAGAAACTGAATCTCTTGCAT R: TAGCCAGGTAGCCCTCCTCT F: CAAAGAAGTTTACACAGACATGTGG R: GCAGAAGTGCCGGAACATCGAGG F: TTGACTTGGTGATTGGTGGA R: TTTCTTCTCGGCCGGACAT F: AAGCCTTTCGCTCTAAAGTGG R: TGGGAGATTTGGGCTTCTTA F: TCAAGGCCCTGTGTACCAA R: ACGTGGGTGTCCCAAAGTAG F: CAGGGCTGGGTCCTAAGAG R: TAGCCTGGATGGCAGCTC
157 301 130 152 129 115 178 134 150 143 130
Abbreviations: F, forward; R, reverse.
The forward and reverse primers were designed using the Primer Express 2.0 software program (Applied Biosystems). The sequences of primers and approximate size of the amplified fragments are listed in Table 1. The level of all tested gene transcription was normalized to b-actin expression levels.
Fig. 1. The average time (days) to reach primary confluence for fibroblast cell cultures derived from two culture media. The length of time until confluence increased significantly, which is longer when cultured in than those in RCMEp. * P < 0.05. Data are presented as the mean standard error of the mean of at least three replicates.
2.4. Telomerase activity assay The Telomerase PCR ELISA kit (Roche Molecular Biochemicals, Mannheim, Germany) based on the telomeric repeat amplification protocol (TRAP) was used to measure telomerase activity of donor cells cultured in each of the primary culture media. Two million cells at passage from 2 to 4 were pelleted at 150 g for 10 minutes in a refrigerated centrifuge at 4 C. Then, lysis buffer (PRO-PREP protein extraction solution; iNtRON Biotechnology, Inc.) was added
Fig. 2. Cell size of donor cells cultured in RCMEp and DMEM (A) during from passage 1 to 4. Cell size was examined before SCNT and analyzed using an automated cell counter Countess. Relative abundance ratio of BAX and BCL2 apoptotic genes (B) during from passage 1 to 4 were examined using realtime quantitative polymerase chain reaction. Data are presented as the mean standard error of the mean of at least three replicates.
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
and incubated on ice for 30 minutes. The supernatant was collected, and protein concentrations were determined by the Bradford assay using NanoDrop 2000 (Thermo Fisher Scientific, Seoul, Korea). When performing the TRAP assay, equal amount of cell protein derived from each primary culture media was analyzed according to the manufacturer’s instructions.
2.5. Statistical analysis Statistical analysis was done using GraphPad Prism 4.02 (GraphPad Software Inc, San Diego, CA, USA). The data were analyzed by an unpaired t test with Welch’s correction. Significance was determined when the P value was less than 0.05. 3. Results 3.1. Length of time to reach primary confluence The numbers of days needed for dissociated cells to become confluent monolayers are shown for the two cell culture media (DMEM and RCMEp) in Figure 1. Cells cultured in DMEM primary medium required significantly more than 15 days to achieve confluence compared to 7 days needed in RCMEp primary culture medium.
527
3.2. Cell size and apoptotic gene expression level of donor cells primary cultured in DMEM and RCMEp No differences were found in cell size between donor cells derived from the two cultured media (Fig. 2A). There were also no significant differences for apoptosis-related genes, the ratio of BAX and BCL2 (Fig. 2B). 3.3. Gene expression profiles and relative telomerase activities in canine fibroblasts after primary culture in DMEM and RCMEp The relative abundance of gene transcripts in donor cells cultured in each medium and relative telomerase activities are shown in Figure 3. Donor cells cultured in DMEM show significantly lower relative telomerase activities than those of RCMEp-cultured cells as shown in Figure 3A. Compared with RCMEp, cells cultured in DMEM had significantly decreased expression levels of SOX2, NANOG, DPPA2, REXO1, HDAC, DNMT1, and MECP2 (P < 0.05) as shown in Figure 3B, C. 3.4. In vivo development of embryos from donor cells cultured in different primary media As shown in Table 2, when donor cells cultured in DMEM or RCMEp as the primary medium were used for
Fig. 3. Selected genes expression and telomerase activities for characterization of donor cells primarily cultured in two culture media. Expression of genes in fibroblasts cultured in RCMEp and Dulbecco’s modified Eagle’s medium (DMEM) were assessed using real-time quantitative polymerase chain reaction. Relative abundance of SOX2, NANOG, DPPA2, and REXO1 (A) and HDAC, DNMT1, DNMT3a, DNMT3b, and MECP2 (C) was presented. Relative telomerase activities in donor cells after primary culture in RCMEp or DMEM (B) were examined by TRAP assay. Data are presented as the mean standard error of the mean of at least six replicates. Asterisk (*) indicate a significant difference (P < 0.05).
