BIOLOGY OF REPRODUCTION (2015) 92(2):43, 1–9 Published online before print 23 December 2014. DOI 10.1095/biolreprod.114.118638
Effect of Vaginal or Systemic Estrogen on Dynamics of Collagen Assembly in the Rat Vaginal Wall1 T. Ignacio Montoya, P. Antonio Maldonado, Jesus F. Acevedo, and R. Ann Word2 Department of Obstetrics and Gynecology, Division of Female Pelvic Medicine and Reconstructive Surgery, University of Texas Southwestern Medical Center, Dallas, Texas
The objective of this study was to compare the effects of systemic and local estrogen treatment on collagen assembly and biomechanical properties of the vaginal wall. Ovariectomized nulliparous rats were treated with estradiol or conjugated equine estrogens (CEEs) either systemically, vaginal CEE, or vaginal placebo cream for 4 wk. Low-dose local CEE treatment resulted in increased vaginal epithelial thickness and significant vaginal growth without uterine hyperplasia. Furthermore, vaginal wall distensibility increased without compromise of maximal force at failure. Systemic estradiol resulted in modest increases in collagen type I with no change in collagen type III mRNA. Low-dose vaginal treatment, however, resulted in dramatic increases in both collagen subtypes whereas moderate and high dose local therapies were less effective. Consistent with the mRNA results, low-dose vaginal estrogen resulted in increased total and cross-linked collagen content. The inverse relationship between vaginal dose and collagen expression may be explained in part by progressive downregulation of estrogen receptor-alpha mRNA with increasing estrogen dose. We conclude that, in this menopausal rat model, local estrogen treatment increased total and cross-linked collagen content and markedly stimulated collagen mRNA expression in an inverse dose-effect relationship. High-dose vaginal estrogen resulted in downregulation of estrogen receptor-alpha and loss of estrogeninduced increases in vaginal collagen. These results may have important clinical implications regarding the use of local vaginal estrogen therapy and its role as an adjunctive treatment in women with loss of vaginal support. collagen, conjugated equine estrogen, estradiol, lysyl oxidase, pelvic organ prolapse
INTRODUCTION Like other matrix components, collagen undergoes continuous synthesis and degradation in the vaginal wall. Although turnover rates are low in other resting adult tissues, connective tissue remodeling is continuous in the vagina during reproductive life and is accentuated during pregnancy, parturition, and after menopause. Fibrillar collagens (collagen 1
This work was supported by NIH AG028048 and HD064824. Presented at the 32nd Annual Scientific Meeting of the American Urogynecologic Society, Chicago, IL, 3-6 October 2012. 2 Correspondence: R. Ann Word, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9032. E-mail: [email protected]
MATERIALS AND METHODS All the animals were handled and euthanized in accordance with the standards of humane animal care described by the National Institutes of Health Guide for the Care and Use of Laboratory Animals, using protocols approved by the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center at Dallas. A total of 37 virginal Sprague Dawley rats (Charles River Laboratories) at 12 wk of age were housed in Institutional Animal Care and Use Committee-approved facilities under a 12L:12D cycle at 228C.
Received: 17 February 2014. First decision: 6 April 2014. Accepted: 17 December 2014. Ó 2015 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363
1
Article 43
Downloaded from www.biolreprod.org.
types I, II, and III) are the predominant matrix components that contribute to tensile strength of the extracellular matrix, thereby playing an essential role in maintenance of vaginal support [1]. In women with pelvic organ prolapse, total collagen content is decreased in the vaginal wall compared with premenopausal controls [2], and women with connective tissue disorders experience high rates of pelvic organ prolapse [3]. Collagen also appears to play a key role in maintenance of normal urinary continence by imparting structural stability to the proximal urethra through the paraurethral connective tissue connections to the pelvic floor [4]. Tissue collagen content is dependent on the balance of its synthesis and degradation. It has been suggested that collagen metabolism shifts to a degradative state after menopause and in the setting of vaginal prolapse, with increased activity of endogenous matrix proteases [2, 5]. Furthermore, the proportion of the highly stable, mature, cross-linked collagen relative to immature precursor collagen molecules that are easily degraded influences tissue strength. It has been shown that the proportion of immature collagen is increased in women with prolapse [1]. Finally, the type of collagen influences connective tissue strength and helps tissue withstand stretch. The vaginal wall is made up of predominantly collagens types I and III secreted from fibroblasts and smooth muscle cells. Collagen type I confers the greater tensile strength. The role of estrogen therapy in the regulation of collagen homeostasis in the vaginal wall is poorly understood. In postmenopausal women, local estrogen is used commonly for treatment of vaginal atrophy symptoms, including vaginal dryness, dysuria, urethral discomfort, and stress urinary incontinence [6]. Local estrogen treatment increases vaginal epithelial thickness and promotes revascularization [7]. With regards to the vaginal subepithelium, Clark et al. [8] demonstrated increases in collagen mRNA expression after systemic estradiol (E2) treatment in a rhesus macaque model. Similarly, systemic estrogen replacement therapy in postmenopausal women resulted in increased mRNA expression of collagen I and III in paraurethral connective tissue [9]. The effects of local estrogen on connective tissue components, however, have been less well characterized. The purpose of this study was to use the rat as an animal model to compare the effects of systemic and local estrogen treatment on collagen content and expression of proteins involved in collagen assembly in the vaginal wall.
ABSTRACT
MONTOYA ET AL. calculated using Image J software (ImageJ 1.46r, NIH) and normalized to total protein loaded quantified on Coomassie-stained gels.
Treatment Groups All the animals underwent bilateral oophorectomy through 1 cm flank incisions. Two weeks after oophorectomy, animals were divided in five groups and treatments were applied as follows. For the systemic E2 (n ¼ 5) group, Alzet osmotic minipumps (Durect Corporation) delivering 50 lg E2/kg/day were inserted subcutaneously through a dorsal incision. The dose of systemic E2 was chosen based on previously published studies demonstrating similar serum estrogen levels to those of cycling rats (29–71 pg/ml) [10–12]. Systemic conjugated equine estrogens (CEEs) (n ¼ 8) was delivered orally per gavage (2.6 lg/day, approximating 0.625 mg/day for women). For the local estrogen groups, CEE cream (Pfizer Pharmaceuticals) was delivered vaginally at three different doses—62.5, 6.25, and 625 ng CEE per dose, delivered in 100 mg of cream and termed high (n ¼ 6), medium (n ¼ 6), and low (n ¼ 6) dose, respectively—with daily vaginal applications for 1 wk, followed by three applications per week for three additional weeks. The placebo group (n ¼ 6) received vaginal applications of a placebo cream in 100 mg cream doses following the same schedule as the CEE treatment groups. Vaginal CEE dosing was calculated utilizing weight-based comparisons with human dosage as previously published in similar studies [13]. The usual vaginal maintenance dose (1 g cream) in a 60 kg woman delivers 625 lg CEEs. By weight comparison, this translates into a 4.2 lg CEE dose in a 400 g animal. For dilutional simplicity, we selected a dose of 6.25 lg CEEs as our medium dose with 10-fold differences for our high (62.5 lg) and low (625 ng) doses, respectively. Vaginal treatments were delivered using a 1 ml syringe. After each vaginal application, topical benzoin was applied to the vulva to deter ingestion of the cream.
Biomechanical Testing Each vaginal ring was suspended between two stainless steel wire mounts and attached to a steel rod apparatus with a calibrated mechanical drive and to a force transducer. Tissues were maintained in a physiologic salt solution in water baths at 378C with 95% O2 and 5% CO2. After acclimation for 15 min, each ring was equilibrated to slack length (ring diameter at resting tone) as measured by the calibrated mechanical drive. Rings were distended in 1 mm increments with 30-sec intervals between each increment to allow stabilization of forces before each subsequent distention. This process was continued until failure (ring breakage) or until plateau of force generation. Wet weights of vaginal rings were determined after testing. Stress (N/m2) was calculated as maximum force per unit area and plotted against strain (change in length divided by slack length), producing a sigmoid-shaped curve. Elasticity, an index of tissue stiffness, was calculated from the slope of the linear portion of the curve.
Histomorphology
Tissue Processing After 4 wk of treatment, the animals were euthanized. The abdominal cavity was opened, the pubic symphysis disarticulated, and the uterine horns, bladder, cervix, and vagina dissected down to the perineal skin. Using microsurgical instruments and a dissection microscope, the perineal skin was removed and the bladder and urethra separated from the anterior vaginal wall. The uterine horns and cervix were removed from the vaginal tube. Gross weights of the pelvic organs were obtained. An upper vaginal ring was excised and submitted for biomechanical testing. An additional vaginal ring was excised and submitted for histologic processing. The remainder of the vaginal tube was opened longitudinally, the epithelium scraped off using a scalpel, and the remaining vaginal stroma snap-frozen in liquid nitrogen and stored at 808C.
Hydroxyproline Assay Collagen solubility measurements were used as an index of collagen structure within the tissue [14]. Weights of vaginal tissues were determined before and after lyophilization. Lyophilized tissue was homogenized with 1 M NaOH with PIs at 48C for 24 h, centrifuged, and the supernatant was saved as fraction A (newly synthesized, noncross-linked collagen fraction). The remaining residue was washed with water plus PIs and extracted with 0.5 M acetic acid plus PIs at 48C for 24 h with rotation. Samples were centrifuged, and the supernatant saved as fraction B (denatured mature collagen). The remaining tissue pellet was saved as fraction C (mature, cross-linked collagen). Collagen content in each fraction was determined by measurement of hydroxyproline content by the chloramine [13]-T method after overnight hydrolysis in 6 M HCl at 1008C. Hydroxyproline values were converted to collagen (3 7.6) and normalized to tissue wet weight.
Protein Extraction Frozen vaginal tissue was pulverized with a liquid nitrogen-chilled mortar and pestle. Tissue powder was then homogenized in basic buffer containing protease inhibitors (PIs)—16 mM potassium phosphate, pH 7.8, 0.12 M NaCl, 1 mM ethylenediaminetetraacetic acid, 0.1 mM phenylmethylsulfonyl fluoride, 10 lg/ml pepstatin A, and 10 lg/ml leupeptin)—and centrifuged at 10 000 3 g. The supernatant was then removed, and the previous homogenization step repeated after resuspending the remaining tissue pellet in basic buffer. After removal of the second supernatant, the remaining tissue pellet was suspended in 6.0 M urea in the above basic buffer, homogenized, and placed on a rotating rack for overnight extraction at 48C. The samples were then centrifuged (10 000 3 g for 30 min), and the supernatant removed. Protein concentrations were determined using a bicinchoninic acid protein assay with standard curves of bovine serum albumin in appropriate buffers.
