Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep
Effects of aescin on cytochrome P450 enzymes in rats$ Yi Huang a, Shuang-li Zheng b, Hai-yan Zhu c, Zhi-sheng Xu b,nn, Ren-ai Xu c,n a b c
Wenzhou People’s Hospital, Wenzhou 325000, China The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China The First Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China
art ic l e i nf o
a b s t r a c t
Article history: Received 18 July 2013 Received in revised form 24 September 2013 Accepted 10 November 2013
Ethnopharmacological relevance: Aescin, the main active component found in extracts of horse chestnut (Aesculus hippocastanum) seed a traditional medicinal herb, is a mixture of triterpene saponins. It has been shown to be effective in inflammatory, chronic venous and edematous treatment conditions in vitro and in vivo, and is broadly used to treat chronic venous insufficiency. The purpose of this study was to find out whether aescin influences the effect on rat cytochrome P450 (CYP) enzymes (CYP1A2, CYP2C9, CYP2E1 and CYP3A4) by using cocktail probe drugs in vivo; the influence on the levels of CYP mRNA was also studied. Materials and methods: A cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg), was given as oral administration to rats treated with a single dose or multiple doses of intravenous aescin via the caudal vein. Blood samples were collected at a series of time-points and the concentrations of probe drugs in plasma were determined by HPLC–MS/MS. The corresponding pharmacokinetic parameters were calculated by the software of DAS 2.0. In addition, real-time RT-PCR was performed to determine the effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 in rat liver. Results: Treatment with a single dose or multiple doses of aescin had inductive effects on rat CYP1A2, while CYP2C9 and CYP3A4 enzyme activities were inhibited. Moreover, aescin has no inductive or inhibitory effect on the activity of CYP2E1. The mRNA expression results were in accordance with the pharmacokinetic results. Conclusions: Aescin can either inhibit or induce activities of CYP1A2, CYP2C9 and CYP3A4. Therefore, caution is needed when aescin is co-administration with some CYP1A2, CYP2C9 or CYP3A4 substrates in clinic, which may result in treatment failure and herb-drug interactions. & 2013 Published by Elsevier Ireland Ltd.
Keywords: Aescin Cocktail CYP mRNA Herb-drug interaction
1. Introduction Saponins are natural surfactants, found in many plants which possess immunomodulatory, anticancer, hypocholesterolemic, hypoglycemic, antiviral, and anti-oxidant properties (Rao and Gurfinkel, 2000). Aescin, the main active component found in extracts of horse chestnut (Aesculus hippocastanum) seed, a traditional medicinal herb, is a mixture of triterpene saponins. It has been shown to be effective in inflammatory, chronic venous and edematous treatment conditions in vitro and in vivo, and is
☆ Chemical compounds studied in this article: Aescin (PubChem CID: 6433489); phenacetin (PubChem CID: 4754); tolbutamide (PubChem CID:5505); chlorzoxazone (PubChem CID: 2733); midazolam (PubChem CID: 4192); carbamazepine (PubChem CID: 2554). n Corresponding author. Tel.: +86 0577 55579708. nn Co-corresponding author. E-mail addresses: [email protected]. (Z.-s. Xu), [email protected]. (R.-a. Xu).
broadly used to treat chronic venous insufficiency (Carrasco and Vidrio, 2007). As a potent anti-edematous and anti-inflammatory agent, aescin is generally administered to the patients with severe trauma injury, which often becomes to be endotoxemic. Aescin has also been demonstrated to be effective in the therapeutic regimen against hemorrhoids, postoperative ileus, type I allergic dermatitis and acute impact injuries, with overall excellent tolerability (Fu et al., 2005; Wang et al., 2009; Xie et al., 2009; Sipos et al., 2013). Recent studies have indicated that aescin is also a potential anticancer agent (Shen et al., 2011; Guney et al., 2013). Despite the widespread use of aescin, however, the effects of aescin on the cytochrome P450 (CYP) remain unclear. The use of herbal medication has been increasing as an alternative and/or complementary therapy worldwide (De Smet, 2002; Zhou et al., 2007). Moreover, it is estimated by the WHO that approximately 80% of the global population relies on traditional herbal medicines as part of standard health care (Foster et al., 2005). Despite the potential for pharmacokinetic and pharmacodynamic herb-drug interactions, many people take
0378-8741/$ - see front matter & 2013 Published by Elsevier Ireland Ltd. http://dx.doi.org/10.1016/j.jep.2013.11.016
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
herbal medications in combination with prescribed Western medication (Hellum et al., 2007). So, it is important to investigate drug-herb interactions. In vitro experiments concerning drug interactions provide us with information about which drugs might show serious interaction problems, although the results need to be tested in vivo (Guengerich, 1997; Tanaka, 1998). Such information can decrease the number of risks from drug–herb interactions. However, few data are available about the effects of aescin on substrate drug–enzyme reactions. CYP are the major enzymes involved in the oxidative metabolism of various xenobiotics. They comprise a superfamily of related enzymes that are grouped into families and subfamilies based on similarities in the amino acid sequences. Among the various CYP isoenzymes, there are 11 major drug-metabolizing CYPs that are expressed in the liver: CYP1A2, CYP2A6, CYP2B6, CYP2C8/9/18/19, CYP2D6, CYP2E1 and CYP3A4/5. Of these, four human hepatic CYP enzymes (CYP1A2, 2C9, 2E1 and 3A4) play a dominant role in the metabolism of drugs and other xenobiotics (Zhou et al., 2003). A survey found that 15% of patients receiving conventional pharmacotherapy also took herbal products, among which, potential adverse herb–drug interactions were observed in 40% of patients (Bush et al., 2007). Accordingly, it is essential to evaluate possible herb–drug interactions of these 4 CYP isoforms (Huang et al., 2007). In recent years, a dramatic increase in the number of herb–drug interactions have been reported and have aroused attention with regard to clinic drug safety, pushing the need for the development of a high-throughput screening approach for these herbs (Chan et al., 2010). An approach using the cocktail of drug probe substrates in a high-throughput CYP inhibition system was established and adopted in the herb–drug interactions (Han et al., 2012; Gao et al., 2013; Su et al., 2013). This method allows fast routine measurement of the multiple CYP isoform activities in a single experiment, increased sample throughput, and reduced costs and labors. However, a limitation to this cocktail substrate approach is the possible interaction between substrates as well as measurement speed limitations from the high performance liquid chromatography mass spectrometry (HPLC–MS) method. Nevertheless, the cocktail approach is widely used to assess the influence of herbal medicines on the CYP activities and potential herb–drug interactions. Aescin, one of the most important herbal medicines in traditional Chinese medicine, is widely consumed in Chinese clinics. However, no systematic study has been reported emphasizing the impact of aescin on hepatic CYP enzyme activities up to now. With the aim of avoiding possible side effects induced by herb–drug interactions, we evaluated the effects of aescin on the activities and mRNA expressions of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 enzymes in rats. We used a new four-probe drug cocktail (containing phenacetin for CYP1A2, tolbutamide for CYP2C9, chlorzoxazone for CYP2E1 and midazolam for CYP3A4) based on a developed and validated HPLC–MS method to assess CYP activities by comparing pharmacokinetics of the four substrates between control and treatment groups in vivo. Real-time RT-PCR was performed to assess the levels of CYP mRNA expression. We predict that the results may be useful for the clinical safety evaluation of herb–drug interactions involving aescin.