528
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
Table 2 Effect of primary culture medium of donor cells on the birth rate of healthy cloned pups. Culture medium type
No. recipients
No. transferred cloned embryos
No. pregnant recipients (%)c
No. cloned pups (%)d
DMEM RCMEp
11 11
183 181
2 (18.18)a 4 (36.36)b
2 (1.09)a 8 (4.41)b
a,b
Different superscripts indicate significant difference (P < 0.05). Pregnancy rate was calculated by the total number of pregnant recipients/total number of recipients. Birth rate was calculated by the total number of delivered live pups/total number of transferred cloned embryos.
c
d
cloning, two and four recipients, respectively, became pregnant. The recipients pregnant with cloned embryos derived from cells that were cultured in DMEM as primary medium gave birth to two cloned pups (1.09%, births per embryos transferred, Table 2). This birth rate represented by the number of delivered pups to the number of transferred embryos was significantly lower than the RCMEpderived cells (4.41%, P < 0.05). All cloned dogs showed no abnormality, and their identity were confirmed by parentage analysis (data not shown).
4. Discussion The rationale of our present study was to investigate the effect of primary culture medium on canine fibroblasts with respect to gene expression levels, telomerase activity of cells grown in vitro, and their subsequent birth rate as evidenced by the number of produced pups after embryo transfer. Culture conditions can significantly affect the proliferative life span of cells in vitro [26]. In our study, the primary culture medium had an effect on the time required to achieve primary confluence. Rapidly outgrowing and dividing cells were only obtained from culture in RCMEp medium. Cell cultures in DMEM required over 15 days forming a confluent monolayer. The difference resulting from two medium may be due to the components of the culture medium. Fibroblasts are commonly cultured using DMEM containing 10% FBS, which promotes adequate cell growth. However, our results indicate that fibroblasts first grown to confluence in RCMEp, which is supplemented with ascorbic acid, FBS, nonessential amino acid, and FGF, display increased proliferation rates for achieving confluence. RCMEp medium was made by modifying an optimized medium for culture of human mesenchymal stem cells intended for use in cell therapies [27]. This application requires rapid expansion of cells to collect large populations quickly. The FBS concentrations of RCMEp (5%, v:v) is the same compared to those of culture medium which can induce the gene expression change of cultured cells [28]. FGF is a well-established mitogen for fibroblasts [10]. Interestingly, some studies reported that FGF can be used as culture supplements to optimize the proliferative capacity of human adipose-derived stem cells [29,30]. Ascorbic acid also plays a role as an important cofactor for collagen biosynthesis [31,32]. Consistent with our result, culture with ascorbic acid promoted proliferation of cells in primary culture [33]. With respect to cell morphology, no differences in cell size were observed. These observations were similar for all passages of fibroblasts examined. Our results indicated that the primary culture medium does not affect