Real-Time Quantitative PCR Quantitative PCR was used to determine the relative levels of mRNAs in vaginal tissues. Tissues were pulverized and homogenized in Trizol reagent (Invitrogen). RNA was isolated according to manufacturer’s protocol. Complementary DNA synthesis was carried out with 2 lg of total RNA in a reaction volume of a 20 ll. Each reaction contained 10 mM dithiothreitol, 0.5 mM deoxynucleotide triphosphates (dNTPs), 0.015 lg/ll random primers, 40 units RNase inhibitor (Invitrogen), and 200 units reverse transcriptase (Invitrogen). PCR reactions were carried out in the ABI Prism 7000 sequence-detection system (Applied Biosystems). The reverse transcription product from 50 ng RNA was used as the template, and reaction volumes (30 ll) contained Master Mix (Applied Biosystems). Primer concentrations were 900 nM. Cycling conditions were 2 min at 508C, followed by 10 min at 958C, then 40 cycles of 15 sec at 958C and 1 min at 608C. SYBR Green was used for amplicon detection. Gene expression was normalized to expression of the housekeeping gene, cyclophilin A (CYPA), which was invariant among samples. A preprogrammed dissociation protocol was used after amplification to ensure that all the samples exhibited a single amplicon. Levels of mRNA were determined using the DCt method (Applied Biosystems) and expressed relative to an external calibrator present on each plate. Primers used in this study are listed in Table 1. All the primer sets were tested to ensure that efficiency of amplification over a wide range of template concentrations was equivalent to that of CYPA.
Immunoblot Analysis Urea-extracted protein samples (10 lg/lane) were applied to 4%–20% gradient polyacrylamide gels (Bio-Rad), separated by electrophoresis, and transferred to nitrocellulose membranes. Identical gels were run side-by-side and Commassie blue-stained for protein loading comparison among the samples. After protein transfer, membranes were treated with blocking buffer, tris (hydroxymethyl) aminomethane 0.01 M, NaCl 0.15 M, Tween 20, 0.1%, pH 7.4 (TBS-T) with 2.5% nonfat milk for 1 h. An affinity-purified rabbit antibody against human lysyl oxidase (LOX) was generated using a pro-LOX peptide (NH2-182GCPYYNYYDTYERPRPG96-OH) that is conserved between mouse, rat, and human LOX. Membranes were incubated in primary antibody (1:1000 dilution) for 90 min at 378C and then serially washed with TBS-T, followed by treatment with secondary antibody (goat immunoglobulin G antirabbit, 1:8000) at room temperature for 1 h. Membranes were serially washed with TBS-T and subsequently incubated with Western Lightning Chemiluminescence Reagent Plus (Perkin-Elmer) for 2 min. Signal strength was captured using a Fujifilm FLA 5100 image capture system. Protein band density was
2
Article 43
Downloaded from www.biolreprod.org.
Vaginal rings were fixed in neutral buffer formalin (10%). Tissues were subsequently processed and embedded in paraffin blocks. Cross-sections of each vaginal ring were stained with hematoxylin and eosin as well as Masson trichrome stain. Images of each section were captured and analyzed using a Nikon E1600 microscope and Nikon NIS Elements AR software. Briefly, the mean of at least six measurements from the lumen cell surface to the basement membrane were quantified for each specimen. Likewise the distance, in lm, between the basement membrane and edge of the muscular bundles was determined as the mean of 6–10 measurements per specimen. Thickness of the muscularis (muscle bundles between the lamina propria and adventitia) was quantified as the mean of 6–10 measurements throughout the specimen.
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL TABLE 1. Primers used for amplification of mRNA in this study. Forward primersa
Reverse primersa
Accession no.
AATGCTGGACCAAACACAAATG (346–367) CTTGGAGCCCTGGGATATCAAG (2568–2589) CGATGGCGTGCTATGCAA (278–295) GTGTCTGCGACTCGGGATCT (265–284) TGGCACCGGTTACTTCCAGTA (909–929) CTTCAGCTCCACAGAGAAGAACTG (1000–1023) GCTGCGCAAGTGTTACGAAG (811–831) GAGGGCAATGATGTGTGCAA (2046–2065)
CCATCCAGCCACTCAGTCTTG (413–393) AACACCGGCCTTCTCTTTCACT (2633–2612) CTGCGTCTGGTGATACATATTCTTCT (381–356) GGAATGACAGGAGCAGGTGTAGA (403–381) ACGTGGATGCCTGGATGTAGT (959–929) TCCAACCCAGGTCCTTCCTA (1070–1051) TCTTTTCGTATCCCGCCTTTC (862–841) GAGTCCGCTGCGCACCT (2096–2080)
NM017101.1 BC085910 BC133728.1 BC087039.1 NM_017061.2 BC076380.1 X61098.1 NM_031323.1
Gene rCPHA rELASTIN rCOLA1 rCOLA3 rLOX rTGFB1 rERa rBMP1 a
Numbers in parenthesis represent nucleotide sequence according to accession number.
One-way analysis of variance (ANOVA) and nonparametric (Kruskal Wallis) testing was performed, as appropriate, for multiple group comparisons. With P , 0.05 significance, posttesting between groups was performed using Dunnett test for normally distributed data and Dunn tests for nonparametric distributions with placebo designated as the control group. Data are presented as mean 6 SEM.
RESULTS Effect of Vaginal CEE on Uterine and Vaginal Weight Because CEE contains E2, estrone, and approximately eight (conjugated) equine estrogens, it was not practical to measure serum levels of all the potential estrogenic compounds in the serum. Thus, increased uterine weight was considered an index of biological estrogen activity. Systemic therapy with CEE did not result in increased uterine weight (Fig. 1A). In contrast, high-dose vaginal CEE increased uterine weight significantly while vaginal low- or medium-dose treatment did not (Fig. 1A). Furthermore, endometrial growth was absent in uterine tissues from animals treated with low-dose CEE (not shown). Interestingly, although low-dose vaginal treatment did not increase uterine weight, vaginal weight increased significantly after low-dose, but not medium- or high-dose, vaginal CEE treatment (Fig. 1B). Because CEEs have relatively low affinity for estrogen receptors (ERs), the effect of systemic E2 was also studied. As expected, systemic E2 exhibited the most dramatic effect on uterine weight (.6-fold). Histologic analyses of sections of the vaginal wall from ovariectomized animals treated with placebo, systemic CEE, or vaginal low-dose CEE are shown in Figure 2. After ovariectomy, vaginal epithelium was reduced to a single layer. Lamina propria, muscularis, and adventitial layers were observed (Fig. 2Aa). Vessels were limited to the adventitial layer with a few small perforating vessels in the lamina propria. Whereas epithelial thickness was not increased significantly after systemic CEE treatment, the epithelial cells were polarized, filled with vacuoles, and secreting mucus (Fig. 2Ab). Vaginal CEE treatment resulted in marked increases in epithelial thickness. Grossly, multiple vessels perforated the lamina propria (Fig. 2Ac). Quantification of epithelial, lamina propria, and muscularis thickness revealed that local administration of vaginal CEE resulted in increased epithelial thickness, but other layers were unchanged (Fig. 2B) except for the appearance of increased collagen density of the systemic CEE vagina (Fig. 2Ab).
Collagen mRNA To determine the mechanisms by which local CEE treatment resulted in increased total and cross-linked collagen in the vaginal wall, levels of collagen type I and III mRNA were quantified. Whereas systemic CEE had no significant effect on collagen type I mRNA for 4 wk, local CEE treatment resulted in increased expression of both types of collagen in an inverse dose-response manner (Fig. 3). Low-dose treatment resulted in 4-fold increases in Col1a and 8-fold increases in Col3a gene expression, whereas high dose vaginal CEE was ineffective. Surprisingly, low-dose vaginal therapy resulted in more dramatic changes in collagen mRNA than systemic E2, which resulted in 2-fold increases in Col1a with no change in Col3a (Fig. 3). In contrast with collagen, tropoelastin gene expression was not altered by local or systemic estrogen treatment (data not shown). Because transforming growth factor b-1 (TGFb1) is known to increase collagen synthesis in mesenchymal cells and regulate expression of the major collagen cross-linking enzyme (LOX), TGFb1 mRNA levels were also analyzed in the vaginal wall after estrogen treatment. Whereas other treatment regimens had no effect, low-dose vaginal CEE resulted in increased TGFb1 mRNA (Fig. 4A). BMP-1 (i.e., procollagen peptidase) and LOX are two enzymes important in processing procollagen to mature collagen fibers. BMP-1 cleaves procollagens and pro-LOX into the mature enzyme in the extracellular space. To gain insight into potential mechanisms by which estrogen affects collagen processing in the vagina, the effect of estrogen treatment on vaginal BMP-1 mRNA and LOX mRNA and protein were determined (Fig. 4). Both systemic and vaginal CEE resulted in 2- to 4-fold increases in BMP-1 mRNA (not shown). Surprisingly, and consistent with CEE-induced changes in mature collagen, low-dose vaginal CEE and systemic CEE increased LOX mRNA. Using immunoblot analysis, pro-LOX, but not mature LOX, was detected with our antibody that preferentially recognized the pro-LOX form (Fig. 4C). Immunoblot analysis was conducted with urea-extracted proteins from the vaginal wall of animals treated with placebo, systemic E2, or local CEE using placebo
Effect of Vaginal CEE Treatment on Collagen Content in the Vaginal Wall Collagen content of the vaginal muscularis was quantified from animals treated with control, systemic CEE, systemic E2, 3
Article 43
Downloaded from www.biolreprod.org.
and local CEE. Data were expressed as lg/mg dry weight and, to account for increased organ size, lg/ vagina (Table 2). Although the collagen content per lg dry weight was similar in all the treatment groups, the amount of cross-linked collagen was increased in muscularis from animals treated with systemic E2. In addition, the fraction of cross-linked collagen was increased significantly in muscularis from animals treated with systemic E2 as well as animals receiving either low- or medium-dose vaginal CEE treatment. Interestingly, the total amount of collagen per vagina was increased significantly in low-dose, but not medium- or high-dose, intravaginal CEE treatment (Table 2).
Statistical Analysis
MONTOYA ET AL.