2. Experimental 2.1. Effects of aescin on the CYP activities in rats by a cocktail method 2.1.1. Chemicals and reagents Aescin (purity 499.0%), phenacetin (purity 498.0%), tolbutamide (purity 4 98.0%), chlorzoxazone (purity 498.0%), midazolam
(purity 498.0%) and the internal standard carbamazepine (IS, purity 498.0%) were purchased from Sigma-Aldrich Company (St. Louis, USA). HPLC grade acetonitrile and methanol were from Merck Company (Darmstadt, Germany). All other chemicals were of analytical grade and used without further purification. Ultrapure water (resistance 418.2 mΩ) prepared by a Millipore Milli-Q purification system (Bedford, USA). 2.1.2. Apparatus and chromatographic conditions All analysis was performed with a 1200 Series liquid chromatography (Agilent Technologies, Waldbronn, Germany) equipped with a quaternary pump, a degasser, an autosampler, a thermostatted column compartment, and a Bruker Esquire HCT mass spectrometer (Bruker Technologies, Bremen, Germany) equipped with an electrospray ion source and controlled by ChemStation software. Chromatographic separation was achieved on a 150 mm 2.1 mm, 3.5 μm particle, Agilent Zorbax SB-C18 column at 30 1C. A gradient elution program was conducted for chromatographic separation with mobile phase A (0.1% formic acid in water) and mobile phase B (acetonitrile) as follows: 0–1.5 min (10%–85% B), 1.5–6.0 min (85%–85% B), 6.0–7.0 min (85%–10% B), 7.0–10.0 min (10%–10% B). The flow rate was 0.4 mL/min. A typical injection volume was 10 mL. The quantification was performed by the peak-area method. The determination of target ions were performed in SIM mode (m/z 180 for phenacetin, m/z 271 for tolbutamide, m/z 168 for chlorzoxazone, m/z 326 for midazolam and m/z 237 for IS ) and positive ion electrospray ionization interface. Drying gas flow was set to 6 L/min and temperature to 350 1C. Nebulizer pressure and capillary voltage of the system were adjusted to 20 psi and 3500 V, respectively. 2.1.3. Animals and administration dosage Male Sprague-Dawley rats with body weights of 220 7 30 g were provided by the Animal Care and Use Committee of Wenzhou Medical College. They were housed into house cages at 23 1C– 25 1C and allowed free access to regular rodent diet and water. After the 1-week acclimatization period, the rats were used for experiments and all efforts were made to minimize any animal suffering. All experimental procedures and protocols were reviewed and approved by the Animal Care and Use Committee of Wenzhou Medical College and were in accordance with the Guide for the Care and Use of Laboratory Animals. For patients, the clinical dose of aescin is 5.0–20.0 mg/day on the basis of patient's condition. Likewise, the doses used for rats were supposed to be 0.45–1.8 mg/kg/day in accordance with the formula of conversion between different species. Low dosage (0.45 mg/kg), medium dosage (0.9 mg/kg) and high dosage (1.8 mg/kg) trial were conducted in our study. In view of clinical use of aescin, we studied the effect of aescin on rat CYP enzymes after rats were intravenously injected by aescin for single dose or multiple doses. 2.1.4. Experimental design 2.1.4.1. Single dose experiment. Twenty-four rats were randomly divided into 4 groups (total 24 rats, n¼ 6): control single group (CSG), low dosage group (LSG), medium dosage group (MSG) and high dosage group (HSG), which were given a single dose of 0.9% sodium chloride solution or aescin. After 5 min, a cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg) in CMC-Na solution, was administered orally to all rats in each group. Blood samples of each rat were collected pre-dose (0 h) and 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 12, 24 h after probe drugs administration through the tail vein and immediately
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
separated by centrifugation at 13,000 rpm for 10 min to obtain plasma. The total volume of blood taken from each animal did not exceed 2.2 mL. 100 mL plasma samples were transferred to another tube and stored frozen at 80 1C until analyzed. 2.1.4.2. Multiple doses experiment. The other 24 rats were also randomly divided into 4 groups (total 24 rats, n¼6): control multiple group (CMG), low dosage group (LMG), medium dosage group (MMG) and high dosage group (HMG), which were given a multiple dose of 0.9% sodium chloride solution or aescin. After intravenous injection for 10 consective days, a cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg) in CMC-Na solution, was administered orally to all rats in each group. Blood samples of each rat were collected pre-dose (0 h) and 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 12, 24 h after probe drugs administration through the tail vein and immediately separated by centrifugation at 13,000 rpm for 10 min to obtain plasma. The total volume of blood taken from each animal did not exceed 2.2 mL. 100 mL plasma samples were transferred to another tube and stored frozen at 80 1C until analyzed.
2.2.4. Synthesis of cDNA We have used 2 μL RNA in a 20 μL reaction mixture utilizing RevertAid™ M-MuLV RT (Fermentas, Hanover, MD, USA) according to the supplier's instructions. Resulting reverse transcription products were stored at 80 1C until assay. 2.2.5. RT-PCR analysis Reactions were performed in a final volume of 25 μL that contained Platinum SYBR Green qPCR SuperMix-UDG 12.5 μL, 2 μL cDNA, 1 μL each of specific oligonucleotide primer (10 μM), and 8.5 μL DEPC-treated autoclaved distilled water. PCR was carried out using initial denaturation at 95 1C for 5 min, followed by 30 cycles of denaturation at 95 1C for 30 s,annealing at 50 1C for 30 s, extension at 72 1C for 30 s and final extension at 72 1C for 5 min. The sequences of the forward and reverse primers used in this experiment are summarized as follows: Isoenzymes Forward
Reverse
CYP1A2
CCGAAGAGCATCACCTTCTC GCATCTGGCTCCTGTCTTTC CTGGAAACTCATGGCTGTCA TGGGAGGTGCCTTATTGGG
CYP2C9 2.1.5. Sample preparation In a 1.5 mL centrifuge tube, aliquot of 0.2 mL acetonitrile with carbamazepine (500 ng/mL) as the internal standard was added to 0.1 mL of collected plasma sample. After the tube was vortexmixed for 1.0 min, the sample was centrifuged at 13,000 rmp for 10 min. Next, the supernatant (10 mL) was injected into the HPLC– MS/MS system for analysis. 2.1.6. Statistical analysis The concentration–time profile of each probe drug was analyzed by DAS software (Version 3.0, Wenzhou Medical College, China) and statistic analyses were tested by t-test using SPSS (Version 13.0, Wenzhou Medical College, China). A value of P o0.05 was considered to be statistically significant. 2.2. Effects of aescin on mRNA expression of CYP Enzymes in rat liver 2.2.1. Drug administration and sample collection (single dose) Twelve male Sprague-Dawley rats were randomly divided into four groups (n ¼ 3): CSG, LSG, MSG and HSG group. Rats in these groups were given a single dose of 0.9% sodium chloride solution or aescin through the caudal vein injection, respectively. Rats were killed 3 h after the treatment. Each liver sample was removed, frozen and store at 80 1C. 2.2.2. Drug administration and sample collection (multiple doses) The other twelve male Sprague-Dawley rats were also randomly divided into four groups (n ¼3): CMG, LMG, MMG and HMG group. Rats in these groups were given a dose of 0.9% sodium chloride solution or aescin through the caudal vein injection, respectively, once daily for 10 days. Twenty-four hours after last dose, rats were killed. Each liver sample was removed, frozen and store at 80 1C. 2.2.3. Total RNA isolation The tissues were processed for isolation of total RNA by using TRIzol reagent (Invitrogen, Calsbad, CA, USA) according to the instruction of the manufacturer. The RNA concentration was determined, and the quality of the isolated RNA was assessed using the 260/280 nm absorbance ratio (1.8–2.0 indicates a highly pure sample). RNA integrity was confirmed by running samples on 1% agarose gel. The RNA pellet was stored at –80 1C until use.
3
CYP2E1 CYP3A4
TCAACCTCGTGAAGAGCAGCA AAAAGCACAATCCGCAGTCT CCTACATGGATGCTGTGGTG TCTGTGCAGAAGCATCGAGTG
2.2.6. Statistical analysis Differences among group mean values were assessed using a two-tailed, two samplet-test that assumed equal variance. A difference of Po 0.05 was considered statistically significant.
3. Results A developed and validated HPLC–MS/MS method was used to determine the levels of the four probe drugs (phenacetin for CYP1A2, tolbutamide for CYP2C9, chlorzoxazone for CYP2E1 and midazolam for CYP3A4) in rat plasma after a single (Fig. 1, Tables 1–4) and multiple (Fig. 2, Tables 5–8) doses of aescin. 3.1. Effect of aescin on rat activity of CYP1A2 Pharmacokinetic profiles of phenacetin after aescin treatment were used to describe the activity of CYP1A2. The effects of different treatment groups of aescin on pharmacokinetic parameters of phenacetin in rats are presented in Tables 1 and 5. Mean plasma concentration–time curves of phenacetin in different groups are presented in Figs. 1 and 2. After pretreatment with a single dose or multiple doses of aescin, the t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1) of phenacetin were decreased significantly compared to those of the corresponding control group, CL of phenacetin was increased significantly. The results indicated that metabolism of phenacetin in these treatment groups was evidently speeded up, and aescin had the potential to induce rat hepatic CYP1A2 activity in vivo. Moreover, the inductive effect of aescin on CYP1A2 was more potent after multiple doses treatment than a single dose. 3.2. Effect of aescin on rat activity of CYP2C9 CYP2C9 activity was evaluated by comparing pharmacokinetic behaviors of tolbutamide between control group and different aescin treatment groups. Listed in Tables 2 and 6 are the main
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
4
Fig. 1. Time–concentration curves for phenacetin (A), tolbutamide (B), chlorzoxazone(C) and midazolam (D) after a single dose of aescin in rats (Mean 7 SD, n¼ 6).
Table 1 Main pharmacokinetic parameters of phenacetin after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg) a b
CSG 4.796 7 0.170 0.2577 0.005 7355.429 7 50.239 31,673.3667 244.794 5.3547 0.606 0.6317 0.005
LSG
MSG a
3.728 70.116 0.2447 0.002 5846.429 7 51.964a 28,653.034 7 335.787 5.236 7 0.726 0.7007 0.038a
HSG a
3.423 7 0.143 0.236 7 0.004 5717.8577 52.056a 25,164.828 71795.448a 4.929 7 0.934 0.798 7 0.056a
3.220 7 0.109b 0.225 7 0.005a 5121.429 7 51.071b 19,181.7267 174.462b 4.309 7 0.700a 1.043 70.010b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 2 Main pharmacokinetic parameters of tolbutamide after a single dose of aescin in rat plasma (n¼6, Mean 7SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
11.374 71.101 2.1437 0.090 14,462.786 7 106.241 175,021.1887 7519.907 10.1797 0.666 0.029 70.001
12.666 7 0.513a 2. 327 70.111 15,413.9247288.707 212,237.5147 9328.53a 10.6517 1.528 0.0277 0.002
15.93571.142b 2.97770.078b 17,413.9247288.707a 295,238.4797 7431.756b 16.469 7 7.265b 0.0247 0.002a
16.1977 0.734b 3.1437 0.378b 17,624.0677 501.148a 311,605.853 7 8502.263b 17.717 71.021b 0.0167 0.001b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
pharmacokinetic parameters of tolbutamide. Mean plasma concentration–time curves of tolbutamide in different groups are presented in Figs. 1 and 2. The results showed that after pretreatment with aescin (especially multiple doses), the t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1) of tolbutamide were increased
significantly compared to those of the corresponding control group, CL of tolbutamide was decreased significantly. These results demonstrated that CYP2C9 activity was significantly inhibited by aescin in rats. Furthermore, the inhibitory effect of aescin on CYP2C9 was more potent after multiple doses treatment.
