Aquatic Toxicology 164 (2015) 61–71

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus) Chang-Hong Cheng a,1 , Fang-Fang Yang b,1 , Ren-Zhi Ling a , Shao-An Liao a , Yu-Tao Miao a , Chao-Xia Ye a,∗ , An-Li Wang a,∗ a Key Laboratory of Ecology and Environmental Science of Guangdong Higher Education Institutes, Guangdong Provincial Key Laboratory for Healthy and Safe Aquaculture, School of Life Science, South China Normal University, Guangzhou 510631, PR China b Key Laboratory of Tropical Marine Bio-resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, PR China

a r t i c l e

i n f o

Article history: Received 16 January 2015 Received in revised form 30 March 2015 Accepted 2 April 2015 Available online 3 April 2015 Keywords: Takifugu obscurus Ammonia stress Apoptosis Oxidative stress Immune response

a b s t r a c t Ammonia is one of major environmental pollutants in the freshwater aquatic system that affects the survival and growth of organisms. In the present study, we investigated the effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Fish were exposed to various concentrations of ammonia (0, 1.43, 3.57, 7.14 mM) for 72 h. The date showed that ammonia exposure could induce intracellular reactive oxygen species (ROS), interrupt intracellular Ca2+ (cf-Ca2+ ) homeostasis, and subsequently lead to DNA damage and cell apoptosis. To test the apoptotic pathway, the expression patterns of some key apoptotic related genes including P53, Bax Bcl2, Caspase 9, Caspase 8 and Caspase 3 in the liver were examined. The results showed that ammonia stress could change these genes transcription, associated with increasing of cell apoptosis, suggesting that the P53–Bax–Bcl2 pathway and caspase-dependent apoptotic pathway could be involved in cell apoptosis induced by ammonia stress. In addition, ammonia stress could induced up-regulation of inflammatory cytokines (BAFF, TNF-␣, IL-6 and IL-12) transcription, indicating that innate immune system play important roles in ammonia-induced toxicity in fish. Furthermore, the gene expressions of antioxidant enzymes (Mn-SOD, CAT, GPx, and GR) and heat shock proteins (HSP90 and HSP70) in the liver were induced by ammonia stress, suggesting that antioxidant system and heat shock proteins tried to protect cells from oxidative stress and apoptosis induced by ammonia stress. Our results will be helpful to understand the mechanism of aquatic toxicology induced by ammonia in fish. © 2015 Published by Elsevier B.V.

1. Introduction Ammonia, an end product of protein catabolism, accounts for more than half the nitrogenous waste released by fish (Ruyet et al., 1995). It can also enter water bodies from several sources such as sewage effluents, industrial wastes, agricultural run-off and decomposition of biologic wastes (Randall and Tsui, 2002; Sinha et al., 2012). In aquatic environments, ammonia exists in two chemical forms, unionized ammonia (NH3 ) and ionized ammonium (NH4 + ) (Wajsbrot et al., 1993). NH3 can readily diffuse across the gill membranes due to its lipid solubility and lack of charge, whereas

∗ Corresponding authors. Tel.: +86 2085210141; fax: +86 2085210141. E-mail addresses: chaoxia [email protected] (C.-X. Ye), [email protected] (A.-L. Wang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.aquatox.2015.04.004 0166-445X/© 2015 Published by Elsevier B.V.

NH4 + occurs as a larger hydrated form with charged entities which cannot readily pass through the hydrophobic micropores in the gill membrane (Svobodova et al., 1993; Benli et al., 2008). Ammonia is one of major environmental pollutants in fish culture especially in recirculation systems. It has been reported that the concentration of ammonia increased directly with culture period, and might reach as high as 46 mg L−1 in intensive aquaculture systems (Chen et al., 1988). Elevated ammonia in aquaculture systems can accumulate uptake of ammonia across gill epithelium and cause very high concentrations in the body fluids (Eddy, 2005). Additionally, elevated concentration of ammonia in pond water can cause fish growth reduction, tissue erosion and degeneration, immune suppression and high mortality (Benli et al., 2008; Lia et al., 2014). However, the molecular mechanism of ammonia stress-induced toxicity remains unclear. It is well accepted that high ammonia level is physiologically harmful to aquatic animals (Benli et al., 2008; Lia et al.,

62

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

2014). Ammonia can cause oxidative stress in organisms, through increasing the concentration of reactive oxygen species (ROS) (Murthy et al., 2001). Overproduction of ROS can damage important biomolecules, such as DNA, proteins and lipids, and initiate a cascade of events, bringing about impaired cellular function (Halliwell, 1999; Suzuki et al., 2002). To counteract oxidative stress and keep cellular redox state in balance, cells evolve the antioxidant defense systems that act at different levels to prevent or repair such damage. Many studies have reported that antioxidant enzyme activity can be induced in low concentrations of pollutants and damaged under higher concentrations (Madeira et al., 2013; Rama and Manjabhat, 2014). Cellular oxidative stress occurs when the physiological antioxidant protection does not counteract the elevated ROS levels produced by stress (Livingstone et al., 1990). Previous study focus on the activity changes of antioxidant enzymes in fish under ammonia exposure (Hegazi et al., 2010). However, the molecular patterns of antioxidant enzymes in fish under ammonia exposure remain unknown largely. Heat shock proteins (HSPs) are another protection system to protect the organisms from oxidative stress by preventing the irreversible loss of vital proteins and facilitating their subsequent regeneration (Parsell and Lindquist, 1993; Jiang et al., 2012). HSPs are a group of highly conserved proteins whose expressions were induced by different kinds of stress conditions such as heat shock, oxidant injury, heavy metal pollution or bacterial infection (Sørensen et al., 2003). Although cells have diverse protective mechanisms against stress, an enhancement of stress beyond the ability of cells to cope with may lead to cell signaling disruption, extensive DNA damage, and cell apoptosis (Chandra et al., 2000). Apoptosis (programmed cell death) is a normal physiological process for removal of old,