FIG. 1. Effect of systemic or local estrogen on uterine and vaginal wet weight. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2) by osmotic minipumps (50 lg/kg/d), oral conjugated equine estrogens (Sys CEE), or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk of treatment, uterine (A) or vaginal (B) tissues were harvested and weighed. Data represent mean 6 SEM of five to eight rats per group; *P , 0.05 compared with Ctl.
Downloaded from www.biolreprod.org. FIG. 2. Effect of systemic or local estrogen on histomorphology of the vaginal wall. A) Representative sections of tissues obtained from the upper third of the vagina in control (Ctl, placebo vaginal cream), systemic CEE, or vaginal CEE (0.625 lg/dose). Sections were stained with Masson trichrome stain. epi, epithelium; l.p., lamina propria; m, muscularis; adv, adventitia. Arrow denotes mucin-laden epithelial cells with systemic CEE. Bar ¼ 200 lm. B) Morphometric measurements of thickness of the vaginal wall, epithelium, lamina propria, or muscularis. Data represent mean 6 SEM of five to eight rats in each group; *P , 0.05 compared with Ctl.
4
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL TABLE 2. Effect of systemic or vaginal estrogen and collagen (Coll) content of the vaginal wall.a Treatmentb Control Sys CEE Sys E2 Vag CEE Low Vag CEE Med Vag CEE High
Total coll (lg/mg dry wt) 432 317 452 347 296 327
6 6 6 6 6 6
36.7 33.1 49.8 34.3 26.9 63.5
Cross-linked (lg/mg dry wt) 35.6 26.9 61 49.6 38.2 26.9
6 6 6 6 6 6
3.2 2.8 4.3* 3.8 2.3 6.1
Cross-linked (%) 8.1 8.5 13.5 14.3 12.8 8.3
6 6 6 6 6 6
0.8 0.8 0.6* 0.5* 0.3* 1.0
Total coll (lg/vagina) 13.3 15.1 18.3 20.9 13.1 12.0
6 6 6 6 6 6
0.2 1.0 0.4* 1.0* 1.5 1.7
Cross-linked (lg/vagina) 2.1 2.9 5.8 4.3 2.0 2.6
6 6 6 6 6 6
0.5 0.2 0.9* 0.8 0.6 0.6
a
Data represent mean 6 SEM of six to eight animals in each group. Sys CEE, systemic CEE treatment; Sys E2, systemic E2 treatment; Vag CEE Low, vaginal CEE low-dose treatment; Vag CEE Med, vaginal CEE medium-dose treatment; Vag CEE High, vaginal CEE high-dose treatment. *P , 0.05 compared with control. b
as controls on each blot for comparisons. As noted in Figure 4C, systemic E2 and local CEE increased pro-LOX protein. In contrast to collagen and TGFb mRNA, however, LOX tended to rise with increasing dose of vaginal estrogen, with high-dose estrogen approaching that of systemic E2.
Effect of Systemic and Vaginal Estrogen on Biomechanical Properties of the Vaginal Wall Next, we sought to determine if changes in collagen content and LOX resulted in functional effects in the biomechanical properties of the vagina. Maximal distention of vaginal rings from ovariectomized rats treated with or without systemic or local CEE was similar (i.e., ;4–5 mm) (Fig. 6A). Furthermore, the maximal force generated in response to increasing stretch was not different among the treatment groups (Fig. 6B). In contrast, local and systemic estrogen treatment (either CEE or E2) resulted in increased vaginal wall distensibility (i.e., decreased stiffness) compared with controls (Fig. 6C). Thus, estrogen treatment regardless of route, compound, or dose resulted in increased distensibility of the vaginal wall without compromise of strength.
Effect of Systemic and Vaginal Estrogen on ERa mRNA The inverse dose-response relationship between vaginal CEE and collagen content in the vaginal wall was puzzling. Furthermore, it was surprising that systemic CEE or E2 treatment was sometimes less effective than that of low-dose vaginal CEE. To examine the possibility that the major ER of the vagina (i.e., ERa) may be affected by different routes and doses of estrogen, ERa mRNA was determined in the vaginal muscularis with or without estrogen therapy (Fig. 5). ERa expression was similar in vaginal muscularis from control- and systemic E2-treated ovariectomized rats. Interestingly, systemic CEE and low-dose vaginal CEE treatments, however, resulted in significant (3-fold) upregulation of vaginal ERa, which was downregulated with increasing doses of vaginal CEE.
DISCUSSION Reproductive hormones may play an important role in the maintenance of connective tissues and extracellular matrix necessary for pelvic visceral support. Estrogen and progesterone receptors have been identified in the nuclei of connective tissue and smooth muscle cells of the levator ani stroma [15], uterosacral ligaments, and vaginal wall [16, 17]. The ratio of 5
Article 43
Downloaded from www.biolreprod.org.
FIG. 3. Effect of systemic and local estrogen on collagen types I and III mRNA in the vagina. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2 by osmotic minipumps (50 lg/kg/day) (Sys E2), systemic CEE, or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk, RNA was isolated from the stroma and muscularis, and the relative mRNA levels of collagen type I (ColA1, A) and collagen type III (ColA3, B) mRNA were quantified. *P , 0.05 compared with Ctl.
MONTOYA ET AL.
Downloaded from www.biolreprod.org. FIG. 4. Regulation of TGFb1 and LOX in the vaginal wall. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2, systemic CEE, or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk, RNA was isolated from the stroma/muscularis, and the relative mRNA levels of TGFb1 (A) and LOX (B) were quantified. C) Immunoblot analysis of LOX in urea extracts. Representative immunoblot provided in the inset with vaginal Hi dose. Urea-extracted protein (10 lg/lane) was applied in each lane and probed with an antibody that preferentially recognizes pro-LOX (;55 kDa). Coomassie-stained gel was used to normalize immunoreactive protein density. Data represent mean 6 SEM of relative signal intensities from five to six animals in each group; *P , 0.05 compared with Ctl.
collagen I (generally consisting of well-organized fibers and associated with ligamentous tissue) to collagen III and IV (more common in skin, blood vessels, and muscle) is decreased in pelvic connective tissues of postmenopausal women without hormone replacement therapy [18]. This relative decrease in well-organized dense collagen is believed to contribute to weakening of vaginal wall tensile strength, thereby leading to increased susceptibility to anterior wall prolapse. Thus, menopause and loss of estrogen may lead to decompensation of pelvic organ support. Although there is little doubt that estrogen improves the vaginal epithelial layer [6], it is unclear whether hormonal
therapy alleviates, worsens, or has no effect on connective tissues that support the pelvic viscera. Furthermore, the differences between local and systemic estrogen therapy are unknown. Here, we used a preclinical ovariectomized rat model to find that low-dose vaginal CEE results in 1) increased vaginal weight, 2) increased total and mature collagen content, 3) increased expression of collagen-processing enzymes, LOX and BMP-1, and 4) increased distensibility of the vaginal wall. Importantly, low-dose vaginal CEE was more effective than systemic CEE. Low-dose vaginal CEE was also superior to medium doses, which was calculated utilizing weight-based comparisons with human dosage equivalence. Although this 6
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL
and thereby result in a net increase in collagen content. Nevertheless, low-dose vaginal treatment with CEE resulted in robust increases in both collagen types I and III mRNA with a disproportionate increase in Col3a. Differential Effects of Systemic and Low-Dose Vaginal CEE Treatments Although systemic CEE increased vaginal weight, systemic CEE did not increase vaginal collagen appreciably. LOX mRNA was increased by systemic CEE. Furthermore, although systemic CEE resulted in increased mucus-producing epithelial cells, epithelial thickness was not increased as observed with vaginal CEE. This finding is in agreement with the overall clinical impression of many gynecologists that local estrogen is superior to systemic estrogen in terms of relief of vaginal atrophy. Our results indicate that vaginal CEE is also superior to systemic CEE in terms of vaginal collagen, suggesting that vaginal CEE may serve to improve the vaginal matrix prior to reconstructive surgery for prolapse [28].
FIG. 5. Effect of systemic and vaginal estrogen on ERa gene expression in the vaginal stroma/muscularis. RNA was isolated from stroma/muscularis of ovariectomized rats treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2), systemic CEE (Sys CEE), or vaginal CEE at low, medium, or high doses as described in Materials and Methods. Relative ERa mRNA was determined by quantitative PCR. Data represent mean 6 SEM of five to eight animals in each group; *P , 0.05 compared with Ctl.
Biomechanics of the Vaginal Wall
dosing regimen may not be precisely equivalent to human vaginal absorption and effects, the results suggest that lower doses of vaginal CEE may be more effective than the current recommendation. Vaginal Weight For decades, increased uterine weight in immature or ovariectomized rats has been used as a sensitive reliable indicator of estrogen effects. Here, we found that vaginal CEE also resulted in uterine prolific effects depending on dose. Although low-dose vaginal CEE treatment caused significant increases in vaginal wet weight, uterine weight was unchanged, suggesting that this dose of local therapy has no systemic absorption. It is well-accepted that long-term use of unopposed CEEs can result in endometrial proliferation and adenocarcinoma of the endometrium. In our study, we did not observe an increase of uterine weight or uterine prolific effects with systemic CEE. Thus, our conclusions are limited to this animal model during this time frame. Nonetheless, the results indicate that low-dose vaginal CEE has a significant effect on vaginal, but not uterine, weight during short-term use. Vaginal Collagen Content Systemic E2 and low-dose vagina CEE treatments resulted in significant increases in vaginal collagen. These findings agree with studies in postmenopausal women in which estrogen supplementation increases collagen content of the skin, vasculature, and pelvic tissues [18–20]. The results also agree with our work in guinea pigs in which systemic E2 also increased growth and collagen content of the vagina [21]. Other studies, however, suggest that estrogen may have negative effects on pelvic support [22–25]. In this study, although systemic E2 resulted in increased collagen content of the vaginal wall, collagen types I and III mRNA levels were not increased 4 wk after treatment. We did not conduct a detailed time course of the effects of estrogen. It is likely that systemic E2 resulted in an initial increase in collagen mRNA that subsided as ERa was downregulated with time. Alternatively, systemic E2 may inhibit collagen degradation [26, 27] 7
Article 43
Downloaded from www.biolreprod.org.