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
5
Table 3 Main pharmacokinetic parameters of chlorzoxazone after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
3.0217 0.125 3.434 7 0.275 13,451.5717 207.739 87,211.1907 1411.916 5.3497 0.117 0.236 7 0.003
3.0607 0.075 3.327 70.111 13,267.286 7342.656 85,999.044 71039.403 5.283 7 0.058 0.2337 0.003
3.098 7 0.221 3.277 70.278 13,343.0007 201.704 86,931.054 7 1321.134 5.249 7 0.226 0.2417 0.007
3.076 70.080 3.343 70.378 13,447.286 7 225.823 85,213.909 7 908.054 5.322 70.088 0.2357 0.002
*Significantly different from control, P o 0.05; ** Significantly different from control, P o 0.01.
Table 4 Main pharmacokinetic parameters of midazolam after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
3.8357 0.173 0.238 7 0.002 4042.634 772.783 21,709.680 7265.873 4.099 7 0.179 0.530 7 0.014
4.4077 0.099a 0.268 70.004a 4712.554 7 64.320a 24,425.9257 149.724 6.1127 0.098b 0.409 7 0.003a
5.285 70.389b 0.2717 0.004a 6424.0007 117.282b 31,686.269 7 150.461b 6.7707 0.351b 0.3167 0.001b
5.2247 0.667b 0.282 70.010a 7142.429 751.491b 39,638.992 7 194.784b 8.1847 0.724b 0.253 70.010b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o 0.01.
Fig. 2. Time–concentration curves for phenacetin (A), tolbutamide (B), chlorzoxazone(C) and midazolam (D) after multiple doses of aescin in rats (Mean 7 SD, n¼ 6).
3.3. Effect of aescin on rat activity of CYP2E1 The effects of different treatment groups of aescin on pharmacokinetic parameters of chlorzoxazone in rats are presented
in Tables 3 and 7. Mean plasma concentration–time curves of chlorzoxazone in different groups are presented in Figs. 1 and 2. The pharmacokinetic parameters (t1/2, Tmax, Cmax, AUC(0 1), MRT(0 1) and CL) of chlorzoxazone in rats showed no signifi-
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
6
Table 5 Main pharmacokinetic parameters of phenacetin after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
4.7417 0.171 0.2667 0.005 5484.571 754.006 22,468.508 7 185.804 6.320 70.135 0.895 70.070
4.1297 0.281a 0.2447 0.002 3883.6467 44.146 19,000.6427 305.966a 5.269 7 1.165a 1.053 7 0.017a
4.232 7 0.307a 0.2467 0.004 3966.503 7 64.742 19,490.869 7269.150a 5.627 70.263a 1.026 7 0.014a
3.6127 0.112a 0.2357 0.005 3666.121 756.463a 13,766.2127 115.58b 4.848 70.100a 1.453 70.012b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 6 Main pharmacokinetic parameters of tolbutamide after multiple doses of aescin in rat plasma (n¼6, Mean 7SD). Parameter t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg) a b
CMG 6.861 71.451 2.1437 0.563 17,608.609 7 265.874 257,666.364 7 21,798.188 10.23371.930 0.028 7 0.007
LMG
MMG b
12.7607 1.197 2.929 70.889b 19,323.430 7 148.996a 339,634.463 7 22,502.64b 17.1167 1.591b 0.022 70.003a
HMG b
14.337 71.538 3.2777 0.678b 20,413.9247 285.885a 351,520.398 7 23,761.452b 20.744 71.365b 0.0157 0.002b
13.7717 1.094b 3.1437 0.378b 20,137.286 7 146.875a 342,256.923 7 21,996.125b 18.0037 1.905b 0.0187 0.002b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 7 Main pharmacokinetic parameters of chlorzoxazone after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
2.942 7 0.191 3.055 7 0.275 12,457.286 7 185.921 86,065.9017 1283.091 5.432 7 0.128 0.232 7 0.003
2.9117 0.280 3.0277 0.111 12,138.7147 168.839 85,813.7037 1516.052 5.420 70.110 0.2337 0.004
2.8497 0.209 2.987 7 0.078 11,920.1437 155.424 85,987.050 7 1199.023 5.35470.130 0.23370.003
2.995 7 0.264 3.143 70.378 11,825.857 7171.240 84,986.246 7 1332.933 5.3977 0.207 0.2357 0.004
*Significantly different from control, P o 0.05; ** Significantly different from control, P o 0.01.
Table 8 Main pharmacokinetic parameters of midazolam after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
5.1327 1.337 0.228 7 0.002 4803.042 782.160 27,428.86771128.601 6.975 71.118 0.376 70.038
6.389 7 1.211a 0.265 7 0.001a 5949.5717 46.065a 34,839.6157 1858.085a 7.881 7 0.168a 0.289 7 0.024a
6.988 7 1.376b 3.293 7 0.003b 6915.000 787.525b 47,277.259 7 1582.374b 9.0467 1.594b 0.2117 0.003b
6.726 70.876b 0.298 7 0.002b 6556.7147 67.088b 43,630.8447 1211.944b 8.988 7 0.989b 0.230 7 0.012b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
cant difference between different treatment groups and control group after pretreatment with a single dose or multiple doses of aescin. Therefore, the pharmacokinetic behaviors of chlorzoxazone indicated that aescin did not affect rat hepatic CYP2E1 activity in vivo. 3.4. Effect of aescin on rat activity of CYP3A4 CYP3A4 activity was evaluated by comparing pharmacokinetic behaviors of midazolam between control group and different aescin treatment groups. The effects of different treatment groups of aescin on pharmacokinetic parameters of midazolam in rats are presented in Tables 4 and 8. Mean plasma concentration–time curves of midazolam in different groups are presented in
Figs. 1 and 2. After pretreatment with a single dose or multiple doses of aescin, the pharmacokinetic parameters (t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1)) of midazolam in rats were increased significantly compared to those of the corresponding control group, CL of midazolam was decreased significantly. The results indicated that aescin had the potential to inhibit rat hepatic CYP3A4 activity in vivo. In addition, the inhibitory effect of aescin on CYP3A4 was more potent after multiple doses treatment than a single dose. 3.5. Effects of aescin on mRNA expression of CYP enzymes in rat liver After a single dose of aescin (Fig. 3), the level of CYP1A2 in the LSG, MSG and HSG was significantly increased to 1.132-fold, 1.208-
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
7
respectively. In addition, the levels of CYP2C9 in the MMG and HMG was significantly decreased to 0.654-fold and 0.688-fold of that observed in the CMG (P o0.01), while the level of CYP3A4 in the MMG and HMG was significantly decreased to 0.644-fold and 0.655-fold (P o0.01). Compared with the CMG, no significant differences were found in the level of CYP2E1 (P 4 0.05). In general, after multiple doses of aescin, the CYP1A2 mRNA expression levels increased, while CYP2C9 and CYP3A4 enzyme activity was inhibited compared to the CMG. Meanwhile, the CYP2E1 enzyme activity was not changed. In this study, the mRNA expression results were consistent with the pharmacokinetic results.
4. Discussion
Fig. 3. Effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 after a single dose treatment in rats. nP o 0.05 vs. control; nnP o0.01 vs. control.
Fig. 4. Effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 after multiple doses treatment in rats. nP o 0.05 vs. control; nnPo 0.01 vs. control.