excess, damaged, necrotic, or potentially dangerous cells such as virus-infected cells (Gao et al., 2013). It is one of central regulatory features of the immune defence mechanism against abiotic, biotic or chemical mediated stress (Teodoro and Branton, 1997; Junga et al., 2014). In mammals, cells undergo apoptosis through two major pathways, namely the extrinsic pathway (death receptor pathway) and the intrinsic pathway (mitochondrial pathway). Furthermore, DNA damage and subsequent P53 activation may also induce apoptotic cell death through a nuclear pathway (Luzio et al., 2013). Previous study has indicated that ammonia stress can directly induce DNA damage and apoptosis in cells (Suzuki et al., 2002). However, the precise mechanism of ammonia-induced apoptosis is not yet fully understood. The river pufferfish (Takifugu obscurus) is commercially very important in China. Pufferfish is an anadromous fish; this dynamic reproductive behavior exposes these fish to both freshwater and saltwater environments and a diverse range of aquatic pollutants (Kim et al., 2010). Therefore, this species provides a good opportunity for the study of stress responses (Kim et al., 2010). Although many studies have been carried out on the toxicity of ammonia, the effects of ammonia on the pathways of cell apoptosis, oxidative stress and immune response in aquatic fish species have not been previously investigated. In the present study, we evaluated the effects of ammonia exposure on apoptosis, ROS production, intracellular Ca2+ concentration, DNA damage in pufferfish. Furthermore, the transcriptional changes of some key related to apoptosis genes (P53, Bax Bcl2, Caspase 9, Caspase 8 and Caspase 3), the genes related to the innate immune system (BAFF, TNF-␣, IL-6 and IL-12), the antioxidant enzyme genes (Mn-SOD, CAT, GPx and GR) and heat shock proteins (HSP70 and HSP90), were also examined in this study. This information provides new insight into the molecular and cellular mechanism of ammonia toxicity.

Table 1 The sequences of primers in this experiment. Target gene

Primer sequence (5 -3 )

P53

F:GCTTGGAAAATGAGCAATGGCA R:CTCGGAGTAGGTGGAGGTGACG F:GGAGATGAGCTGGATGGAAATG R:GTCTGCCAGGTGGGGGTGCC F:GCGTCTCCATCCGCAGGTGC R:TGCCGCGGCGTCGTCCCC F:ATCGTCCAGTTATCCAACCCCTTC R:GGCTTCAGTCTCATGTACTCCCGC F:GCTGCTCCACACTATCCATCGAAA R: AGACCCTTCTTTTCCATTTCAGTAA F:CGAGGGCGTGTTTTTTGGT R:GGGATCTTGGTGGTGCTGC F:GCCGACAGGCATGTTGGAGACC R:CAGGTCGTCGGCCTTCTCGTG F: CCTTCCTCTCAGCAGTGTCC R: CCGCCTCAAAGACAGAAAAG F: TCGTGGTGGTCCTCTGTTGC R: CTTGGCTTTGCTGCTGATGC F: GCTGGAAAACAAGGTGAGGGA R: TGTGGAAGGTGTCGGGGTAGT F:AGACGGACGGGAGCAGTGGC R:GGTCTGGCTGTGGCAGGTGT F:AGATGTCCGCCGCTACAGTTGC R:GCCAAGGAGCGGGATGAGACC F:TGAGCCAAGCCCTGACAAGATGC R:GGTAGTTGGCCACACGGGTTCTG F:TGTCCGTCCTGGAGGTGGTTTCG R:ACTTTGGGTCAGCCATGAGAGC F:CTCACACCTGTTGCCATTGCTGC R:GCCTCCTCTTCTGTTAGTCCCAC F:TTTGGTGTGGGATTTTACTCAGCCTAC R:TTGTCCGTCCTGACTGTAAATGAACCT F:GCAGAAGCCTACCTCGGAAAGAC R:CGCCAAGATCAAAAATCAACACG F:CATCACCATCGGCAACGAGAGG R:CGTCGCACTTCATGATGCTGTTG

Bax Bcl2 Caspase 9 Caspase 8 Caspase 3 Cu/Zn-SOD BAFF TNF-␣ IL-6 IL-12 Mn-SOD CAT GPx GR HSP90 HSP70 ␤-Actin

2. Materials and methods 2.1. Animals Pufferfish (with average body weight 25.5 ± 1.8 g) were supplied by a fish farm in Panyu (Guangdong, China), and acclimated for two weeks in 250 L cycling-filtered plastic tanks containing continuously circulating aerated water at 25 ± 1 ◦ C (pH 7.5; 6.2 mg/L dissolved oxygen). During the acclimation period, the commercial fish diet (42% protein, 8.0% fat, 5.0% fiber and 15% ash, supplied by Haida Group Foods, Guangdong, China) was employed to feed twice a day until 24 h before the experimental treatments.

2.2. Ammonia challenge experiments A stock solution of high purity NH4 Cl (10 g L−1 ) was used as a source of the total ammonia–nitrogen (TAN), which was subsequently diluted to the desired concentrations of TAN. Test concentrations of TAN were 0 (control), 1.43 (low), 3.57 (middle), and 7.14 (high) mM. Thirty fish were randomly selected and placed in a plastic tank exposure chamber containing 100 L of test solution. Three replicate exposure chambers were employed in each group. During the exposure experiment, the pH values of water aquaria were every 12 h registered using a pH meter. The TAN levels were measured by nesslerization (Hegazi et al., 2010) and adjusted by adding NH4 Cl solution every 12 h. After exposure for 0, 3, 6, 12, 24, 48 and 72 h, six fish from each group were randomly sampled and dissected after anesthesia in tricaine methanesulfonate (MS222). The blood and liver samples were collected for assays of flow cytometer, DNA damage, gene expression.