Interestingly, both systemic and vaginal CEE at low, medium, and high doses had a significant impact on the biomechanical properties of the vaginal wall with substantial decreases in vaginal stiffness and no change in maximal strength at failure. Although increases in collagen content are most associated with increased stiffness, this parameter is also known to be altered by collagen subtypes, differences in proteoglycans, tissue hydration, and elastic fibers. The magnitude of estrogen-induced increases in ColA3 was greater than that of ColA1 in low-dose vaginal treatment, which may contribute to the profound decrease in vaginal stiffness in this group. However, decreases in vaginal stiffness did not correlate with changes in Cola1 or Cola3 in systemic CEE or medium/ high vaginal doses. Thus, estrogen-induced decreases in vaginal stiffness may be related to factors other than collagen content, including collagen organization through collagenbinding proteoglycans, glycosaminoglycans, or elastic fibers. This possibility is now under investigation. Downregulation of ERa correlated with decreased efficacy of higher doses of estrogen in terms of collagen mRNA, total collagen content, distensibility, and activation of TGFb1 gene expression. Homologous downregulation of hormone receptors by their ligands has been reported [29, 30]. Medlock et al. [31] demonstrated uterine ER downregulation with high doses of systemic E2. Similar to our findings, Carley et al. [17] also demonstrated that vaginal ER was downregulated with systemic E2 and that responses to treatment differed among uterus, vagina, and bladder. Kim et al. [32], however, showed increased ER binding in ovariectomized rats treated with subphysiological doses of systemic E2. Our findings of marked upregulation of ERa with low-dose local CEE or systemic CEE are in agreement with these studies and suggest that upregulation of ER may be a compensatory mechanism to optimize estrogen-mediated effects when plasma E2 concentration is low. Increases in collagen mRNA and TGFb1 gene expression may or may not be related to ER levels and may be direct or indirect targets. Interestingly, LOX mRNA was increased in the vaginal muscularis after systemic or local CEE therapy for 4 wk. LOX protein was upregulated after vaginal CEE and systemic E2 treatments. Although we have previously shown that LOX is upregulated in the postpartum vagina in rats, which may act to resynthesize matrix molecules after parturition [33], it is also
MONTOYA ET AL.
Downloaded from www.biolreprod.org. FIG. 6. Biomechanical properties of the vaginal wall. Maximal distention (A), maximal force generation at failure (B), and tissue stiffness (C) were determined in rings of vaginal tissues from ovariectomized rats treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2), systemic CEE (Sys CEE), or vaginal CEE at low, med, or (Hi) doses. Data represent mean 6 SEM of five to eight animals in each group; *P , 0.05 compared with Ctl.
interesting that the enzyme is also upregulated with estrogen treatment. Taken together, our data suggest that vaginal estrogen not only results in significant relief of epithelial atrophy, but also induces marked changes in matrix proteins, upregulation of genes important for collagen assembly, and increased distensibility of the vaginal wall. These studies indicate that lower doses of local estrogen therapy may be more beneficial than higher vaginal doses or systemic therapy.
4.
5.
6.
7.
REFERENCES 8.
1. Kerkhof MH, Hendriks L, Brolmann HA. Changes in connective tissue in patients with pelvic organ prolapse—a review of the current literature. Int Urogynecol J Pelvic Floor Dysfunct 2009; 20(4):461–474. 2. Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996; 347(9016):1658–1661. 3. Carley ME, Schaffer J. Urinary incontinence and pelvic organ prolapse in
9.
10.
8
women with Marfan or Ehlers Danlos syndrome. Am J Obstet Gynecol 2000; 182(5):1021–1023. DeLancey JO, Starr RA. Histology of the connection between the vagina and levator ani muscles. Implications for urinary tract function. J Reprod Med 1990; 35(8):765–771. Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA. Remodeling of vaginal connective tissue in patients with prolapse. Obstet Gynecol 2005; 106(5 Pt 1):953–963. Robinson D, Rainer RO, Washburn SA, Clarkson TB. Effects of estrogen and progestin replacement on the urogenital tract of the ovariectomized cynomolgus monkey. Neurourol Urodyn 1996; 15(3):215–221. Simon J, Nachtigall L, Gut R, Lang E, Archer DF, Utian W. Effective treatment of vaginal atrophy with an ultra-low-dose estradiol vaginal tablet. Obstet Gynecol 2008; 112(5):1053–1060. Clark AL, Slayden OD, Hettrich K, Brenner RM. Estrogen increases collagen I and III mRNA expression in the pelvic support tissues of the rhesus macaque. Am J Obstet Gynecol 2005; 192(5):1523–1529. Falconer C, Ekman-Ordeberg G, Ulmsten U, Westergren-Thorsson G, Barchan K, Malmstrom A. Changes in paraurethral connective tissue at menopause are counteracted by estrogen. Maturitas 1996; 24(3):197–204. Chen Y, Jin X, Zeng Z, Liu W, Wang B, Wang H. Estrogen-replacement therapy promotes angiogenesis after acute myocardial infarction by
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL
11. 12. 13.
14. 15. 16. 17.
18.
20. 21. 22.
23.
24. 25. 26. 27. 28.
29. 30.
31. 32. 33.
9
muscle defects and function in women with and without pelvic organ prolapse. Obstet Gynecol 2007; 109(2 Pt 1):295–302. Helvering LM, Adrian MD, Geiser AG, Estrem ST, Wei T, Huang S, Chen P, Dow ER, Calley JN, Dodge JA, Grese TA, Jones SA, et al. Differential effects of estrogen and raloxifene on messenger RNA and matrix metalloproteinase 2 activity in the rat uterus. Biol Reprod 2005; 72(4): 830–841. Hendrix SL, Clark A, Nygaard I, Aragaki A, Barnabei V, McTiernan A. Pelvic organ prolapse in the Women’s Health Initiative: gravity and gravidity. Am J Obstet Gynecol 2002; 186(6):1160–1166. Nygaard I, Bradley C, Brandt D. Pelvic organ prolapse in older women: prevalence and risk factors. Obstet Gynecol 2004; 104(3):489–497. Suzuki A, Enari M, Abe Y, Ohta Y, Iguchi T. Effect of ovariectomy on histological change and protein expression in female mouse reproductive tracts. In Vivo 1996; 10(1):103–110. Slayden OD, Hettrich K, Carroll RS, Otto LN, Clark AL, Brenner RM. Estrogen enhances cystatin C expression in the macaque vagina. J Clin Endocrinol Metab 2004; 89(2):883–891. Rahn DD, Good MM, Roshanravan SM, Shi H, Schaffer JI, Singh RJ, Word RA. Effects of preoperative local estrogen in postmenopausal women with prolapse: a randomized trial. J Clin Endocrinol Metab 2014; 99(10):3728–3736. Vedeckis WV, Ali M, Allen HR. Regulation of glucocorticoid receptor protein and mRNA levels. Cancer Res 1989; 49(8 Suppl):2295s–2302s. Hoeck W, Rusconi S, Groner B. Down-regulation and phosphorylation of glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum against a bacterially expressed receptor fragment. J Biol Chem 1989; 264(24):14396–14402. Medlock KL, Lyttle CR, Kelepouris N, Newman ED, Sheehan DM. Estradiol down-regulation of the rat uterine estrogen receptor. Proc Soc Exp Biol Med 1991; 196(3):293–300. Kim SW, Kim NN, Jeong SJ, Munarriz R, Goldstein I, Traish AM. Modulation of rat vaginal blood flow and estrogen receptor by estradiol. J Urol 2004; 172(4 Pt 1):1538–1543. Drewes PG, Yanagisawa H, Starcher B, Hornstra I, Csiszar K, Marinis SI, Keller P, Word RA. Pelvic organ prolapse in fibulin-5 knockout mice: pregnancy-induced changes in elastic fiber homeostasis in mouse vagina. Am J Pathol 2007; 170(2):578–589.
Article 43
Downloaded from www.biolreprod.org.
19.
enhancing SDF-1 and estrogen receptor expression. Microvasc Res 2009; 77(2):71–77. Li J, McMurray RW. Effects of cyclic versus sustained estrogen administration on peripheral immune functions in ovariectomized mice. Am J Reprod Immunol 2010; 63(4):274–281. Mannino CA, South SM, Inturrisi CE, Quinones-Jenab V. Pharmacokinetics and effects of 17beta-estradiol and progesterone implants in ovariectomized rats. J Pain 2005; 6(12):809–816. Lopez-Belmonte J, Nieto C, Estevez J, Delgado JL, Moscoso Del Prado J. Comparative uterine effects on ovariectomized rats after repeated treatment with different vaginal estrogen formulations. Maturitas 72(4): 353–358. Miller EJ, Rhodes RK. Preparation and characterization of the different types of collagen. Methods Enzymol 1982; 82(A):33–64. Smith P, Heimer G, Norgren A, Ulmsten U. Localization of steroid hormone receptors in the pelvic muscles. Eur J Obstet Gynecol Reprod Biol 1993; 50(1):83–85. Kurita T, Lee KJ, Cooke PS, Taylor JA, Lubahn DB, Cunha GR. Paracrine regulation of epithelial progesterone receptor by estradiol in the mouse female reproductive tract. Biol Reprod 2000; 62(4):821–830. Carley ME, Rickard DJ, Gebhart JB, Webb MJ, Podratz KC, Spelsberg TC. Distribution of estrogen receptors a and ß mRNA in mouse urogenital tissues and their expression after oophorectomy and estrogen replacement. Int Urogynecol J 2003; 14(2):141–145. Moalli PA, Talarico LC, Sung VW, Klingensmith WL, Shand SH, Meyn LA, Watkins SC. Impact of menopause on collagen subtypes in the arcus tendineous fasciae pelvis. Am J Obstet Gynecol 2004; 190(3):620–627. Baron YM, Galea R, Brincat M. Carotid artery wall changes in estrogentreated and -untreated postmenopausal women. Obstet Gynecol 1998; 91(6):982–986. Brincat M, Versi E, Moniz CF, Magos A, de Trafford J, Studd JW. Skin collagen changes in postmenopausal women receiving different regimens of estrogen therapy. Obstet Gynecol 1987; 70(1):123–127. Balgobin S, Montoya TI, Shi H, Acevedo JF, Keller PW, Riegel M, Wai CY, Word RA. Estrogen alters remodeling of the vaginal wall after surgical injury in guinea pigs. Biol Reprod 2013; 89(6):138. DeLancey JO, Morgan DM, Fenner DE, Kearney R, Guire K, Miller JM, Hussain H, Umek W, Hsu Y, Ashton-Miller JA. Comparison of levator ani
Effect of Vaginal or Systemic Estrogen on Dynamics of Collagen Assembly in the Rat Vaginal Wall1 T. Ignacio Montoya, P. Antonio Maldonado, Jesus F. Acevedo, and R. Ann Word2 Department of Obstetrics and Gynecology, Division of Female Pelvic Medicine and Reconstructive Surgery, University of Texas Southwestern Medical Center, Dallas, Texas
The objective of this study was to compare the effects of systemic and local estrogen treatment on collagen assembly and biomechanical properties of the vaginal wall. Ovariectomized nulliparous rats were treated with estradiol or conjugated equine estrogens (CEEs) either systemically, vaginal CEE, or vaginal placebo cream for 4 wk. Low-dose local CEE treatment resulted in increased vaginal epithelial thickness and significant vaginal growth without uterine hyperplasia. Furthermore, vaginal wall distensibility increased without compromise of maximal force at failure. Systemic estradiol resulted in modest increases in collagen type I with no change in collagen type III mRNA. Low-dose vaginal treatment, however, resulted in dramatic increases in both collagen subtypes whereas moderate and high dose local therapies were less effective. Consistent with the mRNA results, low-dose vaginal estrogen resulted in increased total and cross-linked collagen content. The inverse relationship between vaginal dose and collagen expression may be explained in part by progressive downregulation of estrogen receptor-alpha mRNA with increasing estrogen dose. We conclude that, in this menopausal rat model, local estrogen treatment increased total and cross-linked collagen content and markedly stimulated collagen mRNA expression in an inverse dose-effect relationship. High-dose vaginal estrogen resulted in downregulation of estrogen receptor-alpha and loss of estrogeninduced increases in vaginal collagen. These results may have important clinical implications regarding the use of local vaginal estrogen therapy and its role as an adjunctive treatment in women with loss of vaginal support. collagen, conjugated equine estrogen, estradiol, lysyl oxidase, pelvic organ prolapse
INTRODUCTION Like other matrix components, collagen undergoes continuous synthesis and degradation in the vaginal wall. Although turnover rates are low in other resting adult tissues, connective tissue remodeling is continuous in the vagina during reproductive life and is accentuated during pregnancy, parturition, and after menopause. Fibrillar collagens (collagen 1
This work was supported by NIH AG028048 and HD064824. Presented at the 32nd Annual Scientific Meeting of the American Urogynecologic Society, Chicago, IL, 3-6 October 2012. 2 Correspondence: R. Ann Word, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9032. E-mail: [email protected]
MATERIALS AND METHODS All the animals were handled and euthanized in accordance with the standards of humane animal care described by the National Institutes of Health Guide for the Care and Use of Laboratory Animals, using protocols approved by the Institutional Animal Care and Use Committee of the University of Texas Southwestern Medical Center at Dallas. A total of 37 virginal Sprague Dawley rats (Charles River Laboratories) at 12 wk of age were housed in Institutional Animal Care and Use Committee-approved facilities under a 12L:12D cycle at 228C.