morphology or size of fibroblasts, but it affected the time to reach confluence. With this in mind, we next investigated that differential gene expression responses were observed between fibroblasts cultured in RCMEp as the primary medium versus those derived from culture in DMEM. These results imply differential regulation of specific genes by serum and/or growth factors and are also in agreement with differential gene expression responses of various cell types according to culture condition [34]. SOX2, NANOG, DPPA2, and REXO1 are transcription factors with essential functions in maintaining pluripotency, all of which were upregulated by primary culture in RCMEp. These upregulations of pluripotency transcripts were previously observed in canine mesenchymal stem cells that were characterized by high levels of proliferative capacity and pluripotency [11]. Changes in telomerase activities also occurred in fibroblasts cultured first with RCMEp. It was reported that telomerase activity is upregulated in cells that undergo rapid expansion, such as committed hematopoietic progenitor cells [35]. These observations along with evidence from previous studies suggest that the telomerase activity of a cell culture is directly related to its pluripotency potential [36,37], and it is linked with efficacy of human somatic cell reprogramming [38,39]. Therefore, using RCMEp as the primary culture medium can be a method for establishing canine fibroblasts with high levels of pluripotency, telomerase activities and for achieving primary fibroblasts more quickly than DMEM primary culture. It also may affect the cloning efficiency in dogs. RCMEp primary culture led to an increase in the levels of HDAC1, DNMT1, MECP2 when compared to cells primary cultured in DMEM; however, there was no difference in activities of DNMT3a and DNMT3b. It is well accepted that increasing the global acetylation of histone or demethylation alleviates transcriptional repression by facilitating chromatin remodeling [40,41]. All the HDAC1, DNMT1, MECP2 gene expression levels of fibroblasts cultured with RCMEp were increased, which may facilitate chromatin remodeling and allow reprogramming-related factors access to nucleosomes, thereby enhancing the developmental potential of SCNT embryos. To enhance the developmental competence of cloned embryos, epigenetic modulators such as HDAC inhibitor were used [25]. In the same way of epigenetic modulators, cloned dog embryos have to undergo a well-orchestrated series of DNA methylation and histone modification changes that are believed to be permissive to reprogramming during the in vivo development. This finding indicates that primarily cultured cells using RCMEp have higher expression level of reprogramming genes, and these alterations could influence to the birth rate of cloned dogs.
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
4.1. Conclusions In conclusion, the type of culture medium used for primary culture of donor cells could not only change the time required for achieving confluence and affect the level of reprogramming, pluripotency genes’ transcripts, and telomerase activities, but also that these alterations in donor cells can improve the production efficiency of SCNT dogs. Acknowledgments The authors thank Dr Barry D. Bavister for his valuable editing of the article. This study was financially supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (#311062-04-3-SB010), Rural Development Administration (PJ010928032015), Nature Cell, Research Institute for Veterinary Science, TS Corporation, LOTTE-Nestle Korea Co. Ltd. References [1] Jang G, Oh HJ, Kim MK, Fibrianto YH, Hossein MS, Kim HJ, et al. Improvement of canine somatic cell nuclear transfer procedure. Theriogenology 2008;69:146–54. [2] Jeong YW, Kim JJ, Hossein MS, Hwang KC, Hwang IS, Hyun SH, et al. Influence of somatic cell donor breed on reproductive performance and comparison of prenatal growth in cloned canines. Theriogenology 2014;81:1207–1213 e1. [3] Yamanaka K, Sakatani M, Kubota K, Balboula AZ, Sawai K, Takahashi M. Effects of downregulating DNA methyltransferase 1 transcript by RNA interference on DNA methylation status of the satellite I region and in vitro development of bovine somatic cell nuclear transfer embryos. J Reprod Dev 2011;57:393–402. [4] Heindryckx B, Van der Elst J, Dhont M. Culture