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

63

2.3. Flow cytometer analysis 2.3.1. Respiratory burst measurements To monitor the level of respiratory burst, we used the cellpermeant probe 2 ,7 -dichlorofluorescein diacetate (DCFH-DA, Sigma) method, as described by Xian et al. (2009). A volume of 200 ␮L blood cells suspension was diluted with anticoagulant solution to obtain a final concentration of 1 × 106 cells/mL. DCFH-DA was set at a final concentration of 10 ␮M for 30 min in the dark at room temperature. Then the fluorescence of the cell suspensions was analyzed using the flow cytometer (Becton–Dickinson FACSCalibur). Two light-scattering parameters (forward scatter and side scatter) of flow cytometer were used to define a gate that excluded debris and aggregates from all fluorescence analyses. Typically, 10,000 cells were analyzed for the two fluorescent signals. ROS production was expressed as mean fluorescence of DCF. 2.3.2. Cytoplasmic free-Ca2+ concentration To detect the level of intracellular calcium concentration, the cell-permeant probe Fluo-3/acetoxymethyl ester (fluo-3/AM, Sigma) was used by previously described methods (Xian et al., 2010). A volume of 200 ␮L blood cells suspension was diluted with anticoagulant solution to obtain a final concentration of 1 × 106 cells/mL, and then incubated with 10 ␮M fluo-3/AM for 30 min in the dark. Then the fluorescence of the cell suspensions was analyzed by flow cytometer. Cytoplasmic free-Ca2+ concentration was expressed as mean fluorescence of fluo-3. 2.3.3. Apoptotic cell ratio The apoptosis of blood cells were determined by flow cytometry using an apoptosis detection kit (Invitrogen) following the manufacturer’s instructions. The collected blood cells were diluted with anticoagulant solution to obtain a final concentration of 1 × 106 cells. The pellets were resuspended by Annexin V-FITC binding buffer, and then incubated with Annexin V-FITC in dark at 20–25 ◦ C for 10 min. Samples were then analyzed by flow cytometer. 2.4. Single-cell gel electrophoresis-comet assay The procedures for the comet assay were carried out according to a modification of the procedures described by Singh et al. (1988). Sub-samples from each of the three sets of pooled samples were diluted with Hanks’ balanced salt solution to a density of 105 –106 cells/mL. The blood cells from in each group were collected at 0, 3, 6, 12, 24, 48 and 72 h after exposure to ammonia stress. A 20 ␮L portion of each cell suspension was mixed with 50 ␮L of 0.75% low melting point agarose at 37 ◦ C. The mixture was dropped onto a bottom layer of 0.5% normal melting point agarose on glass slides. The agarose was allowed to solidify at 4 ◦ C for 10 min. The slides were immersed in fresh cold lysing solution (2.5 M NaCl, 100 mM EDTA, 10 mM Tris, 1% Triton X-100, pH 10, and 10% DMSO) at 4 ◦ C for 2 h. Then, the slides were rinsed with chilled pure water to remove residual detergent and salts and placed in electrophoresis buffer ((0.3 M NaOH, 1 mM EDTA, pH > 13) for 20 min at 4 ◦ C to allow the DNA to unwind. Electrophoresis of slides in the unwinding buffer was carried out at 200 mA and 20 V for 20 min. After electrophoresis, the slides were neutralized in cold neutralization buffer (0.4 M Trise-HCl, pH 7.5) for 10 min, dehydrated in ethanol for 15 min and stored in the dark at room temperature. The slides were washed twice with water, drained and stained with SYBR GOLD (1:10000) for 2 min. The cells were determined by an Olympus fluorescence microscope equipped with an automatic digital analysis system (Nikon, Coolpix E995). At least 100 randomly chosen cells on each slide were examined, and the CASP image analysis system (Koca et al., 2003) was used to measure the comet tail moment (a product of the fraction of DNA in the tail and the tail length), which is

Fig. 1. Respiratory burst activity (a), cytoplasmic free-Ca2+ concentration (b) and percentage of apoptotic cell (c) in the blood cells of pufferfish in response to ammonia challenge. Results are expressed as mean ± SD for triplicate samples. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

positively correlated with the extent of DNA breakage in a cell. The olive tail moment (OTM), which is the product of the amount of DNA in the tail and the mean distance of migration of DNA in the tail, is automatically calculated by the computer software system for each cell (Olive et al., 1990). 2.5. Total RNA extraction and cDNA synthesis Total RNA was isolated from the liver tissue using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions and then dissolved in DEPC treated water. The quantity of isolated

64

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

Fig. 2. Effect of ammonia on DNA damage by comet assay. (A) Comet pictures of blood cells stained with SYBR GOLD and photographed under a fluorescence photomicroscope for fish exposed to 100 mg L−1 ammonia stress. (a) 0 h; (b) 24 h; (c) 48 h; (d) 72 h. (B) The value in pufferfish blood cells at different times during exposure to 0, 20, 50, 100 mg L−1 ammonia stress. Results are expressed as mean ± SD for triplicate samples. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

RNA was later determined by measuring their absorbance at 260 and 280 nm using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, USA), and its integrity was tested by electrophoresis in 1.2% agarose gel. Single-stranded cDNA was synthesized from 1 ␮g total RNA using PrimeScript RT reagent Kit With gDNA Eraser (Takara, Dalian, China) following the manufacturer’s instructions. The cDNA templates were then stored at −80 ◦ C for later analysis.

2.6. Real-time PCR (RT-PCR) The specific primers were designed based on published pufferfish mRNA using Primer Premier 5 shown in Table 1. The ␤-actin gene was used as a housekeeping gene and it was amplified using ␤-actin-F and ␤-actin-R gene-specific primers. Real-time PCR was amplified in an ABI 7500 real-time PCR machine (Applied Biosystems, USA) using SYBR Premix Ex Taq (Takara, Dalian, China)

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

65

Fig. 3. Relative expression levels of apoptosis-related genes P53 (a), Bax (b), Bcl2 (c), caspase 9 (d), caspase 8 (e) and caspase 3 (f) at 0, 3, 6, 12, 24, 48 and 72 h after ammonia challenge in liver. The relative expression of transcript from qRT-PCR was calculated based on the standard curve and normalized to the ␤-actin mRNA level. Data are presented as the mean ± SD. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

following the manufacturer’s recommendations. Before the RT-PCR experiments, the specificity and efficiency of the primes above were detected. The standard equation and correlation coefficient were determined by constructing a standard curve using a serial dilution of cDNA. The reaction mixtures were 20 ␮L, containing 2 ␮L cDNA sample, 0.4 ␮L ROX, 10 ␮L 2× SYBR Premix Ex Taq 0.4 ␮L each of the 10 mM forward and reverse primers, and 6.8 ␮L dH2 O. The

real-time PCR conditions were as follows: 94 ◦ C for 10 min, then 45 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s and 72 ◦ C for 30 s, followed by 10 min at 72 ◦ C. All samples were run in triplicate, and each assay was repeated three times. After finishing the program, the threshold cycle (Ct) values were obtained from each sample. Relative gene expression levels were evaluated using 2−CT method (Livak and Schmittgen, 2001).