fold and 1.387-fold of that observed in the CSG (Po 0.05), respectively. Moreover, the levels of CYP2C9 in the MSG and HSG was significantly decreased to 0.732-fold and 0.673-fold of that observed in the CSG (Po 0.01), while the level of CYP3A4 in the MMG and HMG was significantly decreased to 0.746-fold and 0.687-fold (P o0.01). Compared with the CSG, no significant differences were found in the level of CYP2E1 (P4 0.05). In general, after a single dose of aescin, CYP1A2 enzyme activity was increased, while CYP2C9 and CYP3A4 mRNA expression were decreased compared to the CSG. And, CYP2E1 enzyme activity were unchanged. In our study, the mRNA expression results were consistent with the pharmacokinetic results. After multiple doses of aescin (Fig. 4), the level of CYP1A2 in the LMG, MMG and HMG was significantly increased to 1.155-fold, 1.189-fold and 1.335-fold of that observed in the CMG (P o0.05),
Recently, we have developed a novel four probe-drug cocktail, consisting of phenacetin, tolbutamide, chlorzoxazone and midazolam, in order to establish and optimize a simplified, rapid, selective HPLC–MS/MS method to determine four probe drugs in a single run for the evaluation of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 activities, respectively. The determination of novel “cocktail” was validated in terms of recovery, linearity, precision and accuracy and applied to the analysis of plasma samples in rats. Therefore, in the present study, we investigated the effect of aescin on the activity and mRNA expression of four major CYP isozymes (CYP1A2, CYP2C9, CYP2E1 and CYP3A4) in rats. According to our results, it indicated that CYP1A2 activity significantly induced by aescin after a single dose or multiple doses of aescin administrations in rats. The differences between a single dose and multiple doses of aescin suggest that the subtypes of enzymes affected did not correlate with the length of administration. Interestingly, the study results of gene level also show that aescin can induce the mRNA expression of CYP1A2, which were consistent with the pharmacokinetic results. As we know, CYP1A2 accounts for about 13% of the total CYP content in human liver (Shimada et al., 1994) and is involved in the metabolism of several endogenous compounds and some widely used drugs, also it could activate the procarcinogens such as aflatoxin B1, the commonly recognized hepatocarcinogen (Mustajoki et al., 1994). The above results show that when aescin is used in combination with other drugs which metabolized by the CYP1A2, the potential herb–drug interactions should be pay more attention so as to reduce some adverse reactions or the failure in treatment due to low plasma concentration. CYP2C9 is one of the most abundant CYP enzymes in the human liver ( 20% of hepatic total CYP content), where it metabolizes approximately 15% clinical drugs (4100 drugs), including a number of drugs with narrow therapeutic ranges (Miners and Birkett, 1998). In addition, CYP3A4 was known as the rate-limiting step in the metabolism and clearance of a large variety of clinical medications, including many pediatric drugs (Lu et al., 2003). Therefore, the induction or inhibition on activity of CYP2C9 and CYP3A4 may lead to some undesirable effects. According to our results, both CYP2C9 and CYP3A4 activity could be significantly inhibited by aescin after a single dose or multiple doses of aescin administrations in rats. The study results also show that aescin can induce the mRNA expression of CYP2C9 and CYP3A4 in different dosages, which were consistent with the pharmacokinetic results. Thus, co-administration with aescin, drugs metabolized by human CYP2C9 and CYP3A4 may need dose adjustment to avoid an undesirable herb–drug interaction. CYP2E1 has a unique capacity to activate many xenobiotics to hepatotoxic or carcinogenic products. CYP2E1 is responsible for the metabolism of a large number of low-molecular-weight chemicals, such as aliphatic, aromatic, and halogenated
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
8
hydrocarbons (Yao et al., 2011). Due to its ability to metabolize the compounds, CYP2E1 may be an important determinant factor of humans' susceptibility to toxicity and carcinogenicity of industrial and environmental chemicals. In our study, we found that there was no significant difference of the pharmacokinetic parameters of chlorzoxazone before and after administration of aescin. Moreover, the mRNA expression result of CYP2E1 activity in rats were consistent with the pharmacokinetic results. It suggests that aescin has no inductive or inhibitory effect on the activity of CYP2E1 after long period of administrations in rats. In conclusion, the inconspicuous effect of aescin on CYP2E1 suggested that there are no clinically relevant herb–drug interactions between the drugs metabolized by this enzyme and aescin when they are used concomitantly. In addition, from our present results, we cannot exclude that comedication of aescin with drugs metabolized by CYP1A2 may induce metabolism of these drugs and decrease plasma concentrations of these drugs, which will result in herb–drug interactions. However, CYP2C9 and CYP3A4 enzyme activitise were inhibited after a single dose or multiple doses treatment of aescin. Finally, the effects of aescin on the CYP activities were more potent after multiple doses treatment, which suggest that multiple doses treatment could be a better route to investigate the effect of aescin. Further clinical studies are required to fully assess the safety of aescin in terms of CYP. Acknowledgment This work was supported by fund of the key academic subject (clinical Chinese pharmacy) of the Twelfth-Five Year Program of state administration of traditional chinese medicine. References Bush, T.M., Rayburn, K.S., Holloway, S.W., Sanchez-Yamamoto, D.S., Allen, B.L., Lam, T., So, B.K., Tran de, H., Greyber, E.R., Kantor, S., Roth, L.W., 2007. Adverse interactions between herbal and dietary substances and prescription medications: a clinical survey. Altern. Therapies Health Med. 13, 30–35. Carrasco, O.F., Vidrio, H., 2007. Endothelium protectant and contractile effects of the antivaricose principle escin in rat aorta. Vascular Pharmacol. 47, 68–73. Chan, E., Tan, M., Xin, J., Sudarsanam, S., Johnson, D.E., 2010. Interactions between traditional Chinese medicines and Western Ther.ics. Curr. Opin. Drug Discov. Devel. 13, 50–65. De Smet, P.A., 2002. Herbal remedies. N. England J. Med. 347, 2046–2056. Foster, B.C., Arnason, J.T., Briggs, C.J., 2005. Natural health products and drug disposition. Ann. Rev. Pharmacol. Toxicol. 45, 203–226. Fu, F., Hou, Y., Jiang, W., Wang, R., Liu, K., 2005. Escin: inhibiting inflammation and promoting gastrointestinal transit to attenuate formation of postoperative adhesions. World J. Surg. 29, 1614-1620; discussion 1621-1612.
Gao, J., Shi, Z., Zhu, S., Li, G.Q., Yan, R., Yao, M., 2013. Influences of processed rhubarbs on the activities of four CYP isozymes and the metabolism of saxagliptin in rats based on probe cocktail and pharmacokinetics approaches. J. Ethnopharmacol. 145, 566–572. Guengerich, F.P., 1997. Role of cytochrome P450 enzymes in drug-drug interactions. Adv. Pharmacol. 43, 7–35. Guney, G., Kutlu, H.M., Iscan, A., 2013. The apoptotic effects of escin in the h-ras transformed 5RP7 cell line. Phytotherapy Res. 27, 900–905. Han, Y.L., Li, D., Ren, B., Jing, G.P., Meng, X.L., Zhou, Z.Y., Yu, Q., Li, Y., Wan, L.L., Guo, C., 2012. Evaluation of impact of Herba Erigerontis injection, a Chinese herbal prescription, on rat hepatic cytochrome P450 enzymes by cocktail probe drugs. J. Ethnopharmacol. 139, 104–109. Hellum, B.H., Hu, Z., Nilsen, O.G., 2007. The induction of CYP1A2, CYP2D6 and CYP3A4 by six trade herbal products in cultured primary human hepatocytes. Basic Clin. Pharmacol. Toxicol. 100, 23–30. Huang, S.M., Temple, R., Throckmorton, D.C., Lesko, L.J., 2007. Drug interaction studies: study design, data analysis, and implications for dosing and labeling. Clin. Pharmacol. Ther.. 81, 298–304. Lu, S.K., Callahan, S.M., Brunner, L.J., 2003. Suppression of hepatic CYP3A1/2 and CYP2C11 by cyclosporine is not mediated by altering growth hormone levels. J. Pharmacol. Exp. Ther.. 305, 331–337. Miners, J.O., Birkett, D.J., 1998. Cytochrome P4502C9: an enzyme of major importance in human drug metabolism. Br. J. Clin. Pharmacol. 45, 525–538. Mustajoki, P., Mustajoki, S., Rautio, A., Arvela, P., Pelkonen, O., 1994. Effects of heme arginate on cytochrome P450-mediated metabolism of drugs in patients with variegate porphyria and in healthy men. Clin. Pharmacol. Ther.. 56, 9–13. Rao, A.V., Gurfinkel, D.M., 2000. The bioactivity of saponins: triterpenoid and steroidal glycosides. Drug Metab. Drug Interac. 17, 211–235. Shen, D.Y., Kang, J.H., Song, W., Zhang, W.Q., Li, W.G., Zhao, Y., Chen, Q.X., 2011. Apoptosis of human cholangiocarcinoma cell lines induced by beta-escin through mitochondrial caspase-dependent pathway. Phytotherapy Res. 25, 1519–1526. Shimada, T., Yamazaki, H., Mimura, M., Inui, Y., Guengerich, F.P., 1994. Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J. Pharmacol. Exp. Ther.. 270, 414–423. Sipos, W., Reutterer, B., Frank, M., Unger, H., Grassauer, A., Prieschl-Grassauer, E., Doerfler, P., 2013. Escin inhibits type I allergic dermatitis in a novel porcine model. Int. Arch. Allergy Immunol. 161, 44–52. Su, T., Mao, C., Yin, F., Yu, Z., Lin, Y., Song, Y., Lu, T., 2013. Effects of unprocessed versus vinegar-processed Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes in rats. J. Ethnopharmacol. 146, 734–743. Tanaka, E., 1998. Clinically important pharmacokinetic drug–drug interactions: role of cytochrome P450 enzymes. J. Clin. Pharm. Ther. 23, 403–416. Wang, T., Fu, F., Zhang, L., Han, B., Zhu, M., Zhang, X., 2009. Effects of escin on acute inflammation and the immune system in mice. Pharmacol. Rep. 61, 697–704. Xie, Q., Zong, X., Ge, B., Wang, S., Ji, J., Ye, Y., Pan, L., 2009. Pilot postoperative ileus study of escin in cancer patients after colorectal surgery. World J. Surg. 33, 348–354. Yao, X.M., Wang, B.L., Gu, Y., Li, Y., 2011. Effects of bicyclol on the activity and expression of CYP450 enzymes of rats after partial hepatectomy. Yao Xue Xue Bao. Acta Pharmaceutica Sinica 46, 656–663. Zhou, S., Gao, Y., Jiang, W., Huang, M., Xu, A., Paxton, J.W., 2003. Interactions of herbs with cytochrome P450. Drug Metab. Rev. 35, 35–98. Zhou, S.F., Xue, C.C., Yu, X.Q., Wang, G., 2007. Metabolic activation of herbal and dietary constituents and its clinical and toxicological implications: an update. Curr. Drug Metab. 8, 526–553.