medium preferences of pre-implantation cloned mouse embryos. Methods Mol Biol 2006;348:59–78. [5] Giraldo AM, Hylan DA, Ballard CB, Purpera MN, Vaught TD, Lynn JW, et al. Effect of epigenetic modifications of donor somatic cells on the subsequent chromatin remodeling of cloned bovine embryos. Biol Reprod 2008;78:832–40. [6] Kim GA, Oh HJ, Lee TH, Lee JH, Oh SH, Kim JW, et al. Effect of culture medium type on canine adipose-derived mesenchymal stem cells and developmental competence of interspecies cloned embryos. Theriogenology 2014;81:243–9. [7] Powell AM, Talbot NC, Wells KD, Kerr DE, Pursel VG, Wall RJ. Cell donor influences success of producing cattle by somatic cell nuclear transfer. Biol Reprod 2004;71:210–6. [8] Giraldo AM, Lynn JW, Godke RA, Bondioli KR. Proliferative characteristics and chromosomal stability of bovine donor cells for nuclear transfer. Mol Reprod Dev 2006;73:1230–8. [9] Lagutina I, Lazzari G, Duchi R, Colleoni S, Ponderato N, Turini P, et al. Somatic cell nuclear transfer in horses: effect of oocyte morphology, embryo reconstruction method and donor cell type. Reproduction 2005;130:559–67. [10] Gritti A, Frolichsthal-Schoeller P, Galli R, Parati EA, Cova L, Pagano SF, et al. Epidermal and fibroblast growth factors behave as mitogenic regulators for a single multipotent stem cell-like population from the subventricular region of the adult mouse forebrain. J Neurosci 1999;19:3287–97. [11] Oh HJ, Park EJ, Lee SY, Soh JW, Kong IS, Choi SW, et al. Comparison of cell proliferation and epigenetic modification of gene expression patterns in canine foetal fibroblasts and adipose tissue-derived mesenchymal stem cells. Cell Prolif 2012;45:438–44. [12] Blelloch R, Wang Z, Meissner A, Pollard S, Smith A, Jaenisch R. Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 2006;24:2007–13. [13] Zhang M, Wang F, Kou Z, Zhang Y, Gao S. Defective chromatin structure in somatic cell cloned mouse embryos. J Biol Chem 2009; 284:24981–7.
529
[14] Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28:173–7. [15] Niemann H, Tian XC, King WA, Lee RS. Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning. Reproduction 2008;135:151–63. [16] Yang F, Hao R, Kessler B, Brem G, Wolf E, Zakhartchenko V. Rabbit somatic cell cloning: effects of donor cell type, histone acetylation status and chimeric embryo complementation. Reproduction 2007; 133:219–30. [17] Campisi J, Dimri GP, Nehlin JO, Testori A, Yoshimoto K. Coming of age in culture. Exp Gerontol 1996;31:7–12. [18] Hai T, Hao J, Wang L, Jouneau A, Zhou Q. Pluripotency maintenance in mouse somatic cell nuclear transfer embryos and its improvement by treatment with the histone deacetylase inhibitor TSA. Cell Reprogram 2011;13:47–56. [19] Wakayama S, Mizutani E, Wakayama T. Production of cloned mice from somatic cells, ES cells, and frozen bodies. Methods Enzymol 2010;476:151–69. [20] Miyamoto K, Tsukiyama T, Yang Y, Li N, Minami N, Yamada M, et al. Cell-free extracts from mammalian oocytes partially induce nuclear reprogramming in somatic cells. Biol Reprod 2009;80: 935–43. [21] Wang Y, Su J, Wang L, Xu W, Quan F, Liu J, et al. The effects of 5-aza2’- deoxycytidine and trichostatin A on gene expression and DNA methylation status in cloned bovine blastocysts. Cell Reprogram 2011;13:297–306. [22] Kim GA, Oh HJ, Park JE, Kim MJ, Park EJ, Lim SH, et al. Employing mated females as recipients for transfer of cloned dog embryos. Reprod Fertil Dev 2013;25:700–6. [23] Hewitt DA, England GC. Effect of preovulatory endocrine events upon maturation of oocytes of domestic bitches. J Reprod Fertil Suppl 1997;51:83–91. [24] Wildt DE, Panko WB, Chakraborty PK, Seager SW. Relationship of serum estrone, estradiol-17beta and progesterone to LH, sexual behavior and time of ovulation in the bitch. Biol Reprod 1979;20:648–58. [25] Oh