66

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

Fig. 4. Relative expression levels of inflammatory cytokines BAFF (a), TNF-␣ (b), IL-6 (c) and IL-12 (d) at 0, 3, 6, 12, 24, 48 and 72 h after ammonia challenge in liver. The relative expression of the transcript from qRT-PCR was calculated based on the standard curve and normalized to the ␤-actin mRNA level. Data are presented as the mean ± SD. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

2.7. Statistical analysis All data were expressed as means ± standard deviation. Analysis of variance (ANOVA) followed by a multiple comparison (Tukey) test was conducted to compare the significant differences among treatments using SPSS 18.0 software (SPSS, Chicago, IL, USA). P < 0.05 was considered to be statistically significant.

apoptotic cell at 3 h after exposed to 1.43 mM ammonia. Apoptotic cell ratio of blood cells increased significantly to 5.35%, 7.43%, 5.58%, 9.48% and 8.32% at 6, 12, 24, 48 and 72 h after exposed to 1.43 mM ammonia, respectively. Our results showed that during 3.57 and 7.14 mM ammonia exposure, apoptotic cell ratio was higher than that in the control group throughout the entire exposure experiment.

3. Results

3.4. Effect of ammonia exposure on DNA damage

3.1. Effect of ammonia exposure on ROS production

The effect of ammonia exposure on DNA damage was shown Fig. 2. The olive tail moment (OTM) of blood cells of the control group remained constant throughout 72 h exposure period. The OTM value did not change at 3 h after exposed to 1.43 mM ammonia, but a subsequently significant increase in the OTM value was recorded. After exposure to 50 and 7.14 mM ammonia, the OTM value increased significantly throughout the 72 h exposure period. The highest OTM value was observed at 48 h after exposure to 7.14 mM ammonia.

Effect of ammonia exposure on ROS production was presented in Fig. 1a. No significant difference in ROS production was observed at 3 h after exposed to 1.43 mM ammonia. The ROS production increased significantly at 6, 12, 24, 48 and 72 h after exposed to 1.43, 3.57 and 7.14 mM ammonia. 3.2. Effect of ammonia exposure on cytoplasmic free-Ca2+ The effect of ammonia exposure on cf-Ca2+ was shown in Fig. 1b. Cf-Ca2+ concentration increased significantly throughout the entire exposure experiment. The highest cf-Ca2+ concentration occurred at 72 h after exposed to 7.14 mM ammonia. 3.3. Effect of ammonia exposure on apoptotic cell ratio At the beginning, the percentage of apoptotic cell was 1.1% (Fig. 1c). There were no significant differences in the percentage of

3.5. Effect of ammonia exposure on apoptosis-related gene transcription Fig. 3 showed the altered expression of genes related to apoptotic signaling processes after ammonia exposure. The mRNA levels of P53 increased significantly after exposure to various concentrations of ammonia for 72 h compared with the control group (Fig. 3a). As a pro-apoptotic member of the Bcl2 family, Bax transcription

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

67

Fig. 5. Relative expression levels of antioxidant enzyme genes Mn-SOD (a), CAT (b), GPx (c) and GR (d) at 0, 3, 6, 12, 24, 48 and 72 h after ammonia challenge in liver. The relative expression of the transcript from qRT-PCR was calculated based on the standard curve and normalized to the ␤-actin mRNA level. Data are presented as the mean ± SD. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

patterns were up-regulated when exposed to 3.57 and 7.14 mM ammonia. The transcript level of Bax did not change at 3 and 6 h, but increased significantly at 12, 24, 48 and 72 h when exposed to 1.43 mM ammonia (Fig. 3b). As an anti-apoptotic protein, Bcl2 transcription patterns were down-regulated when exposed to 3.57 and 7.14 mM ammonia compared with the control group (Fig. 3c). The mRNA levels of Bcl2 were not significantly influenced at 3, 6, 12, 24 and 48 h, but down-regulated at 72 h after 1.43 mM ammonia exposure. To assess whether ammonia stress induces apoptosis via the Caspase pathway, the transcription of three key genes of Caspase 9, Caspase 8 and Caspase 3 were also examined. The Caspase 9 transcript level was increased significantly after exposure to various concentrations of ammonia for 72 h (Fig. 3d). The mRNA level of Caspase 8 was increased significantly after exposure to 7.14 mM ammonia for 72 h, while the Caspase 8 transcript level was increased significantly at 3 and 6 h, but fell back to normal levels at 12, 24, 48 and 72 h after exposed to 1.43 mM ammonia (Fig. 3e). A significantly increased expression of Caspase 3 was observed at 3, 6, 12, 24, 48 and 72 h after exposure to various concentrations of ammonia, respectively (Fig. 3f).

and IL-12) after ammonia stress. As shown in Fig. 4, these genes were up-regulated after exposure to various concentrations of ammonia for 72 h.

3.6. Effect of ammonia exposure on innate immune system-related gene transcription

3.8. Effect of ammonia exposure on heat shock proteins gene transcription

Quantitative real-time PCR was used to investigate the mRNA levels of innate immune system-related genes (BAFF, TNF␣, IL-6

The effects of ammonia stress on the mRNA expression of HSP90 and HSP70 were shown in Fig. 6. The transcript level of HSP70

3.7. Effect of ammonia exposure on antioxidant enzyme gene transcription To characterize the expression patterns of genes related to antioxidant enzyme responses to ammonia, the mRNA levels of Mn-SOD, CAT, GPx and GR were determined (Fig. 5). The transcript level of Mn-SOD increased significantly at 3 h, and it returned to its original level at 6 h and 12 h (Fig. 5a). A significantly increased expression of CAT was observed after exposure to various concentrations of ammonia for 72 h (Fig. 5b). The GPx transcript level was increased significantly when exposed to 1.43 and 3.57 mM ammonia. After exposed to 7.14 mM ammonia, the GPx transcript level was increased significantly at 3 h, and then decreased significantly at 6 and 12 h, but then increased significantly until the end of the experiment (Fig. 5c). A significant induction of GR was also found in the group when exposed to ammonia (Fig. 5d).