Received: 17 February 2014. First decision: 6 April 2014. Accepted: 17 December 2014. Ó 2015 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363
1
Article 43
Downloaded from www.biolreprod.org.
types I, II, and III) are the predominant matrix components that contribute to tensile strength of the extracellular matrix, thereby playing an essential role in maintenance of vaginal support [1]. In women with pelvic organ prolapse, total collagen content is decreased in the vaginal wall compared with premenopausal controls [2], and women with connective tissue disorders experience high rates of pelvic organ prolapse [3]. Collagen also appears to play a key role in maintenance of normal urinary continence by imparting structural stability to the proximal urethra through the paraurethral connective tissue connections to the pelvic floor [4]. Tissue collagen content is dependent on the balance of its synthesis and degradation. It has been suggested that collagen metabolism shifts to a degradative state after menopause and in the setting of vaginal prolapse, with increased activity of endogenous matrix proteases [2, 5]. Furthermore, the proportion of the highly stable, mature, cross-linked collagen relative to immature precursor collagen molecules that are easily degraded influences tissue strength. It has been shown that the proportion of immature collagen is increased in women with prolapse [1]. Finally, the type of collagen influences connective tissue strength and helps tissue withstand stretch. The vaginal wall is made up of predominantly collagens types I and III secreted from fibroblasts and smooth muscle cells. Collagen type I confers the greater tensile strength. The role of estrogen therapy in the regulation of collagen homeostasis in the vaginal wall is poorly understood. In postmenopausal women, local estrogen is used commonly for treatment of vaginal atrophy symptoms, including vaginal dryness, dysuria, urethral discomfort, and stress urinary incontinence [6]. Local estrogen treatment increases vaginal epithelial thickness and promotes revascularization [7]. With regards to the vaginal subepithelium, Clark et al. [8] demonstrated increases in collagen mRNA expression after systemic estradiol (E2) treatment in a rhesus macaque model. Similarly, systemic estrogen replacement therapy in postmenopausal women resulted in increased mRNA expression of collagen I and III in paraurethral connective tissue [9]. The effects of local estrogen on connective tissue components, however, have been less well characterized. The purpose of this study was to use the rat as an animal model to compare the effects of systemic and local estrogen treatment on collagen content and expression of proteins involved in collagen assembly in the vaginal wall.
ABSTRACT
MONTOYA ET AL. calculated using Image J software (ImageJ 1.46r, NIH) and normalized to total protein loaded quantified on Coomassie-stained gels.
Treatment Groups All the animals underwent bilateral oophorectomy through 1 cm flank incisions. Two weeks after oophorectomy, animals were divided in five groups and treatments were applied as follows. For the systemic E2 (n ¼ 5) group, Alzet osmotic minipumps (Durect Corporation) delivering 50 lg E2/kg/day were inserted subcutaneously through a dorsal incision. The dose of systemic E2 was chosen based on previously published studies demonstrating similar serum estrogen levels to those of cycling rats (29–71 pg/ml) [10–12]. Systemic conjugated equine estrogens (CEEs) (n ¼ 8) was delivered orally per gavage (2.6 lg/day, approximating 0.625 mg/day for women). For the local estrogen groups, CEE cream (Pfizer Pharmaceuticals) was delivered vaginally at three different doses—62.5, 6.25, and 625 ng CEE per dose, delivered in 100 mg of cream and termed high (n ¼ 6), medium (n ¼ 6), and low (n ¼ 6) dose, respectively—with daily vaginal applications for 1 wk, followed by three applications per week for three additional weeks. The placebo group (n ¼ 6) received vaginal applications of a placebo cream in 100 mg cream doses following the same schedule as the CEE treatment groups. Vaginal CEE dosing was calculated utilizing weight-based comparisons with human dosage as previously published in similar studies [13]. The usual vaginal maintenance dose (1 g cream) in a 60 kg woman delivers 625 lg CEEs. By weight comparison, this translates into a 4.2 lg CEE dose in a 400 g animal. For dilutional simplicity, we selected a dose of 6.25 lg CEEs as our medium dose with 10-fold differences for our high (62.5 lg) and low (625 ng) doses, respectively. Vaginal treatments were delivered using a 1 ml syringe. After each vaginal application, topical benzoin was applied to the vulva to deter ingestion of the cream.
Biomechanical Testing Each vaginal ring was suspended between two stainless steel wire mounts and attached to a steel rod apparatus with a calibrated mechanical drive and to a force transducer. Tissues were maintained in a physiologic salt solution in water baths at 378C with 95% O2 and 5% CO2. After acclimation for 15 min, each ring was equilibrated to slack length (ring diameter at resting tone) as measured by the calibrated mechanical drive. Rings were distended in 1 mm increments with 30-sec intervals between each increment to allow stabilization of forces before each subsequent distention. This process was continued until failure (ring breakage) or until plateau of force generation. Wet weights of vaginal rings were determined after testing. Stress (N/m2) was calculated as maximum force per unit area and plotted against strain (change in length divided by slack length), producing a sigmoid-shaped curve. Elasticity, an index of tissue stiffness, was calculated from the slope of the linear portion of the curve.
Histomorphology
Tissue Processing After 4 wk of treatment, the animals were euthanized. The abdominal cavity was opened, the pubic symphysis disarticulated, and the uterine horns, bladder, cervix, and vagina dissected down to the perineal skin. Using microsurgical instruments and a dissection microscope, the perineal skin was removed and the bladder and urethra separated from the anterior vaginal wall. The uterine horns and cervix were removed from the vaginal tube. Gross weights of the pelvic organs were obtained. An upper vaginal ring was excised and submitted for biomechanical testing. An additional vaginal ring was excised and submitted for histologic processing. The remainder of the vaginal tube was opened longitudinally, the epithelium scraped off using a scalpel, and the remaining vaginal stroma snap-frozen in liquid nitrogen and stored at 808C.
Hydroxyproline Assay Collagen solubility measurements were used as an index of collagen structure within the tissue [14]. Weights of vaginal tissues were determined before and after lyophilization. Lyophilized tissue was homogenized with 1 M NaOH with PIs at 48C for 24 h, centrifuged, and the supernatant was saved as fraction A (newly synthesized, noncross-linked collagen fraction). The remaining residue was washed with water plus PIs and extracted with 0.5 M acetic acid plus PIs at 48C for 24 h with rotation. Samples were centrifuged, and the supernatant saved as fraction B (denatured mature collagen). The remaining tissue pellet was saved as fraction C (mature, cross-linked collagen). Collagen content in each fraction was determined by measurement of hydroxyproline content by the chloramine [13]-T method after overnight hydrolysis in 6 M HCl at 1008C. Hydroxyproline values were converted to collagen (3 7.6) and normalized to tissue wet weight.
Protein Extraction Frozen vaginal tissue was pulverized with a liquid nitrogen-chilled mortar and pestle. Tissue powder was then homogenized in basic buffer containing protease inhibitors (PIs)—16 mM potassium phosphate, pH 7.8, 0.12 M NaCl, 1 mM ethylenediaminetetraacetic acid, 0.1 mM phenylmethylsulfonyl fluoride, 10 lg/ml pepstatin A, and 10 lg/ml leupeptin)—and centrifuged at 10 000 3 g. The supernatant was then removed, and the previous homogenization step repeated after resuspending the remaining tissue pellet in basic buffer. After removal of the second supernatant, the remaining tissue pellet was suspended in 6.0 M urea in the above basic buffer, homogenized, and placed on a rotating rack for overnight extraction at 48C. The samples were then centrifuged (10 000 3 g for 30 min), and the supernatant removed. Protein concentrations were determined using a bicinchoninic acid protein assay with standard curves of bovine serum albumin in appropriate buffers.
