Fitoterapia 95 (2014) 58–64

Contents lists available at ScienceDirect

Fitoterapia journal homepage: www.elsevier.com/locate/fitote

Effects of compound K on hyperglycemia and insulin resistance in rats with type 2 diabetes mellitus Shuang Jiang a,c,1, Dayong Ren b,1, Jianrui Li d, Guangxin Yuan a,e, Hongyu Li a,e, Guangyu Xu a, Xiao Han a, Peige Du a,⁎, Liping An a,⁎ a b c d e

College of Pharmacy, Beihua University, Jilin, Jilin 132013, PR China College of Food Science and Engineering, Jilin Agricultural University, Changchun, Jilin 130117, PR China College of Basic Medical Sciences, Changchun University of Chinese Medicine, Changchun, Jilin 130117, PR China Department of Personnel, Changchun University of Chinese Medicine, Changchun, Jilin 130117, PR China Biological Macromolecular Function Development and Application of Engineering Laboratory, Jilin, Jilin 132013, PR China

a r t i c l e

i n f o

Article history: Received 10 January 2014 Accepted in revised form 24 February 2014 Available online 5 March 2014 Keywords: Compound K Hyperglycemia Insulin resistance

a b s t r a c t Compound K (CK) is a final metabolite of panaxadiol ginsenosides from Panax ginseng. Although anti-diabetic activity of CK has been reported in recent years, the molecular mechanism of CK in the treatment of diabetes mellitus remains unclear. In the present investigation, we established a rat model of type 2 diabetes mellitus (T2DM) with insulin resistance using high-fat diet (HFD) and streptozotocin (STZ), and attempted to verify more details and exact mechanisms in the treatment of T2DM. CK was administered orally at three doses [300, 100 and 30 mg/kg bodyweight (b.w.)] to the diabetic rats. Bodyweight, food-intake, fasting blood glucose (FBG), fasting serum insulin (FINS), insulin sensitivity (ISI), total glycerin (TG), total cholesterol (TC), as well as oral glucose tolerance test (OGTT) were evaluated in normal and diabetic rats. According to our results, CK could improve bodyweight and food-intake of diabetic rats. CK exhibited dose-dependent reduction of FBG, TG and TC of diabetic rats. CK treatment also enhanced FINS and ISI. Meanwhile, the glucose tolerance observed in the present study was improved significantly by CK. It is concluded from the results that CK may have improving effects on hyperglycemia and insulin resistance of diabetic rats. Furthermore, research showed that CK could promote the expression of InsR, IRS1, PI3Kp85, pAkt and Glut4 in skeletal muscle tissue of diabetic rats. These results indicate that the hypoglycemic activity of CK is mediated by improvement of insulin sensitivity, which is closely related to PI3K/Akt signaling pathway. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Now there has been a sharp increase of diabetes across the world. It is estimated that the number of diabetics will rise to 380 million worldwide by 2025, and 95% of those people belong to T2DM [1]. T2DM is characterized by insulin

⁎ Corresponding authors. Tel./fax: +86 432 64608281. E-mail addresses: [email protected] (S. Jiang), [email protected] (L. An). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.fitote.2014.02.017 0367-326X/© 2014 Elsevier B.V. All rights reserved.

resistance, which is a state where insulin has a reduced ability to mediate glucose homeostasis in its major target tissues, such as skeletal muscle, adipose tissue and liver [2]. Insulin resistance is not only the key pathophysiological abnormality of T2DM, but also the primary cause of many related complications, such as hyperglycemia, dyslipidemia, abdominal obesity, hypertension, and so on [3]. Therefore, improving insulin resistance has become an established and acknowledgeable treatment for T2DM. Although several drugs are available for the treatment of diabetes, side effects and adverse reactions induced by them

S. Jiang et al. / Fitoterapia 95 (2014) 58–64

are of great concern. Recently, many researchers are seeking for natural products or dietary interventions to prevent or treat T2DM. Panax ginseng has been used as tonic and restorative remedies in traditional Chinese medicine for several thousand years. The pharmacological properties of P. ginseng are mainly attributed to ginsenosides, which are the active components found in the extracts of different species of P. ginseng [4]. CK, a final metabolite of panaxadiol ginsenosides (Fig. 1), has caught an increasing attention in view of various biological activities including anticancer, anti-inflammation and hepatoprotective effect [5–11]. In recent years, the anti-diabetic effect of CK has been found. It was reported that CK could enhance the insulin secretion in pancreatic cell, while another team proved that CK could reduce FBG, TG and TC levels through attenuating gluconeogenesis in diabetic mice [12,13]. In our previous studies, lots of data hinted that CK could improve insulin resistance in T2DM model, which provided another important direction for illustrating the role of CK in the treatment of T2DM. In this study, a rat T2DM model with insulin resistance was established using HFD and STZ, and an attempt was made to verify the effect of CK on T2DM and its mechanisms, with focusing on the improvement of CK on insulin sensitivity and the identification of the role of CK in the critical pathway of insulin sensitivity.