68

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

Fig. 6. Relative expression levels of heat shock proteins-related genes HSP90 (a) and HSP70 (b) at 0, 3, 6, 12, 24, 48 and 72 h after ammonia challenge in liver. The relative expression of the transcript from qRT-PCR was calculated based on the standard curve and normalized to the ␤-actin mRNA level. Data are presented as the mean ± SD. Dates at the same time with different letters are significantly different (P < 0.05) among treatments.

significantly increased at 3 and 6 h, but fell back to the normal levels at 12 h, and then increased again at 24, 48 and 72 h after exposure to 1.43 mM ammonia (Fig. 6a). HSP90 mRNA level were up-regulated in a concentration-dependent manner. After exposed to 1.43 mM ammonia, the HSP90 transcript level was increased significantly at 3, 6, 12 and 24 h, but fell back to the normal levels at 48 and 72 h, while HSP70 mRNA level was significantly induced at 3, 6 and 72 h after exposure to 7.14 mM ammonia.

4. Discussion Ammonia, an environmental toxicant, is problematic for aquatic animals. The research about the mechanism of ammonia toxicity in fish is still limited. The aim of this study was to clarify the possible mechanism of ammonia toxicity in fish. Thus, we investigated the effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish. In the present study, a high percentage of apoptotic cells were observed after ammonia exposure. Several conditions, molecules and organelles such as oxidative stress, mitochondria, Ca2+ , proteases or nucleases may involve in the apoptosis (Chen et al., 2006). Reactive oxygen species (ROS) are important for apoptosis. Generation of excess ROS can impair mitochondrial membrane permeability and the respiratory chain. Under normal conditions, ROS was quickly eliminated by antioxidant defense system. However, under environmental stress, the balance between the production of ROS and antioxidant defense is disturbed. Previous studies have found up-regulation of ROS in fish cells after treatment with chemical environmental contaminants (Hegazi et al., 2010; Zhang et al., 2012). In our study, the ROS level increased significantly after ammonia exposure, indicating that ammonia exposure induced oxidative stress. Our result also showed that the number of apoptotic cells was increased after ammonia exposure, which was closely related to the overproduction of ROS. It has been reported that an increase of cf-Ca2+ concentration, which may be stimulated by ROS, can trigger the apoptosis pathway (Rizzuto et al., 2003). Interruption of Ca2+ homeostasis induced by environmental toxicants can activate hydrolytic enzymes, lead to exaggerated energy expenditure, impair energy production, initiate cytoskeletal degradation and ultimately result in cell death (Nicotera and Orrenius, 1998). In this study, cf-Ca2+ concentration increased significantly after ammonia exposure. This result suggested that Ca2+ signaling might play an important role in the mechanism of apoptosis induced by ammonia. Taken together, our results further suggested

that ammonia exposure produced ROS, interrupted Ca2+ homeostasis, and subsequently triggered cell apoptosis. Previous study has shown that oxidative stress has a close relationship with DNA damage (Jin et al., 2011a,b). ROS can modify DNA bases and cause strand scission by degrading the ribose ring. The single-cell gel electrophoresis assay is one of the most promising genotoxicity tests developed to measure and analyze DNA damage in single cells (Olive et al., 1990; Koca et al., 2003; Jin et al., 2011a,b). Numerous studies have shown that DNA damage is observed in fish cells after treatment with chemical environmental contaminants (Maia et al., 2010; Jin et al., 2011a,b; Selvaraj et al., 2013). In the present study, DNA damage occurred after ammonia exposure. Meanwhile, the overproduction of ROS was observed, which strongly suggested that oxidative stress play an essential role in ammonia-induced DNA damage. The tumor suppressor P53 is known to play an important role in regulating apoptosis and cell proliferation. ROS generation induced by cellular stresses can regulate P53 activity. Activation of P53 initiates a program of cell cycle arrest, cellular senescence or apoptosis. In this study, after ammonia exposure, expression of P53 increased significantly, suggesting that P53 could be involved in ammonia-induced apoptosis. Moreover, P53 can induce apoptosis by up-regulating the transcription of pro-apoptotic genes and down-regulating that of anti-apoptotic genes, such as Bcl2 family (Zeng et al., 2014). Bax a pro-apoptotic member of the Bcl2 family located in the outer membrane of mitochondria, is a direct target of P53 transcriptional activation (Jin et al., 2011a,b). Bax can induce the release of cytochrome c into the cytosol, whereas the anti-apoptotic Bcl2 can inhibit the release of cytochrome c from mitochondria. Alterations in intracellular Bcl2 and Bax expression ratios can affect mitochondrial cytochrome c release (Hildeman et al., 2003; Zhang et al., 2012). The increase of the Bax-to-Bcl2 ratio can induce cell apoptosis (Whiteman et al., 2007). In the present study, the Bax-to-Bcl2 ratio was increased in response to ammonia exposure, suggesting that ammonia might trigger apoptosis via a P53–Bax–Bcl2 pathway. Caspase activity is a useful marker for detecting stress-induced apoptosis in the early-life stages of fish. Two general pathways of apoptosis are widely recognized: the extrinsic death receptor pathway and intrinsic mitochondrial pathway. The extrinsic death receptor pathway is modulated by recognition of extracellular ligands with transmembrane receptors, which directly activates the initiator Caspase 8 (Mardones and Escárate, 2014). The intrinsic mitochondrial pathway is initiated by the release of cytochrome c from the mitochondria. The cytochrome c can active

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

69

Fig. 7. The plausible mechanism of ammonia-induced apoptosis, oxidative stress and immune response in pufferfish.