Real-Time Quantitative PCR Quantitative PCR was used to determine the relative levels of mRNAs in vaginal tissues. Tissues were pulverized and homogenized in Trizol reagent (Invitrogen). RNA was isolated according to manufacturer’s protocol. Complementary DNA synthesis was carried out with 2 lg of total RNA in a reaction volume of a 20 ll. Each reaction contained 10 mM dithiothreitol, 0.5 mM deoxynucleotide triphosphates (dNTPs), 0.015 lg/ll random primers, 40 units RNase inhibitor (Invitrogen), and 200 units reverse transcriptase (Invitrogen). PCR reactions were carried out in the ABI Prism 7000 sequence-detection system (Applied Biosystems). The reverse transcription product from 50 ng RNA was used as the template, and reaction volumes (30 ll) contained Master Mix (Applied Biosystems). Primer concentrations were 900 nM. Cycling conditions were 2 min at 508C, followed by 10 min at 958C, then 40 cycles of 15 sec at 958C and 1 min at 608C. SYBR Green was used for amplicon detection. Gene expression was normalized to expression of the housekeeping gene, cyclophilin A (CYPA), which was invariant among samples. A preprogrammed dissociation protocol was used after amplification to ensure that all the samples exhibited a single amplicon. Levels of mRNA were determined using the DCt method (Applied Biosystems) and expressed relative to an external calibrator present on each plate. Primers used in this study are listed in Table 1. All the primer sets were tested to ensure that efficiency of amplification over a wide range of template concentrations was equivalent to that of CYPA.
Immunoblot Analysis Urea-extracted protein samples (10 lg/lane) were applied to 4%–20% gradient polyacrylamide gels (Bio-Rad), separated by electrophoresis, and transferred to nitrocellulose membranes. Identical gels were run side-by-side and Commassie blue-stained for protein loading comparison among the samples. After protein transfer, membranes were treated with blocking buffer, tris (hydroxymethyl) aminomethane 0.01 M, NaCl 0.15 M, Tween 20, 0.1%, pH 7.4 (TBS-T) with 2.5% nonfat milk for 1 h. An affinity-purified rabbit antibody against human lysyl oxidase (LOX) was generated using a pro-LOX peptide (NH2-182GCPYYNYYDTYERPRPG96-OH) that is conserved between mouse, rat, and human LOX. Membranes were incubated in primary antibody (1:1000 dilution) for 90 min at 378C and then serially washed with TBS-T, followed by treatment with secondary antibody (goat immunoglobulin G antirabbit, 1:8000) at room temperature for 1 h. Membranes were serially washed with TBS-T and subsequently incubated with Western Lightning Chemiluminescence Reagent Plus (Perkin-Elmer) for 2 min. Signal strength was captured using a Fujifilm FLA 5100 image capture system. Protein band density was
2
Article 43
Downloaded from www.biolreprod.org.
Vaginal rings were fixed in neutral buffer formalin (10%). Tissues were subsequently processed and embedded in paraffin blocks. Cross-sections of each vaginal ring were stained with hematoxylin and eosin as well as Masson trichrome stain. Images of each section were captured and analyzed using a Nikon E1600 microscope and Nikon NIS Elements AR software. Briefly, the mean of at least six measurements from the lumen cell surface to the basement membrane were quantified for each specimen. Likewise the distance, in lm, between the basement membrane and edge of the muscular bundles was determined as the mean of 6–10 measurements per specimen. Thickness of the muscularis (muscle bundles between the lamina propria and adventitia) was quantified as the mean of 6–10 measurements throughout the specimen.
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL TABLE 1. Primers used for amplification of mRNA in this study. Forward primersa
Reverse primersa
Accession no.
AATGCTGGACCAAACACAAATG (346–367) CTTGGAGCCCTGGGATATCAAG (2568–2589) CGATGGCGTGCTATGCAA (278–295) GTGTCTGCGACTCGGGATCT (265–284) TGGCACCGGTTACTTCCAGTA (909–929) CTTCAGCTCCACAGAGAAGAACTG (1000–1023) GCTGCGCAAGTGTTACGAAG (811–831) GAGGGCAATGATGTGTGCAA (2046–2065)
CCATCCAGCCACTCAGTCTTG (413–393) AACACCGGCCTTCTCTTTCACT (2633–2612) CTGCGTCTGGTGATACATATTCTTCT (381–356) GGAATGACAGGAGCAGGTGTAGA (403–381) ACGTGGATGCCTGGATGTAGT (959–929) TCCAACCCAGGTCCTTCCTA (1070–1051) TCTTTTCGTATCCCGCCTTTC (862–841) GAGTCCGCTGCGCACCT (2096–2080)
NM017101.1 BC085910 BC133728.1 BC087039.1 NM_017061.2 BC076380.1 X61098.1 NM_031323.1
Gene rCPHA rELASTIN rCOLA1 rCOLA3 rLOX rTGFB1 rERa rBMP1 a
Numbers in parenthesis represent nucleotide sequence according to accession number.
One-way analysis of variance (ANOVA) and nonparametric (Kruskal Wallis) testing was performed, as appropriate, for multiple group comparisons. With P , 0.05 significance, posttesting between groups was performed using Dunnett test for normally distributed data and Dunn tests for nonparametric distributions with placebo designated as the control group. Data are presented as mean 6 SEM.
RESULTS Effect of Vaginal CEE on Uterine and Vaginal Weight Because CEE contains E2, estrone, and approximately eight (conjugated) equine estrogens, it was not practical to measure serum levels of all the potential estrogenic compounds in the serum. Thus, increased uterine weight was considered an index of biological estrogen activity. Systemic therapy with CEE did not result in increased uterine weight (Fig. 1A). In contrast, high-dose vaginal CEE increased uterine weight significantly while vaginal low- or medium-dose treatment did not (Fig. 1A). Furthermore, endometrial growth was absent in uterine tissues from animals treated with low-dose CEE (not shown). Interestingly, although low-dose vaginal treatment did not increase uterine weight, vaginal weight increased significantly after low-dose, but not medium- or high-dose, vaginal CEE treatment (Fig. 1B). Because CEEs have relatively low affinity for estrogen receptors (ERs), the effect of systemic E2 was also studied. As expected, systemic E2 exhibited the most dramatic effect on uterine weight (.6-fold). Histologic analyses of sections of the vaginal wall from ovariectomized animals treated with placebo, systemic CEE, or vaginal low-dose CEE are shown in Figure 2. After ovariectomy, vaginal epithelium was reduced to a single layer. Lamina propria, muscularis, and adventitial layers were observed (Fig. 2Aa). Vessels were limited to the adventitial layer with a few small perforating vessels in the lamina propria. Whereas epithelial thickness was not increased significantly after systemic CEE treatment, the epithelial cells were polarized, filled with vacuoles, and secreting mucus (Fig. 2Ab). Vaginal CEE treatment resulted in marked increases in epithelial thickness. Grossly, multiple vessels perforated the lamina propria (Fig. 2Ac). Quantification of epithelial, lamina propria, and muscularis thickness revealed that local administration of vaginal CEE resulted in increased epithelial thickness, but other layers were unchanged (Fig. 2B) except for the appearance of increased collagen density of the systemic CEE vagina (Fig. 2Ab).
Collagen mRNA To determine the mechanisms by which local CEE treatment resulted in increased total and cross-linked collagen in the vaginal wall, levels of collagen type I and III mRNA were quantified. Whereas systemic CEE had no significant effect on collagen type I mRNA for 4 wk, local CEE treatment resulted in increased expression of both types of collagen in an inverse dose-response manner (Fig. 3). Low-dose treatment resulted in 4-fold increases in Col1a and 8-fold increases in Col3a gene expression, whereas high dose vaginal CEE was ineffective. Surprisingly, low-dose vaginal therapy resulted in more dramatic changes in collagen mRNA than systemic E2, which resulted in 2-fold increases in Col1a with no change in Col3a (Fig. 3). In contrast with collagen, tropoelastin gene expression was not altered by local or systemic estrogen treatment (data not shown). Because transforming growth factor b-1 (TGFb1) is known to increase collagen synthesis in mesenchymal cells and regulate expression of the major collagen cross-linking enzyme (LOX), TGFb1 mRNA levels were also analyzed in the vaginal wall after estrogen treatment. Whereas other treatment regimens had no effect, low-dose vaginal CEE resulted in increased TGFb1 mRNA (Fig. 4A). BMP-1 (i.e., procollagen peptidase) and LOX are two enzymes important in processing procollagen to mature collagen fibers. BMP-1 cleaves procollagens and pro-LOX into the mature enzyme in the extracellular space. To gain insight into potential mechanisms by which estrogen affects collagen processing in the vagina, the effect of estrogen treatment on vaginal BMP-1 mRNA and LOX mRNA and protein were determined (Fig. 4). Both systemic and vaginal CEE resulted in 2- to 4-fold increases in BMP-1 mRNA (not shown). Surprisingly, and consistent with CEE-induced changes in mature collagen, low-dose vaginal CEE and systemic CEE increased LOX mRNA. Using immunoblot analysis, pro-LOX, but not mature LOX, was detected with our antibody that preferentially recognized the pro-LOX form (Fig. 4C). Immunoblot analysis was conducted with urea-extracted proteins from the vaginal wall of animals treated with placebo, systemic E2, or local CEE using placebo
Effect of Vaginal CEE Treatment on Collagen Content in the Vaginal Wall Collagen content of the vaginal muscularis was quantified from animals treated with control, systemic CEE, systemic E2, 3
Article 43
Downloaded from www.biolreprod.org.
and local CEE. Data were expressed as lg/mg dry weight and, to account for increased organ size, lg/ vagina (Table 2). Although the collagen content per lg dry weight was similar in all the treatment groups, the amount of cross-linked collagen was increased in muscularis from animals treated with systemic E2. In addition, the fraction of cross-linked collagen was increased significantly in muscularis from animals treated with systemic E2 as well as animals receiving either low- or medium-dose vaginal CEE treatment. Interestingly, the total amount of collagen per vagina was increased significantly in low-dose, but not medium- or high-dose, intravaginal CEE treatment (Table 2).
Statistical Analysis
MONTOYA ET AL.
FIG. 1. Effect of systemic or local estrogen on uterine and vaginal wet weight. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2) by osmotic minipumps (50 lg/kg/d), oral conjugated equine estrogens (Sys CEE), or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk of treatment, uterine (A) or vaginal (B) tissues were harvested and weighed. Data represent mean 6 SEM of five to eight rats per group; *P , 0.05 compared with Ctl.