2. Experimental 2.1. Materials and chemicals CK used in this study was isolated and purified from P. ginseng roots by a series of chromatography procedures in our laboratory. STZ was purchased from Sigma Chemical Co. (St. Louis, MO, USA) and reagents for serum insulin were purchased from Invitrogen Biotech Co. (Camarillo, CA, USA). Glucose, TC and TG test kits were obtained from Huili Biotech Co. (Changchun, Jilin, China) and iodine [125I] insulin radioimmunoassay kit was purchased from Jiancheng Biotech Co. (Nanjing, Jiangsu, China). SYBR Premix Ex Taq™ was gained from Takara Biotech Co. (Otsu, Japan) and antibody of insulin receptor (InsR), insulin receptor substrates 1 (IRS1), phosphorylated phosphatidylinositol 3 kinase (pPI3Kp85), phosphorylated protein kinase B (pAkt) and glucose transporter 4 (Glut4) were purchased from Cell Signaling Technology

59

(Beverly, MA, USA). All of other reagents were analytical grade from Sinopharm Chemical Reagent Co. (Beijing, China). 2.2. Experimental animal Male Wistar rats (200–250 g) were purchased from the Experimental Animal Breeding Centre, Jilin University (Changchun, Jilin, China). All rats were housed in an air conditioned room at 22 ± 1 °C, with humidity of 50 ± 10%, and a constant 12 h light and 12 h dark cycle. They were fed with diet and given tap water ad libitum. Normal-pellet diet (NPD), consisting of 5% fat, 53% carbohydrate, 23% protein and with total calorific value 25.0 kJ/kg, and HFD, consisting of 22% fat, 48% carbohydrate, 20% protein and with total calorific value 44.3 kJ/kg, were ordered from the Experimental Animal Breeding Centre, Jilin University. All experimental animals were overseen and approved by the Animal Care and Use Committee of our institute before and during experiments. 2.3. Preparation of HFD/STZ-induced diabetic rat [14,15] The rats were randomly divided into 2 groups. One group (n = 10, normal control) was fed with normal-pellet diet and another group (n = 60) was fed with high-fat diet. After 4 weeks, the rats fed with HFD were injected intraperitoneally with STZ dissolved in citrate buffer (pH 4.5) at a dose of 30 mg/kg b.w, and their FBG levels were measured on week 4 after the injection. The rats fed with NPD were injected intraperitoneally with the citrate buffer vehicle. The HFD-fed rats with an FBG value above 7.8 mmol/L were randomly divided into 4 groups (n = 10 each) and were fed with HFD continuously. One group was used as a high-fat diabetic control (DM), and other 3 groups were orally gavaged with CK dissolved in 0.5% CMC-Na at the doses of 300, 100 and 30 mg/kg b.w. per day, respectively. Rats in the normal control and diabetic control groups were gavaged with 0.5% CMC-Na. The bodyweight and food-intake were recorded daily and weekly, respectively. On the 28th day of the experiment, the animals were deprived of food overnight before being sacrificed. Blood samples obtained from tails were separated by centrifugation for 5 min and kept at −80 °C. The skeletal muscle tissue was removed promptly, and stored in liquid nitrogen for the required. 2.4. Oral glucose tolerance test OGTT was conducted in control and treated rats, 24 h before they were sacrificed. After overnight fast, blood samples were collected from the veins of rats' tail to obtain baseline blood glucose levels. Subsequently, all the rats in groups were orally gavaged with 2 g/kg b.w. of glucose solution (40%, wt/vol). Blood glucose levels were measured at 0, 30, 60, 90 and 120 min by the glucose oxidase method according to the instruction. 2.5. Fasting serum insulin and insulin sensitivity index

Fig. 1. Compound K. Compound K (20-O-β-D-glucopyranosyl-20(S)protopanaxadiol, C36H62O8, M.W. 623).

FINS was quantified in duplicate using commercial iodine [125I] insulin radioimmunoassay kit. Each assay was performed by following the kit instructions. Standards at a series of concentrations were in parallel with the samples. The insulin content in the samples was calculated in reference to the corresponding standard curves and expressed as mU/L.