downstream effector Caspase 9 and Caspase 3 through formation of the cytochrome c/Apaf-1/Caspase 9-containing apoptosome (Fulda and Debatin, 2006). The activation of Caspase 3 causes the cleavage of a series of proteins, such as nuclear lamins, fodrin, leading to cell apoptosis (Liu et al., 2013; Mardones and Escárate, 2014). The present study showed that ammonia exposure increased expressions of Caspase 9, Caspase 8 and Caspase 3, which further indicated that caspase-dependent apoptotic pathway may involve in ammonia induced apoptosis of pufferfish. The overproduction of ROS not only causes cell apoptosis, but also initiates inflammation (Kim et al., 2011). Inflammation is critical to the efficiency of the innate and subsequent adaptive response to any type of infection (Collet, 2014). Environmental chemicals, bacteria or viruses could induce or inhibit mRNA expression of innate immune-related cytokines. B-cell activating factor (BAFF) is considered as an important member of the TNF family of cytokines, playing a pivotal role in the regulation of innate immune system against the infectious and inflammatory diseases (Ai et al., 2011). Activation of BAFF can lead to activation of NF-␬B and thus increasing the expression of proinflammatory cytokines. TNF-␣ is another pleiotropic proinflammatory cytokine involved in inflammation, apoptosis, cell proliferation, and the general stimulation of the immune system (Lama et al., 2011). Activation of TNF-␣ can also active NF-␬B passageway. NF-␬B is targeted as an integral messenger in the enhancement of the response to environmental perturbation, activating a series of cellular genes related to proinflammatory and cytotoxic cytokines including iNOS, IL-1, IL-6 and IL-12 (Liu et al., 1995; Jia et al., 2014). In the present study, ammonia exposure altered the expression patterns of cytokines including BAFF, TNF-␣ IL-6 and IL-12, suggesting that ammonia exposure induced the immune response in pufferfish. Oxidative stress exposed to ammonia stress is indicated by changes in ROS production in pufferfish. However, organisms have an intracellular ROS-scavenging system for protecting themselves against the toxic effects of ROS. A major defense mechanism for reducing the production of ROS is achieved by raising the levels of antioxidant enzymes, such as superoxide dismutase

(SOD), glutathione peroxidase (GPx), catalase (CAT) and glutathione reductase (GR). The superoxide anion, the parental form of intracellular ROS, is a highly active molecule, but it can be converted to H2 O2 by SOD (Jin et al., 2011a,b). GPx and CAT eliminate H2 O2 effectively, thus reducing its toxic effect. GSH is also an effective antioxidant which could directly scavenge singlet oxygen and hydroxyl radicals to intact cells under oxidative stress. The regeneration of GSH depends on GR, which could catalyze the reduction of GSSG back to GSH (Jiang et al., 2014). In the present study, the mRNA expression of antioxidant enzymes was changed after ammonia exposure. Hegazi et al. (2010) also reports that chronic ammonia exposure can induce oxidative stress in liver and white muscle of Nile tilapia juveniles, which in turn alters antioxidant enzymes to prevent oxidative damage. Heat shock proteins (HSPs) function as molecular chaperones, refolding stress-denatured protein, preventing protein aggregation, or assisting in the folding of nascent proteins, and are considered to play critical roles in protecting cells against oxidative stress (Parsell and Lindquist, 1993; Jiang et al., 2012). Among Hsps, HSP70 can assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins (Xu et al., 2014). HSP70 is related to the modulation of cellular redox status and reduction of ROS level (Azad et al., 2011). HSP70 has been known to involve in stress response, intracellular trafficking, anti-apoptotic, antigen processing, or chaperonic function (Bermejo-Nogales et al., 2014). HSP90 is often found in a constitutive dimmer, which plays a pivotal role in controlling multiple regulatory pathways such as stress defense, hormone signaling, cell cycle control, cell proliferation and differentiation, and apoptosis (Rajeshkumar et al., 2013). Enhanced levels of HSP70 and HSP90 in fish may reflect a protective response against environmental pollutant-related stress. Results of the present study showed that environmental ammonia stress changed the HSP70 and HSP90 transcription. This result suggested that HSPs were crucial for protein repair, protein synthesis and degradation,

70

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71

prevention of apoptosis and cellular signaling exposed to ammonia stress in pufferfish. 5. Conclusion In summary, we demonstrated the effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Fig. 7). Our results indicated that ammonia exposure could induce ROS, interrupt Ca2+ homeostasis, and subsequently lead to DNA damage and apoptosis. The P53–Bax–Bcl2 pathway and caspase-dependent apoptotic pathway were both involved in apoptosis induced by ammonia stress. Additionally, ammonia stress could cause the innate immune response. Antioxidant system and heat shock proteins tried to protect cells from oxidative stress and apoptosis. However, this system did not achieve an effective protection under the influence of intense oxidative conditions. According to the conclusion, we speculate that improving the ability of antioxidant defense may increase the tolerance of fish to ammonia exposure, via dietary supplemental antioxidant nutrients, such as vitamin C, vitamin E, immunostimulants and etc. Acknowledgements This research was supported by the National Natural Science Foundation of China (31100296 and 31402324), the China Postdoctoral Science Foundation (2012M511829), Science and technology achievement transformation funds of Ministry of Agriculture (2013GB2E000365),the Guangdong Provincial Natural Science Foundation (S2011020003256 and S2012040008093), the Scientific and Technological Planning Project of Guangdong Province (2011B020307010 and 2012B020307004), the Science and technology innovation of Higher School Guangdong Province (cxzd114), the Project of Guangdong Provincial Oceanic and Fishery Administration (A200901B06), Guangzhou Science and Technology Program Project (2014J4100052) and the Scientific and Technological Planning Project of Guangzhou City (11A82090870 and 12C432091991). References Ai, X.G., Shen, Y.F., Min, C., Pang, S.Y., Zhang, J.X., Zhang, S.Q., Zhao, Z.H., 2011. Molecular structure, expression and bioactivity characterization of TNF13B (BAFF) gene in mefugu Takifugu obscurus. Fish Shellfish Immunol. 30, 1265–1274. Azad, P., Ryu, J., Haddad, G.G., 2011. Distinct role of Hsp70 in Drosophila hemocytes during severe hypoxia. Free Radical Bio. Med. 51, 530–538. Benli, A.C.K., Köksal, G., Özkul, A., 2008. Sublethal ammonia exposure of Nile tilapia (Oreochromis niloticus L.): effects on gill liver and kidney histology. Chemosphere 72, 1355–1358. Bermejo-Nogales, A., Nederlof, M., Benedito-Palos, L., Ballester-Lozano, G.F., Folkedal, O., Olsen, R.E., Sitjà-Bobadilla, A., Pérez-Sánchez, J., 2014. Metabolic and transcriptional responses of gilthead sea bream (Sparus aurata L.) to environmental stress: new insights in fish mitochondrial phenotyping. Gen. Comp. Endocrinol. 205, 305–315. Chandra, J., Samali, A., Orrenius, S., 2000. Triggering and modulation of apoptosis by oxidative stress. Free Radical Biol. Med. 29, 323–333. Chen, J.C., Liu, P.C., Lin, Y.T., 1988. Super intensive culture of red-tailed shrimp Penaeus penicillatus. J. World Aquacult. Soc. 19, 127–131. Chen, X.Y., Shao, J.Z., Xiang, L.X., Liu, X.M., 2006. Involvement of apoptosis in malathion-induced cytotoxicity in a grass carp (Ctenopharyngodon idellus) cell line. Comp. Biochem. Phys. C 142, 36–42. Collet, B., 2014. Innate immune responses of salmonid fish to viral infections. Dev. Comp. Immunol. 43, 160–173. Eddy, F.B., 2005. Ammonia in estuaries and effect on fish. J. Fish Biol. 67, 1495–1513. Fulda, S., Debatin, K.M., 2006. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25, 4798–4811. Gao, D., Xu, Z., Zhang, X.Y., Zhu, C.C., Wang, W.N., Min, W.P., 2013. Cadmium triggers kidney cell apoptosis of purse red common carp (Cyprinus carpio) without caspase-8 activation. Dev. Comp. Immunol. 41, 728–737. Halliwell, B., 1999. Antioxidant defence mechanisms: from the beginning to the end (of the beginning). Free Radical Res. 31, 261–272.