HJ, Hong SG, Park JE, Kang JT, Kim MJ, Kim MK, et al. Improved efficiency of canine nucleus transfer using roscovitine-treated canine fibroblasts. Theriogenology 2009;72:461–70. [26] Balin AK, Fisher AJ, Anzelone M, Leong I, Allen RG. Effects of establishing cell cultures and cell culture conditions on the proliferative life span of human fibroblasts isolated from different tissues and donors of different ages. Exp Cell Res 2002; 274:275–87. [27] Ra JC, Shin IS, Kim SH, Kang SK, Kang BC, Lee HY, et al. Safety of intravenous infusion of human adipose tissue-derived mesenchymal stem cells in animals and humans. Stem Cells Dev 2011;20: 1297–308. [28] Bieback K, Ha VA, Hecker A, Grassl M, Kinzebach S, Solz H, et al. Altered gene expression in human adipose stem cells cultured with fetal bovine serum compared to human supplements. Tissue Eng Part A 2010;16:3467–84. [29] Hebert TL, Wu X, Yu G, Goh BC, Halvorsen YD, Wang Z, et al. Culture effects of epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) on cryopreserved human adipose-derived stromal/ stem cell proliferation and adipogenesis. J Tissue Eng Regen Med 2009;3:553–61. [30] Hu F, Wang X, Liang G, Lv L, Zhu Y, Sun B, et al. Effects of epidermal growth factor and basic fibroblast growth factor on the proliferation and osteogenic and neural differentiation of adipose-derived stem cells. Cell Reprogram 2013;15:224–32. [31] Otsuka E, Kato Y, Hirose S, Hagiwara H. Role of ascorbic acid in the osteoclast formation: induction of osteoclast differentiation factor with formation of the extracellular collagen matrix. Endocrinology 2000;141:3006–11. [32] Chung JH, Youn SH, Kwon OS, Cho KH, Youn JI, Eun HC. Regulations of collagen synthesis by ascorbic acid, transforming growth factorbeta and interferon-gamma in human dermal fibroblasts cultured in three-dimensional collagen gel are photoaging- and aging-independent. J Dermatol Sci 1997;15:188–200. [33] Shima N, Kimoto M, Yamaguchi M, Yamagami S. Increased proliferation and replicative lifespan of isolated human corneal endothelial cells with L-ascorbic acid 2-phosphate. Invest Ophthalmol Vis Sci 2011;52:8711–7. [34] Koellensperger E, Gramley F, Preisner F, Leimer U, Germann G, Dexheimer V. Alterations of gene expression and proteins synthesis in co-cultured adipose tissue-derived stem cells and squamous cellcarcinoma cells: consequences for clinical applications. Stem Cell Res Ther 2014;5:65.
530
G.A. Kim et al. / Theriogenology 84 (2015) 524–530
[35] Haik S, Gauthier LR, Granotier C, Peyrin JM, Lages CS, Dormont D, et al. Fibroblast growth factor 2 upregulates telomerase activity in neural precursor cells. Oncogene 2000;19:2957–66. [36] Low KC, Tergaonkar V. Telomerase: central regulator of all of the hallmarks of cancer. Trends Biochem Sci 2013;38:426–34. [37] Ninagawa N, Murakami R, Isobe E, Tanaka Y, Nakagawa H, Torihashi S. Mesenchymal stem cells originating from ES cells show high telomerase activity and therapeutic benefits. Differentiation 2011;82:153–64. [38] Xu T, Xu Y, Liao CP, Lau R, Goldkorn A. Reprogramming murine telomerase rapidly inhibits the growth of mouse cancer cells in vitro and in vivo. Mol Cancer Ther 2010;9:438–49.
[39] Marusic L, Anton M, Tidy A, Wang P, Villeponteau B, Bacchetti S. Reprogramming of telomerase by expression of mutant telomerase RNA template in human cells leads to altered telomeres that correlate with reduced cell viability. Mol Cell Biol 1997;17:6394–401. [40] Kumar BM, Maeng GH, Lee YM, Lee JH, Jeon BG, Ock SA, et al. Epigenetic modification of fetal fibroblasts improves developmental competency and gene expression in porcine cloned embryos. Vet Res Commun 2013;37:19–28. [41] Mason K, Liu Z, Aguirre-Lavin T, Beaujean N. Chromatin and epigenetic modifications during early mammalian development. Anim Reprod Sci 2012;134:45–55.