Downloaded from www.biolreprod.org. FIG. 2. Effect of systemic or local estrogen on histomorphology of the vaginal wall. A) Representative sections of tissues obtained from the upper third of the vagina in control (Ctl, placebo vaginal cream), systemic CEE, or vaginal CEE (0.625 lg/dose). Sections were stained with Masson trichrome stain. epi, epithelium; l.p., lamina propria; m, muscularis; adv, adventitia. Arrow denotes mucin-laden epithelial cells with systemic CEE. Bar ¼ 200 lm. B) Morphometric measurements of thickness of the vaginal wall, epithelium, lamina propria, or muscularis. Data represent mean 6 SEM of five to eight rats in each group; *P , 0.05 compared with Ctl.
4
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL TABLE 2. Effect of systemic or vaginal estrogen and collagen (Coll) content of the vaginal wall.a Treatmentb Control Sys CEE Sys E2 Vag CEE Low Vag CEE Med Vag CEE High
Total coll (lg/mg dry wt) 432 317 452 347 296 327
6 6 6 6 6 6
36.7 33.1 49.8 34.3 26.9 63.5
Cross-linked (lg/mg dry wt) 35.6 26.9 61 49.6 38.2 26.9
6 6 6 6 6 6
3.2 2.8 4.3* 3.8 2.3 6.1
Cross-linked (%) 8.1 8.5 13.5 14.3 12.8 8.3
6 6 6 6 6 6
0.8 0.8 0.6* 0.5* 0.3* 1.0
Total coll (lg/vagina) 13.3 15.1 18.3 20.9 13.1 12.0
6 6 6 6 6 6
0.2 1.0 0.4* 1.0* 1.5 1.7
Cross-linked (lg/vagina) 2.1 2.9 5.8 4.3 2.0 2.6
6 6 6 6 6 6
0.5 0.2 0.9* 0.8 0.6 0.6
a
Data represent mean 6 SEM of six to eight animals in each group. Sys CEE, systemic CEE treatment; Sys E2, systemic E2 treatment; Vag CEE Low, vaginal CEE low-dose treatment; Vag CEE Med, vaginal CEE medium-dose treatment; Vag CEE High, vaginal CEE high-dose treatment. *P , 0.05 compared with control. b
as controls on each blot for comparisons. As noted in Figure 4C, systemic E2 and local CEE increased pro-LOX protein. In contrast to collagen and TGFb mRNA, however, LOX tended to rise with increasing dose of vaginal estrogen, with high-dose estrogen approaching that of systemic E2.
Effect of Systemic and Vaginal Estrogen on Biomechanical Properties of the Vaginal Wall Next, we sought to determine if changes in collagen content and LOX resulted in functional effects in the biomechanical properties of the vagina. Maximal distention of vaginal rings from ovariectomized rats treated with or without systemic or local CEE was similar (i.e., ;4–5 mm) (Fig. 6A). Furthermore, the maximal force generated in response to increasing stretch was not different among the treatment groups (Fig. 6B). In contrast, local and systemic estrogen treatment (either CEE or E2) resulted in increased vaginal wall distensibility (i.e., decreased stiffness) compared with controls (Fig. 6C). Thus, estrogen treatment regardless of route, compound, or dose resulted in increased distensibility of the vaginal wall without compromise of strength.
Effect of Systemic and Vaginal Estrogen on ERa mRNA The inverse dose-response relationship between vaginal CEE and collagen content in the vaginal wall was puzzling. Furthermore, it was surprising that systemic CEE or E2 treatment was sometimes less effective than that of low-dose vaginal CEE. To examine the possibility that the major ER of the vagina (i.e., ERa) may be affected by different routes and doses of estrogen, ERa mRNA was determined in the vaginal muscularis with or without estrogen therapy (Fig. 5). ERa expression was similar in vaginal muscularis from control- and systemic E2-treated ovariectomized rats. Interestingly, systemic CEE and low-dose vaginal CEE treatments, however, resulted in significant (3-fold) upregulation of vaginal ERa, which was downregulated with increasing doses of vaginal CEE.
DISCUSSION Reproductive hormones may play an important role in the maintenance of connective tissues and extracellular matrix necessary for pelvic visceral support. Estrogen and progesterone receptors have been identified in the nuclei of connective tissue and smooth muscle cells of the levator ani stroma [15], uterosacral ligaments, and vaginal wall [16, 17]. The ratio of 5
Article 43
Downloaded from www.biolreprod.org.
FIG. 3. Effect of systemic and local estrogen on collagen types I and III mRNA in the vagina. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2 by osmotic minipumps (50 lg/kg/day) (Sys E2), systemic CEE, or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk, RNA was isolated from the stroma and muscularis, and the relative mRNA levels of collagen type I (ColA1, A) and collagen type III (ColA3, B) mRNA were quantified. *P , 0.05 compared with Ctl.
MONTOYA ET AL.
Downloaded from www.biolreprod.org. FIG. 4. Regulation of TGFb1 and LOX in the vaginal wall. Ovariectomized rats were treated with control (Ctl, placebo vaginal cream), systemic E2, systemic CEE, or vaginal CEE at 0.625 (low), 6.25 (med), or 62.5 (Hi) lg doses as described in Materials and Methods. After 4 wk, RNA was isolated from the stroma/muscularis, and the relative mRNA levels of TGFb1 (A) and LOX (B) were quantified. C) Immunoblot analysis of LOX in urea extracts. Representative immunoblot provided in the inset with vaginal Hi dose. Urea-extracted protein (10 lg/lane) was applied in each lane and probed with an antibody that preferentially recognizes pro-LOX (;55 kDa). Coomassie-stained gel was used to normalize immunoreactive protein density. Data represent mean 6 SEM of relative signal intensities from five to six animals in each group; *P , 0.05 compared with Ctl.
collagen I (generally consisting of well-organized fibers and associated with ligamentous tissue) to collagen III and IV (more common in skin, blood vessels, and muscle) is decreased in pelvic connective tissues of postmenopausal women without hormone replacement therapy [18]. This relative decrease in well-organized dense collagen is believed to contribute to weakening of vaginal wall tensile strength, thereby leading to increased susceptibility to anterior wall prolapse. Thus, menopause and loss of estrogen may lead to decompensation of pelvic organ support. Although there is little doubt that estrogen improves the vaginal epithelial layer [6], it is unclear whether hormonal
therapy alleviates, worsens, or has no effect on connective tissues that support the pelvic viscera. Furthermore, the differences between local and systemic estrogen therapy are unknown. Here, we used a preclinical ovariectomized rat model to find that low-dose vaginal CEE results in 1) increased vaginal weight, 2) increased total and mature collagen content, 3) increased expression of collagen-processing enzymes, LOX and BMP-1, and 4) increased distensibility of the vaginal wall. Importantly, low-dose vaginal CEE was more effective than systemic CEE. Low-dose vaginal CEE was also superior to medium doses, which was calculated utilizing weight-based comparisons with human dosage equivalence. Although this 6
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL
and thereby result in a net increase in collagen content. Nevertheless, low-dose vaginal treatment with CEE resulted in robust increases in both collagen types I and III mRNA with a disproportionate increase in Col3a. Differential Effects of Systemic and Low-Dose Vaginal CEE Treatments Although systemic CEE increased vaginal weight, systemic CEE did not increase vaginal collagen appreciably. LOX mRNA was increased by systemic CEE. Furthermore, although systemic CEE resulted in increased mucus-producing epithelial cells, epithelial thickness was not increased as observed with vaginal CEE. This finding is in agreement with the overall clinical impression of many gynecologists that local estrogen is superior to systemic estrogen in terms of relief of vaginal atrophy. Our results indicate that vaginal CEE is also superior to systemic CEE in terms of vaginal collagen, suggesting that vaginal CEE may serve to improve the vaginal matrix prior to reconstructive surgery for prolapse [28].
FIG. 5. Effect of systemic and vaginal estrogen on ERa gene expression in the vaginal stroma/muscularis. RNA was isolated from stroma/muscularis of ovariectomized rats treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2), systemic CEE (Sys CEE), or vaginal CEE at low, medium, or high doses as described in Materials and Methods. Relative ERa mRNA was determined by quantitative PCR. Data represent mean 6 SEM of five to eight animals in each group; *P , 0.05 compared with Ctl.
Biomechanics of the Vaginal Wall
dosing regimen may not be precisely equivalent to human vaginal absorption and effects, the results suggest that lower doses of vaginal CEE may be more effective than the current recommendation. Vaginal Weight For decades, increased uterine weight in immature or ovariectomized rats has been used as a sensitive reliable indicator of estrogen effects. Here, we found that vaginal CEE also resulted in uterine prolific effects depending on dose. Although low-dose vaginal CEE treatment caused significant increases in vaginal wet weight, uterine weight was unchanged, suggesting that this dose of local therapy has no systemic absorption. It is well-accepted that long-term use of unopposed CEEs can result in endometrial proliferation and adenocarcinoma of the endometrium. In our study, we did not observe an increase of uterine weight or uterine prolific effects with systemic CEE. Thus, our conclusions are limited to this animal model during this time frame. Nonetheless, the results indicate that low-dose vaginal CEE has a significant effect on vaginal, but not uterine, weight during short-term use. Vaginal Collagen Content Systemic E2 and low-dose vagina CEE treatments resulted in significant increases in vaginal collagen. These findings agree with studies in postmenopausal women in which estrogen supplementation increases collagen content of the skin, vasculature, and pelvic tissues [18–20]. The results also agree with our work in guinea pigs in which systemic E2 also increased growth and collagen content of the vagina [21]. Other studies, however, suggest that estrogen may have negative effects on pelvic support [22–25]. In this study, although systemic E2 resulted in increased collagen content of the vaginal wall, collagen types I and III mRNA levels were not increased 4 wk after treatment. We did not conduct a detailed time course of the effects of estrogen. It is likely that systemic E2 resulted in an initial increase in collagen mRNA that subsided as ERa was downregulated with time. Alternatively, systemic E2 may inhibit collagen degradation [26, 27] 7
Article 43
Downloaded from www.biolreprod.org.