60

S. Jiang et al. / Fitoterapia 95 (2014) 58–64

Table 1 List of designed primer sets for real-time qPCR. Gene

Primer

5′———3′

Size (bp)

InsR

Sense Antisense Sense Antisense Sense Antisense Sense Antisense

CATCATGATCACAGACTA GCTCCTTCAGGTGGACCA GTATTATGAGAACGAGAAG GGCAAAGTGTTCGTCTCG TAAGAAGACTGGAGTGGTGTTTG GATAGCCTGGATCACGCCCTTA GTATGACTCTACCCACGGCAAGT TGGCCCCACCCTTCAGGTGAGC

149

IRS1 Glut4 GAPDH

147 150 206

was separated by SDS-PAGE using a 10% gel and transferred to a PVDF membrane. The membrane was blocked with 5% non-fat milk, and then incubated with anti-InsR, anti-IRS1, anti-PI3Kp85, anti-pAKT and anti-Glut4 primary antibodies. After washing with TBST, the membrane was incubated with the secondary antibody. An enhanced chemiluminescence kit was used to detect the bands. GAPDH was chosen as an internal control and the blots were probed with anti-GAPDH mAb. Proteins were quantitatively determined by densitometry using NIH image software. 2.9. Statistical analysis

ISI was calculated according to FBG and FINS. The formula of ISI used was given below: −1

ISI ¼ LnðFBG  FINSÞ

2.6. Estimation of lipid profiles in blood samples Approximately 24 h after completion of FBG and OGTT, the rats were sacrificed and their blood samples were collected from their tails. The lipid profiles for all groups were performed using commercially available kits as described earlier. 2.7. Real-time quantitative polymerase chain reaction (qPCR) Gene levels of InsR, IRS1 and Glut4 in skeletal muscle tissue were confirmed by a real-time qPCR. Total RNA was prepared with a TRI reagent according to the manufacturer's instructions. RNA was treated with DNase, purified by ethanol precipitation, resuspended in DEPC-treated water, and stored at −80 °C. Total RNA was quantified with a spectrophotometer. The total RNA quality was estimated by formaldehyde gel electrophoresis. Reserve transcription with 2 μg of total RNA, 1 μg of Oligo (dT) primers, 5 μL 5 × RT buffer, 5 μL 10 mM dNTP mix, 40 U Rnase inhibitor, and 200 U BcaBEST polymerase were performed first to obtain cDNA. Gene specific primers (Table 1) were used for amplification by real-time qPCR on a BIO-RAD Chromo Real-Time PCR System using an SYBR Premix Ex Taq™ according to the manufacturer's protocols. Each mRNA expression level was normalized with respect to mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The data were analyzed using the 2−ΔΔCt method [16]. 2.8. Western blot analysis Protein levels of InsR, IRS1, PI3Kp85, pAkt and Glut4 in skeletal muscle tissue were assayed by western blot analysis. Skeletal muscle tissue from control and experimental rats were homogenized and lysed in ice-cold RIPA lysis buffer containing protease inhibitor. The supernatant protein concentration was measured by the Bradford assay. The protein

All results were expressed as means ± standard deviations (SD) for each group. Statistical calculations by SPSS version 13.0 software (SPSS Inc, USA) were carried out. The significance of the difference between the means of test and control studies was established by Student's t-test. P values of less than 0.05 or 0.01 were considered significant. 3. Results 3.1. CK improved bodyweight and food-intake of diabetic rats Male Wistar rats were fed with HFD for 4 weeks and then injected with STZ followed by continual HFD-fed to generate a non-genetic rodent model mimicking human T2DM with insulin resistance and insulin deficiency. As seen from Table 2, there was a significant difference in bodyweight between the groups of HFD and NPD (P b 0.05). FBG level in HFD group increased, but no significant difference compared with that in NPD group (P N 0.05). The daily food-intake in NPD group was lower than that in HFD group (P b 0.01). The analysis of plasma lipids including TG and TC showed a significant increase in response to the high-fat diet (P b 0.05). In the present investigation, several indicators in HFD/ STZ-induced diabetic rats were measured for the observation of the chronic effects of CK on the metabolism. First, the rats treated with HFD/STZ in the diabetic control group (DM) had a greater bodyweight loss than those in the normal control group (CON), which was consistent with the clinical symptom of patients with diabetes mellitus. In addition, HFD/STZ-induced diabetic rats had an increased food-intake compared with the normal control rats. After treatment with CK, bodyweights of all rats administrated at the doses of 300 (HCK), 100 (MCK) and 30 (LCK) mg/kg b.w. significantly increased as compared with those in the DM group (P b 0.05 or P b 0.01) (Table 3). 3.2. CK reduced fasting blood glucose of diabetic rats The effect of CK on FBG in normal and HFD/STZ-induced diabetic rats was shown in Fig. 2. It was found that the rats of

Table 2 Glycolipid metabolic indicators in NPD and HFD-fed rats for 4 weeks. Means ± SD. Groups

Bodyweight (g)

Food-intake (KJ/day)

FBG (mmol/L)

TG (mmol/L)

TC (mmol/L)

NPD-fed HFD-fed

296.52 ± 16.78 321.46 ± 16.12⁎

51.39 ± 3.69 71.15 ± 3.75⁎⁎

5.28 ± 0.67 5.43 ± 0.51

1.22 ± 0.06 1.37 ± 0.05⁎

2.51 ± 0.18 3.43 ± 0.14⁎

⁎ P b 0.05, ⁎⁎ P b 0.01 vs NPD-fed group (n = 10).