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep
Effects of aescin on cytochrome P450 enzymes in rats$ Yi Huang a, Shuang-li Zheng b, Hai-yan Zhu c, Zhi-sheng Xu b,nn, Ren-ai Xu c,n a b c
Wenzhou People’s Hospital, Wenzhou 325000, China The Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China The First Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China
art ic l e i nf o
a b s t r a c t
Article history: Received 18 July 2013 Received in revised form 24 September 2013 Accepted 10 November 2013
Ethnopharmacological relevance: Aescin, the main active component found in extracts of horse chestnut (Aesculus hippocastanum) seed a traditional medicinal herb, is a mixture of triterpene saponins. It has been shown to be effective in inflammatory, chronic venous and edematous treatment conditions in vitro and in vivo, and is broadly used to treat chronic venous insufficiency. The purpose of this study was to find out whether aescin influences the effect on rat cytochrome P450 (CYP) enzymes (CYP1A2, CYP2C9, CYP2E1 and CYP3A4) by using cocktail probe drugs in vivo; the influence on the levels of CYP mRNA was also studied. Materials and methods: A cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg), was given as oral administration to rats treated with a single dose or multiple doses of intravenous aescin via the caudal vein. Blood samples were collected at a series of time-points and the concentrations of probe drugs in plasma were determined by HPLC–MS/MS. The corresponding pharmacokinetic parameters were calculated by the software of DAS 2.0. In addition, real-time RT-PCR was performed to determine the effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 in rat liver. Results: Treatment with a single dose or multiple doses of aescin had inductive effects on rat CYP1A2, while CYP2C9 and CYP3A4 enzyme activities were inhibited. Moreover, aescin has no inductive or inhibitory effect on the activity of CYP2E1. The mRNA expression results were in accordance with the pharmacokinetic results. Conclusions: Aescin can either inhibit or induce activities of CYP1A2, CYP2C9 and CYP3A4. Therefore, caution is needed when aescin is co-administration with some CYP1A2, CYP2C9 or CYP3A4 substrates in clinic, which may result in treatment failure and herb-drug interactions. & 2013 Published by Elsevier Ireland Ltd.
Keywords: Aescin Cocktail CYP mRNA Herb-drug interaction
1. Introduction Saponins are natural surfactants, found in many plants which possess immunomodulatory, anticancer, hypocholesterolemic, hypoglycemic, antiviral, and anti-oxidant properties (Rao and Gurfinkel, 2000). Aescin, the main active component found in extracts of horse chestnut (Aesculus hippocastanum) seed, a traditional medicinal herb, is a mixture of triterpene saponins. It has been shown to be effective in inflammatory, chronic venous and edematous treatment conditions in vitro and in vivo, and is
☆ Chemical compounds studied in this article: Aescin (PubChem CID: 6433489); phenacetin (PubChem CID: 4754); tolbutamide (PubChem CID:5505); chlorzoxazone (PubChem CID: 2733); midazolam (PubChem CID: 4192); carbamazepine (PubChem CID: 2554). n Corresponding author. Tel.: +86 0577 55579708. nn Co-corresponding author. E-mail addresses: [email protected]. (Z.-s. Xu), [email protected]. (R.-a. Xu).
broadly used to treat chronic venous insufficiency (Carrasco and Vidrio, 2007). As a potent anti-edematous and anti-inflammatory agent, aescin is generally administered to the patients with severe trauma injury, which often becomes to be endotoxemic. Aescin has also been demonstrated to be effective in the therapeutic regimen against hemorrhoids, postoperative ileus, type I allergic dermatitis and acute impact injuries, with overall excellent tolerability (Fu et al., 2005; Wang et al., 2009; Xie et al., 2009; Sipos et al., 2013). Recent studies have indicated that aescin is also a potential anticancer agent (Shen et al., 2011; Guney et al., 2013). Despite the widespread use of aescin, however, the effects of aescin on the cytochrome P450 (CYP) remain unclear. The use of herbal medication has been increasing as an alternative and/or complementary therapy worldwide (De Smet, 2002; Zhou et al., 2007). Moreover, it is estimated by the WHO that approximately 80% of the global population relies on traditional herbal medicines as part of standard health care (Foster et al., 2005). Despite the potential for pharmacokinetic and pharmacodynamic herb-drug interactions, many people take
0378-8741/$ - see front matter & 2013 Published by Elsevier Ireland Ltd. http://dx.doi.org/10.1016/j.jep.2013.11.016
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
herbal medications in combination with prescribed Western medication (Hellum et al., 2007). So, it is important to investigate drug-herb interactions. In vitro experiments concerning drug interactions provide us with information about which drugs might show serious interaction problems, although the results need to be tested in vivo (Guengerich, 1997; Tanaka, 1998). Such information can decrease the number of risks from drug–herb interactions. However, few data are available about the effects of aescin on substrate drug–enzyme reactions. CYP are the major enzymes involved in the oxidative metabolism of various xenobiotics. They comprise a superfamily of related enzymes that are grouped into families and subfamilies based on similarities in the amino acid sequences. Among the various CYP isoenzymes, there are 11 major drug-metabolizing CYPs that are expressed in the liver: CYP1A2, CYP2A6, CYP2B6, CYP2C8/9/18/19, CYP2D6, CYP2E1 and CYP3A4/5. Of these, four human hepatic CYP enzymes (CYP1A2, 2C9, 2E1 and 3A4) play a dominant role in the metabolism of drugs and other xenobiotics (Zhou et al., 2003). A survey found that 15% of patients receiving conventional pharmacotherapy also took herbal products, among which, potential adverse herb–drug interactions were observed in 40% of patients (Bush et al., 2007). Accordingly, it is essential to evaluate possible herb–drug interactions of these 4 CYP isoforms (Huang et al., 2007). In recent years, a dramatic increase in the number of herb–drug interactions have been reported and have aroused attention with regard to clinic drug safety, pushing the need for the development of a high-throughput screening approach for these herbs (Chan et al., 2010). An approach using the cocktail of drug probe substrates in a high-throughput CYP inhibition system was established and adopted in the herb–drug interactions (Han et al., 2012; Gao et al., 2013; Su et al., 2013). This method allows fast routine measurement of the multiple CYP isoform activities in a single experiment, increased sample throughput, and reduced costs and labors. However, a limitation to this cocktail substrate approach is the possible interaction between substrates as well as measurement speed limitations from the high performance liquid chromatography mass spectrometry (HPLC–MS) method. Nevertheless, the cocktail approach is widely used to assess the influence of herbal medicines on the CYP activities and potential herb–drug interactions. Aescin, one of the most important herbal medicines in traditional Chinese medicine, is widely consumed in Chinese clinics. However, no systematic study has been reported emphasizing the impact of aescin on hepatic CYP enzyme activities up to now. With the aim of avoiding possible side effects induced by herb–drug interactions, we evaluated the effects of aescin on the activities and mRNA expressions of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 enzymes in rats. We used a new four-probe drug cocktail (containing phenacetin for CYP1A2, tolbutamide for CYP2C9, chlorzoxazone for CYP2E1 and midazolam for CYP3A4) based on a developed and validated HPLC–MS method to assess CYP activities by comparing pharmacokinetics of the four substrates between control and treatment groups in vivo. Real-time RT-PCR was performed to assess the levels of CYP mRNA expression. We predict that the results may be useful for the clinical safety evaluation of herb–drug interactions involving aescin.
2. Experimental 2.1. Effects of aescin on the CYP activities in rats by a cocktail method 2.1.1. Chemicals and reagents Aescin (purity 499.0%), phenacetin (purity 498.0%), tolbutamide (purity 4 98.0%), chlorzoxazone (purity 498.0%), midazolam
(purity 498.0%) and the internal standard carbamazepine (IS, purity 498.0%) were purchased from Sigma-Aldrich Company (St. Louis, USA). HPLC grade acetonitrile and methanol were from Merck Company (Darmstadt, Germany). All other chemicals were of analytical grade and used without further purification. Ultrapure water (resistance 418.2 mΩ) prepared by a Millipore Milli-Q purification system (Bedford, USA). 2.1.2. Apparatus and chromatographic conditions All analysis was performed with a 1200 Series liquid chromatography (Agilent Technologies, Waldbronn, Germany) equipped with a quaternary pump, a degasser, an autosampler, a thermostatted column compartment, and a Bruker Esquire HCT mass spectrometer (Bruker Technologies, Bremen, Germany) equipped with an electrospray ion source and controlled by ChemStation software. Chromatographic separation was achieved on a 150 mm 2.1 mm, 3.5 μm particle, Agilent Zorbax SB-C18 column at 30 1C. A gradient elution program was conducted for chromatographic separation with mobile phase A (0.1% formic acid in water) and mobile phase B (acetonitrile) as follows: 0–1.5 min (10%–85% B), 1.5–6.0 min (85%–85% B), 6.0–7.0 min (85%–10% B), 7.0–10.0 min (10%–10% B). The flow rate was 0.4 mL/min. A typical injection volume was 10 mL. The quantification was performed by the peak-area method. The determination of target ions were performed in SIM mode (m/z 180 for phenacetin, m/z 271 for tolbutamide, m/z 168 for chlorzoxazone, m/z 326 for midazolam and m/z 237 for IS ) and positive ion electrospray ionization interface. Drying gas flow was set to 6 L/min and temperature to 350 1C. Nebulizer pressure and capillary voltage of the system were adjusted to 20 psi and 3500 V, respectively. 2.1.3. Animals and administration dosage Male Sprague-Dawley rats with body weights of 220 7 30 g were provided by the Animal Care and Use Committee of Wenzhou Medical College. They were housed into house cages at 23 1C– 25 1C and allowed free access to regular rodent diet and water. After the 1-week acclimatization period, the rats were used for experiments and all efforts were made to minimize any animal suffering. All experimental procedures and protocols were reviewed and approved by the Animal Care and Use Committee of Wenzhou Medical College and were in accordance with the Guide for the Care and Use of Laboratory Animals. For patients, the clinical dose of aescin is 5.0–20.0 mg/day on the basis of patient's condition. Likewise, the doses used for rats were supposed to be 0.45–1.8 mg/kg/day in accordance with the formula of conversion between different species. Low dosage (0.45 mg/kg), medium dosage (0.9 mg/kg) and high dosage (1.8 mg/kg) trial were conducted in our study. In view of clinical use of aescin, we studied the effect of aescin on rat CYP enzymes after rats were intravenously injected by aescin for single dose or multiple doses. 2.1.4. Experimental design 2.1.4.1. Single dose experiment. Twenty-four rats were randomly divided into 4 groups (total 24 rats, n¼ 6): control single group (CSG), low dosage group (LSG), medium dosage group (MSG) and high dosage group (HSG), which were given a single dose of 0.9% sodium chloride solution or aescin. After 5 min, a cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg) in CMC-Na solution, was administered orally to all rats in each group. Blood samples of each rat were collected pre-dose (0 h) and 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 12, 24 h after probe drugs administration through the tail vein and immediately
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
separated by centrifugation at 13,000 rpm for 10 min to obtain plasma. The total volume of blood taken from each animal did not exceed 2.2 mL. 100 mL plasma samples were transferred to another tube and stored frozen at 80 1C until analyzed. 2.1.4.2. Multiple doses experiment. The other 24 rats were also randomly divided into 4 groups (total 24 rats, n¼6): control multiple group (CMG), low dosage group (LMG), medium dosage group (MMG) and high dosage group (HMG), which were given a multiple dose of 0.9% sodium chloride solution or aescin. After intravenous injection for 10 consective days, a cocktail solution at a dose of 5 mL/kg, which contained phenacetin (20 mg/kg), tolbutamide (5 mg/kg), chlorzoxazone (20 mg/kg) and midazolam (10 mg/kg) in CMC-Na solution, was administered orally to all rats in each group. Blood samples of each rat were collected pre-dose (0 h) and 0.25, 0.5, 0.75, 1, 1.5, 2, 3, 4, 6, 8, 12, 24 h after probe drugs administration through the tail vein and immediately separated by centrifugation at 13,000 rpm for 10 min to obtain plasma. The total volume of blood taken from each animal did not exceed 2.2 mL. 100 mL plasma samples were transferred to another tube and stored frozen at 80 1C until analyzed.