Interestingly, both systemic and vaginal CEE at low, medium, and high doses had a significant impact on the biomechanical properties of the vaginal wall with substantial decreases in vaginal stiffness and no change in maximal strength at failure. Although increases in collagen content are most associated with increased stiffness, this parameter is also known to be altered by collagen subtypes, differences in proteoglycans, tissue hydration, and elastic fibers. The magnitude of estrogen-induced increases in ColA3 was greater than that of ColA1 in low-dose vaginal treatment, which may contribute to the profound decrease in vaginal stiffness in this group. However, decreases in vaginal stiffness did not correlate with changes in Cola1 or Cola3 in systemic CEE or medium/ high vaginal doses. Thus, estrogen-induced decreases in vaginal stiffness may be related to factors other than collagen content, including collagen organization through collagenbinding proteoglycans, glycosaminoglycans, or elastic fibers. This possibility is now under investigation. Downregulation of ERa correlated with decreased efficacy of higher doses of estrogen in terms of collagen mRNA, total collagen content, distensibility, and activation of TGFb1 gene expression. Homologous downregulation of hormone receptors by their ligands has been reported [29, 30]. Medlock et al. [31] demonstrated uterine ER downregulation with high doses of systemic E2. Similar to our findings, Carley et al. [17] also demonstrated that vaginal ER was downregulated with systemic E2 and that responses to treatment differed among uterus, vagina, and bladder. Kim et al. [32], however, showed increased ER binding in ovariectomized rats treated with subphysiological doses of systemic E2. Our findings of marked upregulation of ERa with low-dose local CEE or systemic CEE are in agreement with these studies and suggest that upregulation of ER may be a compensatory mechanism to optimize estrogen-mediated effects when plasma E2 concentration is low. Increases in collagen mRNA and TGFb1 gene expression may or may not be related to ER levels and may be direct or indirect targets. Interestingly, LOX mRNA was increased in the vaginal muscularis after systemic or local CEE therapy for 4 wk. LOX protein was upregulated after vaginal CEE and systemic E2 treatments. Although we have previously shown that LOX is upregulated in the postpartum vagina in rats, which may act to resynthesize matrix molecules after parturition [33], it is also
MONTOYA ET AL.
Downloaded from www.biolreprod.org. FIG. 6. Biomechanical properties of the vaginal wall. Maximal distention (A), maximal force generation at failure (B), and tissue stiffness (C) were determined in rings of vaginal tissues from ovariectomized rats treated with control (Ctl, placebo vaginal cream), systemic E2 (Sys E2), systemic CEE (Sys CEE), or vaginal CEE at low, med, or (Hi) doses. Data represent mean 6 SEM of five to eight animals in each group; *P , 0.05 compared with Ctl.
interesting that the enzyme is also upregulated with estrogen treatment. Taken together, our data suggest that vaginal estrogen not only results in significant relief of epithelial atrophy, but also induces marked changes in matrix proteins, upregulation of genes important for collagen assembly, and increased distensibility of the vaginal wall. These studies indicate that lower doses of local estrogen therapy may be more beneficial than higher vaginal doses or systemic therapy.
4.
5.
6.
7.
REFERENCES 8.
1. Kerkhof MH, Hendriks L, Brolmann HA. Changes in connective tissue in patients with pelvic organ prolapse—a review of the current literature. Int Urogynecol J Pelvic Floor Dysfunct 2009; 20(4):461–474. 2. Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996; 347(9016):1658–1661. 3. Carley ME, Schaffer J. Urinary incontinence and pelvic organ prolapse in
9.
10.
8
women with Marfan or Ehlers Danlos syndrome. Am J Obstet Gynecol 2000; 182(5):1021–1023. DeLancey JO, Starr RA. Histology of the connection between the vagina and levator ani muscles. Implications for urinary tract function. J Reprod Med 1990; 35(8):765–771. Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA. Remodeling of vaginal connective tissue in patients with prolapse. Obstet Gynecol 2005; 106(5 Pt 1):953–963. Robinson D, Rainer RO, Washburn SA, Clarkson TB. Effects of estrogen and progestin replacement on the urogenital tract of the ovariectomized cynomolgus monkey. Neurourol Urodyn 1996; 15(3):215–221. Simon J, Nachtigall L, Gut R, Lang E, Archer DF, Utian W. Effective treatment of vaginal atrophy with an ultra-low-dose estradiol vaginal tablet. Obstet Gynecol 2008; 112(5):1053–1060. Clark AL, Slayden OD, Hettrich K, Brenner RM. Estrogen increases collagen I and III mRNA expression in the pelvic support tissues of the rhesus macaque. Am J Obstet Gynecol 2005; 192(5):1523–1529. Falconer C, Ekman-Ordeberg G, Ulmsten U, Westergren-Thorsson G, Barchan K, Malmstrom A. Changes in paraurethral connective tissue at menopause are counteracted by estrogen. Maturitas 1996; 24(3):197–204. Chen Y, Jin X, Zeng Z, Liu W, Wang B, Wang H. Estrogen-replacement therapy promotes angiogenesis after acute myocardial infarction by
Article 43
LOCAL ESTROGEN EFFECTS ON THE VAGINAL WALL
11. 12. 13.
14. 15. 16. 17.
18.
20. 21. 22.
23.
24. 25. 26. 27. 28.
29. 30.
31. 32. 33.
9
muscle defects and function in women with and without pelvic organ prolapse. Obstet Gynecol 2007; 109(2 Pt 1):295–302. Helvering LM, Adrian MD, Geiser AG, Estrem ST, Wei T, Huang S, Chen P, Dow ER, Calley JN, Dodge JA, Grese TA, Jones SA, et al. Differential effects of estrogen and raloxifene on messenger RNA and matrix metalloproteinase 2 activity in the rat uterus. Biol Reprod 2005; 72(4): 830–841. Hendrix SL, Clark A, Nygaard I, Aragaki A, Barnabei V, McTiernan A. Pelvic organ prolapse in the Women’s Health Initiative: gravity and gravidity. Am J Obstet Gynecol 2002; 186(6):1160–1166. Nygaard I, Bradley C, Brandt D. Pelvic organ prolapse in older women: prevalence and risk factors. Obstet Gynecol 2004; 104(3):489–497. Suzuki A, Enari M, Abe Y, Ohta Y, Iguchi T. Effect of ovariectomy on histological change and protein expression in female mouse reproductive tracts. In Vivo 1996; 10(1):103–110. Slayden OD, Hettrich K, Carroll RS, Otto LN, Clark AL, Brenner RM. Estrogen enhances cystatin C expression in the macaque vagina. J Clin Endocrinol Metab 2004; 89(2):883–891. Rahn DD, Good MM, Roshanravan SM, Shi H, Schaffer JI, Singh RJ, Word RA. Effects of preoperative local estrogen in postmenopausal women with prolapse: a randomized trial. J Clin Endocrinol Metab 2014; 99(10):3728–3736. Vedeckis WV, Ali M, Allen HR. Regulation of glucocorticoid receptor protein and mRNA levels. Cancer Res 1989; 49(8 Suppl):2295s–2302s. Hoeck W, Rusconi S, Groner B. Down-regulation and phosphorylation of glucocorticoid receptors in cultured cells. Investigations with a monospecific antiserum against a bacterially expressed receptor fragment. J Biol Chem 1989; 264(24):14396–14402. Medlock KL, Lyttle CR, Kelepouris N, Newman ED, Sheehan DM. Estradiol down-regulation of the rat uterine estrogen receptor. Proc Soc Exp Biol Med 1991; 196(3):293–300. Kim SW, Kim NN, Jeong SJ, Munarriz R, Goldstein I, Traish AM. Modulation of rat vaginal blood flow and estrogen receptor by estradiol. J Urol 2004; 172(4 Pt 1):1538–1543. Drewes PG, Yanagisawa H, Starcher B, Hornstra I, Csiszar K, Marinis SI, Keller P, Word RA. Pelvic organ prolapse in fibulin-5 knockout mice: pregnancy-induced changes in elastic fiber homeostasis in mouse vagina. Am J Pathol 2007; 170(2):578–589.
Article 43
Downloaded from www.biolreprod.org.
19.
enhancing SDF-1 and estrogen receptor expression. Microvasc Res 2009; 77(2):71–77. Li J, McMurray RW. Effects of cyclic versus sustained estrogen administration on peripheral immune functions in ovariectomized mice. Am J Reprod Immunol 2010; 63(4):274–281. Mannino CA, South SM, Inturrisi CE, Quinones-Jenab V. Pharmacokinetics and effects of 17beta-estradiol and progesterone implants in ovariectomized rats. J Pain 2005; 6(12):809–816. Lopez-Belmonte J, Nieto C, Estevez J, Delgado JL, Moscoso Del Prado J. Comparative uterine effects on ovariectomized rats after repeated treatment with different vaginal estrogen formulations. Maturitas 72(4): 353–358. Miller EJ, Rhodes RK. Preparation and characterization of the different types of collagen. Methods Enzymol 1982; 82(A):33–64. Smith P, Heimer G, Norgren A, Ulmsten U. Localization of steroid hormone receptors in the pelvic muscles. Eur J Obstet Gynecol Reprod Biol 1993; 50(1):83–85. Kurita T, Lee KJ, Cooke PS, Taylor JA, Lubahn DB, Cunha GR. Paracrine regulation of epithelial progesterone receptor by estradiol in the mouse female reproductive tract. Biol Reprod 2000; 62(4):821–830. Carley ME, Rickard DJ, Gebhart JB, Webb MJ, Podratz KC, Spelsberg TC. Distribution of estrogen receptors a and ß mRNA in mouse urogenital tissues and their expression after oophorectomy and estrogen replacement. Int Urogynecol J 2003; 14(2):141–145. Moalli PA, Talarico LC, Sung VW, Klingensmith WL, Shand SH, Meyn LA, Watkins SC. Impact of menopause on collagen subtypes in the arcus tendineous fasciae pelvis. Am J Obstet Gynecol 2004; 190(3):620–627. Baron YM, Galea R, Brincat M. Carotid artery wall changes in estrogentreated and -untreated postmenopausal women. Obstet Gynecol 1998; 91(6):982–986. Brincat M, Versi E, Moniz CF, Magos A, de Trafford J, Studd JW. Skin collagen changes in postmenopausal women receiving different regimens of estrogen therapy. Obstet Gynecol 1987; 70(1):123–127. Balgobin S, Montoya TI, Shi H, Acevedo JF, Keller PW, Riegel M, Wai CY, Word RA. Estrogen alters remodeling of the vaginal wall after surgical injury in guinea pigs. Biol Reprod 2013; 89(6):138. DeLancey JO, Morgan DM, Fenner DE, Kearney R, Guire K, Miller JM, Hussain H, Umek W, Hsu Y, Ashton-Miller JA. Comparison of levator ani