Hegazi, M.M., Attia, Z.I., Ashour, O.A., 2010. Oxidative stress and antioxidant enzymes in liver and white muscle of Nile tilapia juveniles in chronic ammonia exposure. Aquat. Toxicol. 99, 118–125. Hildeman, D.A., Mitchell, T., Aronow, B., Wojciechowski, S., Kappler, J., Marrack, P., 2003. Control of Bcl-2 expression by reactive oxygen species. Proc. Natl. Acad. Sci. U.S.A. 100, 15035–15040. Jia, R., Cao, L.P., Du, J.L., Wang, J.H., Liu, Y.J., Jeney, G., Xu, P., Yin, G.J., 2014. Effects of carbon tetrachloride on oxidative stress, inflammatory response and hepatocyte apoptosis in common carp (Cyprinus carpio). Aquat. Toxicol. 152, 11–19. Jiang, J.L., Shi, Y., Shan, Z.J., Yang, L.Y., Wang, X.R., Shi, L.L., 2012. Bioaccumulation, oxidative stress and HSP70 expression in Cyprinus carpio L. exposed to microcystin-LR under laboratory conditions. Comp. Biochem. Phys. C 155, 483–490. Jiang, W.D., Liu, Y., Hua, K., Jiang, J., Li, S.H., Feng, L., Zhou, X.Q., 2014. Copper exposure induces oxidative injury, disturbs the antioxidant system and changes the Nrf2/ARE (CuZnSOD) signaling in the fish brain: protective effects of myo-inositol. Aquat. Toxicol. 155, 301–313. Jin, Y.X., Zheng, S.S., Fu, Z.W., 2011a. Embryonic exposure to cypermethrin induces apoptosis and immunotoxicity in zebrafish (Danio rerio). Fish Shellfish Immunol. 30, 1049–1054. Jin, Y.X., Zheng, S.S., Pu, P., Shu, L.J., Sun, L.W., Liu, W.P., Fu, Z.W., 2011b. Cypermethrin has the potential to induce hepatic oxidative stress, DNA damage and apoptosis in adult zebrafish (Danio rerio). Chemosphere 82, 398–404. Junga, M.H., Nikapitiya, C., Song, J.Y., Lee, J.H., Lee, J., Oha, M., Jung, S.J., 2014. Gene expression of pro- and anti-apoptotic proteins in rock bream (Oplegnathus fasciatus) infected with megalocytivirus (family Iridoviridae). Fish Shellfish Immunol. 37, 122–130. Kim, H.Y., Park, J., Lee, K.H., Lee, D.U., Kwak, J.H., Kim, Y.S., Lee, S.M., 2011. Ferulic acid protects against carbon tetrachloride-induced liver injury in mice. Toxicology 282, 104–111. Kim, J.H., Rhee, J.S., Lee, J.S., Dahms, H.U., Lee, J., Han, K.N., Lee, J.S., 2010. Effect of cadmium exposure on expression of antioxidant gene transcripts in the river pufferfish, Takifugu obscurus (Tetraodontiformes). Comp. Biochem. Phys. C 152, 473–479. ´ z, ´ S., Koza, Z., Koca, K., Lankoff, A., Banasik, A., Lisowska, H., Kuszewski, T., Gózd Wojcik, A., 2003. A cross-platform public domain PC image-analysis program for the comet assay. Mutat. Res. Genet. Toxicol. Environ. 534, 15–20. Lama, F.W.S., Wua, S.Y., Lina, S.J., Lina, C.C., Chen, Y.M., Wang, H.C., Chena, T.W., Lind, H.T., Lina, J.H.Y., 2011. The expression of two novel orange-spotted grouper (Epinephelus coioides) TNF genes in peripheral blood leukocytes, various organs, and fish larvae. Fish Shellfish Immunol. 30, 618–629. Lia, M., Yu, N., Qin, J.G., Li, E., Du, Z.Y., Chen, L.Q., 2014. Effects of ammonia stress, dietary linseed oil and Edwardsiella ictaluri challenge on juvenile darkbarbel catfish Pelteobagrus vachelli. Fish Shellfish Immunol. 38, 158–165. Liu, C.M., Zheng, G., Ming, H., Chao, Q.L., Sun, C.J.M., 2013. Sesamin protects mouse liver against nickel-induced oxidative DNA damage and apoptosis by the PI3KAkt pathway. J. Agric. Food Chem. 61, 1146–1154. Liu, S.L., Esposti, S.D., Yao, T., Diehl, A.M., Zern, M.A., 1995. Vitamin E therapy of acute CCl4 -induced hepatic injury in mice is associated with inhibition of nuclear factor kappa B binding. Hepatology 22, 1474–1481. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2−CT method. Methods 25, 402–408. Livingstone, D.R., Martinez, P.G., Michel, X., Narbonne, J.F., Ohara, S., Ribera, D., Winston, G.W., 1990. Oxyradical production as a pollution-mediated mechanism of toxicity in the common mussel, Mytilus edulis (L.), and other mollusks. Funct. Ecol. 4, 415–424. Luzio, A., Monteiro, S.M., Fontaínhas-Fernandes, A.A., Pinto-Carnide, O., Matos, M., Coimbra, A.M., 2013. Copper induced upregulation of apoptosis related genes in zebrafish (Danio rerio) gill. Aquat. Toxicol. 129, 183–189. Madeira, D.L., Narciso, H.N., Cabral, C., Vinagre, M.S., 2013. Influence of temperature in thermal and oxidative stress responses in estuarine fish. Comp. Biochem. Phys. A 166, 237–243. Maia, W.J., Yan, J.L., Wang, L., Zheng, Y., Xin, Y., Wang, W.N., 2010. Acute acidic exposure induces p53-mediated oxidative stress and DNA damage in tilapia (Oreochromis niloticus) blood cells. Aquat. Toxicol. 100, 271–281. Mardones, J.C., Escárate, C.G., 2014. Immune response of apoptosis-related cysteine peptidases from the red abalone Haliotis rufescens (HrCas8 and HrCas3): molecular characterization and transcription expression. Fish Shellfish Immunol. 39, 90–98. Murthy, C.R.K., Rama Rao, K.V., Bai, G., Norenberg, M.D., 2001. Ammonia-induced production of free radicals in primary cultures of rat astrocytes. J. Neurosci. Res. 66, 282–288. Nicotera, P., Orrenius, S., 1998. The role of calcium in apoptosis. Cell Calcium 23, 173–180. Olive, P., Banath, J., Durand, R., 1990. Heterogeneity in radiation-induced DNA damage and repair in tumor and normal cells measured using thecometassay. Radiat. Res. 122, 86–94. Parsell, D.A., Lindquist, S., 1993. The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27, 437–496.