2.2.4. Synthesis of cDNA We have used 2 μL RNA in a 20 μL reaction mixture utilizing RevertAid™ M-MuLV RT (Fermentas, Hanover, MD, USA) according to the supplier's instructions. Resulting reverse transcription products were stored at 80 1C until assay. 2.2.5. RT-PCR analysis Reactions were performed in a final volume of 25 μL that contained Platinum SYBR Green qPCR SuperMix-UDG 12.5 μL, 2 μL cDNA, 1 μL each of specific oligonucleotide primer (10 μM), and 8.5 μL DEPC-treated autoclaved distilled water. PCR was carried out using initial denaturation at 95 1C for 5 min, followed by 30 cycles of denaturation at 95 1C for 30 s,annealing at 50 1C for 30 s, extension at 72 1C for 30 s and final extension at 72 1C for 5 min. The sequences of the forward and reverse primers used in this experiment are summarized as follows: Isoenzymes Forward
Reverse
CYP1A2
CCGAAGAGCATCACCTTCTC GCATCTGGCTCCTGTCTTTC CTGGAAACTCATGGCTGTCA TGGGAGGTGCCTTATTGGG
CYP2C9 2.1.5. Sample preparation In a 1.5 mL centrifuge tube, aliquot of 0.2 mL acetonitrile with carbamazepine (500 ng/mL) as the internal standard was added to 0.1 mL of collected plasma sample. After the tube was vortexmixed for 1.0 min, the sample was centrifuged at 13,000 rmp for 10 min. Next, the supernatant (10 mL) was injected into the HPLC– MS/MS system for analysis. 2.1.6. Statistical analysis The concentration–time profile of each probe drug was analyzed by DAS software (Version 3.0, Wenzhou Medical College, China) and statistic analyses were tested by t-test using SPSS (Version 13.0, Wenzhou Medical College, China). A value of P o0.05 was considered to be statistically significant. 2.2. Effects of aescin on mRNA expression of CYP Enzymes in rat liver 2.2.1. Drug administration and sample collection (single dose) Twelve male Sprague-Dawley rats were randomly divided into four groups (n ¼ 3): CSG, LSG, MSG and HSG group. Rats in these groups were given a single dose of 0.9% sodium chloride solution or aescin through the caudal vein injection, respectively. Rats were killed 3 h after the treatment. Each liver sample was removed, frozen and store at 80 1C. 2.2.2. Drug administration and sample collection (multiple doses) The other twelve male Sprague-Dawley rats were also randomly divided into four groups (n ¼3): CMG, LMG, MMG and HMG group. Rats in these groups were given a dose of 0.9% sodium chloride solution or aescin through the caudal vein injection, respectively, once daily for 10 days. Twenty-four hours after last dose, rats were killed. Each liver sample was removed, frozen and store at 80 1C. 2.2.3. Total RNA isolation The tissues were processed for isolation of total RNA by using TRIzol reagent (Invitrogen, Calsbad, CA, USA) according to the instruction of the manufacturer. The RNA concentration was determined, and the quality of the isolated RNA was assessed using the 260/280 nm absorbance ratio (1.8–2.0 indicates a highly pure sample). RNA integrity was confirmed by running samples on 1% agarose gel. The RNA pellet was stored at –80 1C until use.
3
CYP2E1 CYP3A4
TCAACCTCGTGAAGAGCAGCA AAAAGCACAATCCGCAGTCT CCTACATGGATGCTGTGGTG TCTGTGCAGAAGCATCGAGTG
2.2.6. Statistical analysis Differences among group mean values were assessed using a two-tailed, two samplet-test that assumed equal variance. A difference of Po 0.05 was considered statistically significant.
3. Results A developed and validated HPLC–MS/MS method was used to determine the levels of the four probe drugs (phenacetin for CYP1A2, tolbutamide for CYP2C9, chlorzoxazone for CYP2E1 and midazolam for CYP3A4) in rat plasma after a single (Fig. 1, Tables 1–4) and multiple (Fig. 2, Tables 5–8) doses of aescin. 3.1. Effect of aescin on rat activity of CYP1A2 Pharmacokinetic profiles of phenacetin after aescin treatment were used to describe the activity of CYP1A2. The effects of different treatment groups of aescin on pharmacokinetic parameters of phenacetin in rats are presented in Tables 1 and 5. Mean plasma concentration–time curves of phenacetin in different groups are presented in Figs. 1 and 2. After pretreatment with a single dose or multiple doses of aescin, the t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1) of phenacetin were decreased significantly compared to those of the corresponding control group, CL of phenacetin was increased significantly. The results indicated that metabolism of phenacetin in these treatment groups was evidently speeded up, and aescin had the potential to induce rat hepatic CYP1A2 activity in vivo. Moreover, the inductive effect of aescin on CYP1A2 was more potent after multiple doses treatment than a single dose. 3.2. Effect of aescin on rat activity of CYP2C9 CYP2C9 activity was evaluated by comparing pharmacokinetic behaviors of tolbutamide between control group and different aescin treatment groups. Listed in Tables 2 and 6 are the main
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
4
Fig. 1. Time–concentration curves for phenacetin (A), tolbutamide (B), chlorzoxazone(C) and midazolam (D) after a single dose of aescin in rats (Mean 7 SD, n¼ 6).
Table 1 Main pharmacokinetic parameters of phenacetin after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg) a b
CSG 4.796 7 0.170 0.2577 0.005 7355.429 7 50.239 31,673.3667 244.794 5.3547 0.606 0.6317 0.005
LSG
MSG a
3.728 70.116 0.2447 0.002 5846.429 7 51.964a 28,653.034 7 335.787 5.236 7 0.726 0.7007 0.038a
HSG a
3.423 7 0.143 0.236 7 0.004 5717.8577 52.056a 25,164.828 71795.448a 4.929 7 0.934 0.798 7 0.056a
3.220 7 0.109b 0.225 7 0.005a 5121.429 7 51.071b 19,181.7267 174.462b 4.309 7 0.700a 1.043 70.010b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 2 Main pharmacokinetic parameters of tolbutamide after a single dose of aescin in rat plasma (n¼6, Mean 7SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
11.374 71.101 2.1437 0.090 14,462.786 7 106.241 175,021.1887 7519.907 10.1797 0.666 0.029 70.001
12.666 7 0.513a 2. 327 70.111 15,413.9247288.707 212,237.5147 9328.53a 10.6517 1.528 0.0277 0.002
15.93571.142b 2.97770.078b 17,413.9247288.707a 295,238.4797 7431.756b 16.469 7 7.265b 0.0247 0.002a
16.1977 0.734b 3.1437 0.378b 17,624.0677 501.148a 311,605.853 7 8502.263b 17.717 71.021b 0.0167 0.001b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
pharmacokinetic parameters of tolbutamide. Mean plasma concentration–time curves of tolbutamide in different groups are presented in Figs. 1 and 2. The results showed that after pretreatment with aescin (especially multiple doses), the t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1) of tolbutamide were increased
significantly compared to those of the corresponding control group, CL of tolbutamide was decreased significantly. These results demonstrated that CYP2C9 activity was significantly inhibited by aescin in rats. Furthermore, the inhibitory effect of aescin on CYP2C9 was more potent after multiple doses treatment.
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
5
Table 3 Main pharmacokinetic parameters of chlorzoxazone after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
3.0217 0.125 3.434 7 0.275 13,451.5717 207.739 87,211.1907 1411.916 5.3497 0.117 0.236 7 0.003
3.0607 0.075 3.327 70.111 13,267.286 7342.656 85,999.044 71039.403 5.283 7 0.058 0.2337 0.003
3.098 7 0.221 3.277 70.278 13,343.0007 201.704 86,931.054 7 1321.134 5.249 7 0.226 0.2417 0.007
3.076 70.080 3.343 70.378 13,447.286 7 225.823 85,213.909 7 908.054 5.322 70.088 0.2357 0.002
*Significantly different from control, P o 0.05; ** Significantly different from control, P o 0.01.
Table 4 Main pharmacokinetic parameters of midazolam after a single dose of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CSG
LSG
MSG
HSG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
3.8357 0.173 0.238 7 0.002 4042.634 772.783 21,709.680 7265.873 4.099 7 0.179 0.530 7 0.014
4.4077 0.099a 0.268 70.004a 4712.554 7 64.320a 24,425.9257 149.724 6.1127 0.098b 0.409 7 0.003a
5.285 70.389b 0.2717 0.004a 6424.0007 117.282b 31,686.269 7 150.461b 6.7707 0.351b 0.3167 0.001b
5.2247 0.667b 0.282 70.010a 7142.429 751.491b 39,638.992 7 194.784b 8.1847 0.724b 0.253 70.010b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o 0.01.
Fig. 2. Time–concentration curves for phenacetin (A), tolbutamide (B), chlorzoxazone(C) and midazolam (D) after multiple doses of aescin in rats (Mean 7 SD, n¼ 6).
3.3. Effect of aescin on rat activity of CYP2E1 The effects of different treatment groups of aescin on pharmacokinetic parameters of chlorzoxazone in rats are presented
in Tables 3 and 7. Mean plasma concentration–time curves of chlorzoxazone in different groups are presented in Figs. 1 and 2. The pharmacokinetic parameters (t1/2, Tmax, Cmax, AUC(0 1), MRT(0 1) and CL) of chlorzoxazone in rats showed no signifi-
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
6
Table 5 Main pharmacokinetic parameters of phenacetin after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
4.7417 0.171 0.2667 0.005 5484.571 754.006 22,468.508 7 185.804 6.320 70.135 0.895 70.070
4.1297 0.281a 0.2447 0.002 3883.6467 44.146 19,000.6427 305.966a 5.269 7 1.165a 1.053 7 0.017a
4.232 7 0.307a 0.2467 0.004 3966.503 7 64.742 19,490.869 7269.150a 5.627 70.263a 1.026 7 0.014a
3.6127 0.112a 0.2357 0.005 3666.121 756.463a 13,766.2127 115.58b 4.848 70.100a 1.453 70.012b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 6 Main pharmacokinetic parameters of tolbutamide after multiple doses of aescin in rat plasma (n¼6, Mean 7SD). Parameter t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg) a b
CMG 6.861 71.451 2.1437 0.563 17,608.609 7 265.874 257,666.364 7 21,798.188 10.23371.930 0.028 7 0.007
LMG
MMG b
12.7607 1.197 2.929 70.889b 19,323.430 7 148.996a 339,634.463 7 22,502.64b 17.1167 1.591b 0.022 70.003a
HMG b
14.337 71.538 3.2777 0.678b 20,413.9247 285.885a 351,520.398 7 23,761.452b 20.744 71.365b 0.0157 0.002b
13.7717 1.094b 3.1437 0.378b 20,137.286 7 146.875a 342,256.923 7 21,996.125b 18.0037 1.905b 0.0187 0.002b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
Table 7 Main pharmacokinetic parameters of chlorzoxazone after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
2.942 7 0.191 3.055 7 0.275 12,457.286 7 185.921 86,065.9017 1283.091 5.432 7 0.128 0.232 7 0.003
2.9117 0.280 3.0277 0.111 12,138.7147 168.839 85,813.7037 1516.052 5.420 70.110 0.2337 0.004
2.8497 0.209 2.987 7 0.078 11,920.1437 155.424 85,987.050 7 1199.023 5.35470.130 0.23370.003
2.995 7 0.264 3.143 70.378 11,825.857 7171.240 84,986.246 7 1332.933 5.3977 0.207 0.2357 0.004
*Significantly different from control, P o 0.05; ** Significantly different from control, P o 0.01.
Table 8 Main pharmacokinetic parameters of midazolam after multiple doses of aescin in rat plasma (n¼ 6, Mean 7 SD). Parameter
CMG
LMG
MMG
HMG
t1/2 (h) Tmax (h) Cmax (ng/mL) AUC(0 1)(mg h/L) MRT(0 1)(h) CL/F (L/h/kg)
5.1327 1.337 0.228 7 0.002 4803.042 782.160 27,428.86771128.601 6.975 71.118 0.376 70.038
6.389 7 1.211a 0.265 7 0.001a 5949.5717 46.065a 34,839.6157 1858.085a 7.881 7 0.168a 0.289 7 0.024a
6.988 7 1.376b 3.293 7 0.003b 6915.000 787.525b 47,277.259 7 1582.374b 9.0467 1.594b 0.2117 0.003b
6.726 70.876b 0.298 7 0.002b 6556.7147 67.088b 43,630.8447 1211.944b 8.988 7 0.989b 0.230 7 0.012b
a b
Significantly different from control, Po 0.05 Significantly different from control, P o0.01.
cant difference between different treatment groups and control group after pretreatment with a single dose or multiple doses of aescin. Therefore, the pharmacokinetic behaviors of chlorzoxazone indicated that aescin did not affect rat hepatic CYP2E1 activity in vivo. 3.4. Effect of aescin on rat activity of CYP3A4 CYP3A4 activity was evaluated by comparing pharmacokinetic behaviors of midazolam between control group and different aescin treatment groups. The effects of different treatment groups of aescin on pharmacokinetic parameters of midazolam in rats are presented in Tables 4 and 8. Mean plasma concentration–time curves of midazolam in different groups are presented in
Figs. 1 and 2. After pretreatment with a single dose or multiple doses of aescin, the pharmacokinetic parameters (t1/2, Tmax, Cmax, AUC(0 1) and MRT(0 1)) of midazolam in rats were increased significantly compared to those of the corresponding control group, CL of midazolam was decreased significantly. The results indicated that aescin had the potential to inhibit rat hepatic CYP3A4 activity in vivo. In addition, the inhibitory effect of aescin on CYP3A4 was more potent after multiple doses treatment than a single dose. 3.5. Effects of aescin on mRNA expression of CYP enzymes in rat liver After a single dose of aescin (Fig. 3), the level of CYP1A2 in the LSG, MSG and HSG was significantly increased to 1.132-fold, 1.208-
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
7
respectively. In addition, the levels of CYP2C9 in the MMG and HMG was significantly decreased to 0.654-fold and 0.688-fold of that observed in the CMG (P o0.01), while the level of CYP3A4 in the MMG and HMG was significantly decreased to 0.644-fold and 0.655-fold (P o0.01). Compared with the CMG, no significant differences were found in the level of CYP2E1 (P 4 0.05). In general, after multiple doses of aescin, the CYP1A2 mRNA expression levels increased, while CYP2C9 and CYP3A4 enzyme activity was inhibited compared to the CMG. Meanwhile, the CYP2E1 enzyme activity was not changed. In this study, the mRNA expression results were consistent with the pharmacokinetic results.
4. Discussion
Fig. 3. Effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 after a single dose treatment in rats. nP o 0.05 vs. control; nnP o0.01 vs. control.
Fig. 4. Effects of aescin on the mRNA expression of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 after multiple doses treatment in rats. nP o 0.05 vs. control; nnPo 0.01 vs. control.