C.-H. Cheng et al. / Aquatic Toxicology 164 (2015) 61–71 Rajeshkumar, S., Mini, J., Munuswamy, N., 2013. Effects of heavy metals on antioxidants and expression of HSP70 in different tissues of Milk fish (Chanos chanos) of Kaattuppalli Island, Chennai, India. Ecotoxicol. Environ. Saf. 98, 8–18. Rama, S., Manjabhat, S.N., 2014. Protective effect of shrimp carotenoids against ammonia stress in common carp, Cyprinus carpio. Ecotoxicol. Environ. Saf. 107, 207–213. Randall, D.J., Tsui, T.K., 2002. Ammonia toxicity in fish. Mar. Pollut. Bull. 45, 17–23. Rizzuto, R., Pinton, P., Ferrari, D., Chami, M., Szabadkai, G., Magalhaes, P.J., 2003. Calcium and apoptosis: facts and hypotheses. Oncogene 22, 8619–8627. Ruyet, J.P.L., Chartois, H., Quemener, L., 1995. Comparative acute ammonia toxicity in marine fish and plasma ammonia response. Aquaculture 136, 181–194. Selvaraj, W., Armistead, M.Y., Cohenford, M., Murray, E., 2013. Arsenic trioxide (As2O3) induces apoptosis and necrosis mediated cell death through mitochondrial membrane potential damage and elevated production of reactive oxygen species in PLHC-1 fish cell line. Chemosphere 90, 1201–1209. Singh, N., McCoy, M., Tice, R., Schneider, E., 1988. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp. Cell Res. 175, 184–191. Sinha, A.L., Liew, H.J., Diricxa, M., Blust, R., Boeck, G.D., 2012. The interactive effects of ammonia exposure, nutritional status and exercise on metabolic and physiological responses in gold fish (Carassius auratus L.). Aquat. Toxicol. 109, 33–46. Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 6, 1025–1037. Suzuki, H., Yanaka, A., Shibahara, T., Matsui, H., Nakahara, A., Tanaka, N., Muto, H., Momoi, T., Uchiyama, Y., 2002. Ammonia-induced apoptosis is accelerated at higher pH in gastric surface mucous cells. Am. J. Physiol. 283, 986–995. Svobodova, Z., Lloyd, R., Machova, J., 1993. Ammonia. Water Quality and Fish Health, 54. EIFAC Technical Paper, pp. 11–16.

71

Teodoro, J.G., Branton, P.E., 1997. Regulation of apoptosis by viral gene products. J. Virol. 71, 1739–1746. Wajsbrot, N., Gasith, A., Diamant, A., Popper, D.M., 1993. Chronic toxicity of ammonia to juvenile gilthead seabream Sparus aurata and related histopathological effects. J. Fish Biol. 42, 321–328. Whiteman, M., Chu, S.H., Siau, J.L., Rose, P., Sabapathy, K., Schantz, J.T., 2007. The proinflammatory oxidant hypochlorous acid induces Bax-dependent mitochondrial permeabilisation and cell death through AIF-/EndoG-dependent pathways. Cell Signal 19, 705–714. Xian, J.A., Wang, A.L., Tian, J.X., Huang, J.W., Ye, C.X., Wang, W.N., 2009. Physiological and immunological changes of haemocytes from Litopenaeus vanname treated by lipopolysaccharide. Aquaculture 98, 139–145. Xian, J.A., Wang, A.L., Ye, C.X., Chen, X.D., Wang, W.N., 2010. Phagocytic activity, respiratory burst, cytoplasmic free-Ca2+ concentration and apoptotic cell ratio of haemocytes from the black tiger shrimp, Penaeus monodon under acute copper stress. Comp. Biochem. Phys. C 152, 182–188. Xu, Y.P., Zheng, G.W., Dong, S.Z., Liu, G.F., Yu, X.P., 2014. Molecular cloning, characterization and expression analysis of HSP60, HSP70 and HSP90 in the golden apple snail, Pomacea canaliculata. Fish Shellfish Immunol. 41, 643–653. Zeng, C., Sun, H., Xie, P., Hua, J., Zhang, G., Chen, N., 2014. The role of apoptosis in MCLR-induced developmental toxicity in zebrafish embryos. Aquat. Toxicol. 149, 25–32. Zhang, H.J., Shao, D.D., Wu, Y.Z., Cai, C.C., Hu, C.M., Shou, X.L., Dai, B.R., Ye, B.H., Wang, M.D., Jia, X.Y., 2012. Apoptotic responses of Carassius auratus lymphocytes to nodularin exposure in vitro. Fish Shellfish Immunol. 33, 1229–1237.