fold and 1.387-fold of that observed in the CSG (Po 0.05), respectively. Moreover, the levels of CYP2C9 in the MSG and HSG was significantly decreased to 0.732-fold and 0.673-fold of that observed in the CSG (Po 0.01), while the level of CYP3A4 in the MMG and HMG was significantly decreased to 0.746-fold and 0.687-fold (P o0.01). Compared with the CSG, no significant differences were found in the level of CYP2E1 (P4 0.05). In general, after a single dose of aescin, CYP1A2 enzyme activity was increased, while CYP2C9 and CYP3A4 mRNA expression were decreased compared to the CSG. And, CYP2E1 enzyme activity were unchanged. In our study, the mRNA expression results were consistent with the pharmacokinetic results. After multiple doses of aescin (Fig. 4), the level of CYP1A2 in the LMG, MMG and HMG was significantly increased to 1.155-fold, 1.189-fold and 1.335-fold of that observed in the CMG (P o0.05),
Recently, we have developed a novel four probe-drug cocktail, consisting of phenacetin, tolbutamide, chlorzoxazone and midazolam, in order to establish and optimize a simplified, rapid, selective HPLC–MS/MS method to determine four probe drugs in a single run for the evaluation of CYP1A2, CYP2C9, CYP2E1 and CYP3A4 activities, respectively. The determination of novel “cocktail” was validated in terms of recovery, linearity, precision and accuracy and applied to the analysis of plasma samples in rats. Therefore, in the present study, we investigated the effect of aescin on the activity and mRNA expression of four major CYP isozymes (CYP1A2, CYP2C9, CYP2E1 and CYP3A4) in rats. According to our results, it indicated that CYP1A2 activity significantly induced by aescin after a single dose or multiple doses of aescin administrations in rats. The differences between a single dose and multiple doses of aescin suggest that the subtypes of enzymes affected did not correlate with the length of administration. Interestingly, the study results of gene level also show that aescin can induce the mRNA expression of CYP1A2, which were consistent with the pharmacokinetic results. As we know, CYP1A2 accounts for about 13% of the total CYP content in human liver (Shimada et al., 1994) and is involved in the metabolism of several endogenous compounds and some widely used drugs, also it could activate the procarcinogens such as aflatoxin B1, the commonly recognized hepatocarcinogen (Mustajoki et al., 1994). The above results show that when aescin is used in combination with other drugs which metabolized by the CYP1A2, the potential herb–drug interactions should be pay more attention so as to reduce some adverse reactions or the failure in treatment due to low plasma concentration. CYP2C9 is one of the most abundant CYP enzymes in the human liver ( 20% of hepatic total CYP content), where it metabolizes approximately 15% clinical drugs (4100 drugs), including a number of drugs with narrow therapeutic ranges (Miners and Birkett, 1998). In addition, CYP3A4 was known as the rate-limiting step in the metabolism and clearance of a large variety of clinical medications, including many pediatric drugs (Lu et al., 2003). Therefore, the induction or inhibition on activity of CYP2C9 and CYP3A4 may lead to some undesirable effects. According to our results, both CYP2C9 and CYP3A4 activity could be significantly inhibited by aescin after a single dose or multiple doses of aescin administrations in rats. The study results also show that aescin can induce the mRNA expression of CYP2C9 and CYP3A4 in different dosages, which were consistent with the pharmacokinetic results. Thus, co-administration with aescin, drugs metabolized by human CYP2C9 and CYP3A4 may need dose adjustment to avoid an undesirable herb–drug interaction. CYP2E1 has a unique capacity to activate many xenobiotics to hepatotoxic or carcinogenic products. CYP2E1 is responsible for the metabolism of a large number of low-molecular-weight chemicals, such as aliphatic, aromatic, and halogenated
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
R. Xu et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎
8
hydrocarbons (Yao et al., 2011). Due to its ability to metabolize the compounds, CYP2E1 may be an important determinant factor of humans' susceptibility to toxicity and carcinogenicity of industrial and environmental chemicals. In our study, we found that there was no significant difference of the pharmacokinetic parameters of chlorzoxazone before and after administration of aescin. Moreover, the mRNA expression result of CYP2E1 activity in rats were consistent with the pharmacokinetic results. It suggests that aescin has no inductive or inhibitory effect on the activity of CYP2E1 after long period of administrations in rats. In conclusion, the inconspicuous effect of aescin on CYP2E1 suggested that there are no clinically relevant herb–drug interactions between the drugs metabolized by this enzyme and aescin when they are used concomitantly. In addition, from our present results, we cannot exclude that comedication of aescin with drugs metabolized by CYP1A2 may induce metabolism of these drugs and decrease plasma concentrations of these drugs, which will result in herb–drug interactions. However, CYP2C9 and CYP3A4 enzyme activitise were inhibited after a single dose or multiple doses treatment of aescin. Finally, the effects of aescin on the CYP activities were more potent after multiple doses treatment, which suggest that multiple doses treatment could be a better route to investigate the effect of aescin. Further clinical studies are required to fully assess the safety of aescin in terms of CYP. Acknowledgment This work was supported by fund of the key academic subject (clinical Chinese pharmacy) of the Twelfth-Five Year Program of state administration of traditional chinese medicine. References Bush, T.M., Rayburn, K.S., Holloway, S.W., Sanchez-Yamamoto, D.S., Allen, B.L., Lam, T., So, B.K., Tran de, H., Greyber, E.R., Kantor, S., Roth, L.W., 2007. Adverse interactions between herbal and dietary substances and prescription medications: a clinical survey. Altern. Therapies Health Med. 13, 30–35. Carrasco, O.F., Vidrio, H., 2007. Endothelium protectant and contractile effects of the antivaricose principle escin in rat aorta. Vascular Pharmacol. 47, 68–73. Chan, E., Tan, M., Xin, J., Sudarsanam, S., Johnson, D.E., 2010. Interactions between traditional Chinese medicines and Western Ther.ics. Curr. Opin. Drug Discov. Devel. 13, 50–65. De Smet, P.A., 2002. Herbal remedies. N. England J. Med. 347, 2046–2056. Foster, B.C., Arnason, J.T., Briggs, C.J., 2005. Natural health products and drug disposition. Ann. Rev. Pharmacol. Toxicol. 45, 203–226. Fu, F., Hou, Y., Jiang, W., Wang, R., Liu, K., 2005. Escin: inhibiting inflammation and promoting gastrointestinal transit to attenuate formation of postoperative adhesions. World J. Surg. 29, 1614-1620; discussion 1621-1612.
Gao, J., Shi, Z., Zhu, S., Li, G.Q., Yan, R., Yao, M., 2013. Influences of processed rhubarbs on the activities of four CYP isozymes and the metabolism of saxagliptin in rats based on probe cocktail and pharmacokinetics approaches. J. Ethnopharmacol. 145, 566–572. Guengerich, F.P., 1997. Role of cytochrome P450 enzymes in drug-drug interactions. Adv. Pharmacol. 43, 7–35. Guney, G., Kutlu, H.M., Iscan, A., 2013. The apoptotic effects of escin in the h-ras transformed 5RP7 cell line. Phytotherapy Res. 27, 900–905. Han, Y.L., Li, D., Ren, B., Jing, G.P., Meng, X.L., Zhou, Z.Y., Yu, Q., Li, Y., Wan, L.L., Guo, C., 2012. Evaluation of impact of Herba Erigerontis injection, a Chinese herbal prescription, on rat hepatic cytochrome P450 enzymes by cocktail probe drugs. J. Ethnopharmacol. 139, 104–109. Hellum, B.H., Hu, Z., Nilsen, O.G., 2007. The induction of CYP1A2, CYP2D6 and CYP3A4 by six trade herbal products in cultured primary human hepatocytes. Basic Clin. Pharmacol. Toxicol. 100, 23–30. Huang, S.M., Temple, R., Throckmorton, D.C., Lesko, L.J., 2007. Drug interaction studies: study design, data analysis, and implications for dosing and labeling. Clin. Pharmacol. Ther.. 81, 298–304. Lu, S.K., Callahan, S.M., Brunner, L.J., 2003. Suppression of hepatic CYP3A1/2 and CYP2C11 by cyclosporine is not mediated by altering growth hormone levels. J. Pharmacol. Exp. Ther.. 305, 331–337. Miners, J.O., Birkett, D.J., 1998. Cytochrome P4502C9: an enzyme of major importance in human drug metabolism. Br. J. Clin. Pharmacol. 45, 525–538. Mustajoki, P., Mustajoki, S., Rautio, A., Arvela, P., Pelkonen, O., 1994. Effects of heme arginate on cytochrome P450-mediated metabolism of drugs in patients with variegate porphyria and in healthy men. Clin. Pharmacol. Ther.. 56, 9–13. Rao, A.V., Gurfinkel, D.M., 2000. The bioactivity of saponins: triterpenoid and steroidal glycosides. Drug Metab. Drug Interac. 17, 211–235. Shen, D.Y., Kang, J.H., Song, W., Zhang, W.Q., Li, W.G., Zhao, Y., Chen, Q.X., 2011. Apoptosis of human cholangiocarcinoma cell lines induced by beta-escin through mitochondrial caspase-dependent pathway. Phytotherapy Res. 25, 1519–1526. Shimada, T., Yamazaki, H., Mimura, M., Inui, Y., Guengerich, F.P., 1994. Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: studies with liver microsomes of 30 Japanese and 30 Caucasians. J. Pharmacol. Exp. Ther.. 270, 414–423. Sipos, W., Reutterer, B., Frank, M., Unger, H., Grassauer, A., Prieschl-Grassauer, E., Doerfler, P., 2013. Escin inhibits type I allergic dermatitis in a novel porcine model. Int. Arch. Allergy Immunol. 161, 44–52. Su, T., Mao, C., Yin, F., Yu, Z., Lin, Y., Song, Y., Lu, T., 2013. Effects of unprocessed versus vinegar-processed Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes in rats. J. Ethnopharmacol. 146, 734–743. Tanaka, E., 1998. Clinically important pharmacokinetic drug–drug interactions: role of cytochrome P450 enzymes. J. Clin. Pharm. Ther. 23, 403–416. Wang, T., Fu, F., Zhang, L., Han, B., Zhu, M., Zhang, X., 2009. Effects of escin on acute inflammation and the immune system in mice. Pharmacol. Rep. 61, 697–704. Xie, Q., Zong, X., Ge, B., Wang, S., Ji, J., Ye, Y., Pan, L., 2009. Pilot postoperative ileus study of escin in cancer patients after colorectal surgery. World J. Surg. 33, 348–354. Yao, X.M., Wang, B.L., Gu, Y., Li, Y., 2011. Effects of bicyclol on the activity and expression of CYP450 enzymes of rats after partial hepatectomy. Yao Xue Xue Bao. Acta Pharmaceutica Sinica 46, 656–663. Zhou, S., Gao, Y., Jiang, W., Huang, M., Xu, A., Paxton, J.W., 2003. Interactions of herbs with cytochrome P450. Drug Metab. Rev. 35, 35–98. Zhou, S.F., Xue, C.C., Yu, X.Q., Wang, G., 2007. Metabolic activation of herbal and dietary constituents and its clinical and toxicological implications: an update. Curr. Drug Metab. 8, 526–553.
Please cite this article as: Huang, Y., et al., Effects of aescin on cytochrome P450 enzymes in rats. Journal of Ethnopharmacology (2013), http://dx.doi.org/10.1016/j.jep.2013.11.016i