S. Jiang et al. / Fitoterapia 95 (2014) 58–64

61

Table 3 Changes in body weight of diabetic rats during medication. Means ± SD. Groups

Body weight (g) 0 week

CON DM HCK MCK LCK

334.13 303.75 303.2 295.31 299.2

1 week ± ± ± ± ±

20.17 31.57 44.73 31.67 26.47

339.74 282.18 289.07 281.13 281.65

2 week ± ± ± ± ±

18.05 27.88 45.12 33.9 19.7

342.52 269.5 286.62 280.03 278.5

3 week ± ± ± ± ±

26.49 24.71 45.76 38.71 15.87

352.92 249.91 280.44 280.98 270.27

4 week ± ± ± ± ±

32.24 27.13 47.34 31.95 15.13

370.51 234.87 289.93 280.08 274.56

± ± ± ± ±

35.44⁎⁎ 32.97 47.47⁎⁎ 29.08⁎⁎ 16.19⁎

⁎ P b 0.05, ⁎⁎ P b 0.01 vs DM group (n = 10).

CON group had a normal FBG level which was different from that of the DM group (P b 0.01). FBG level of diabetic rats could be significantly inhibited by all doses of CK. Their hypoglycemic effects on diabetic rats decreased in the order of HCK N MCK NLCK. Based on the data, it may be concluded that CK could have a more positive effect on FBG level in HFD/ STZ-induced diabetic rats. 3.3. The effect of CK on oral glucose tolerance test of diabetic rats In OGTT, the maximum blood glucose levels in NC at 60 min and CK-treated groups appeared at 30 min after the oral glucose challenge. The blood glucose level of rats in HCK, MCK and LCK groups was significantly suppressed and reached higher values than those at the initial stage at 120 min after the challenge. This suppression effect on the blood glucose level would persist until the blood glucose level reached the initial level. Among CK-treated groups, the higher dose-treated rats usually had more potent glucose tolerance than the lower dose-treated rats, which was reduced progressively in the following order: HCK N MCK N LCK, indicating a dose-dependent effect of CK on the glucose tolerance in the rats (Fig. 3). 3.4. CK enhanced the insulin sensitivity of diabetic rats As Figs. 4 and 5 illustrated, the treatment with CK also increased FINS and ISI in HFD/STZ-induced diabetic rats dosedependently. FINS levels in the HCK group (P b 0.01) and MCK group (P b 0.05) were significantly elevated, but not significantly

in the LCK group (P N 0.05) compared with those in the DM group. When being treated with CK, the diabetic rats showed remarkably higher ISI compared with those in the DM group (P b 0.01). 3.5. The lipid profile of diabetic rats decreased by CK treatment To further evaluate the anti-diabetic effect of CK, we estimated the metabolic indicators associated with T2DM in different groups. The results showed that CK at doses of 300, 100 and 30 mg/kg b.w. could significantly reduce TG by 17.0%, 13.1% and 8.50%, and TC by 25.5%, 18.7% and 13.0% respectively compared with the diabetic control group (P b 0.05 or P b 0.01) (Fig. 6). 3.6. CK improved insulin resistance by PI3K/Akt signaling pathway To delineate the molecular mechanism of CK on improving insulin resistance, we evaluated the effects of CK on InsR, IRS1 and Glut4 at gene levels with real-time qPCR. The results of experiment showed that the change in the quantity of InsR and IRS1 in CK-treated groups and DM group was not detectable, but a clear change in the quantity in Glu4 could be seen. Glut4 contents in HCK, MCK and LCK groups were up-regulated by as much as 1.92, 1.53 and 1.27 times those in the DM group. We also evaluated the effects of CK on the expression of InsR, IRS1, pPI3Kp85, pAkt and Glut4 at protein levels with western blot analysis. InsR and IRS1 expression of all rats administrated at the doses of 300, 100 and 30 mg/kg b.w. significantly increased

25

CON DM HCK MCK LCK

40 35

Blood glucose (mmol/L)

FBG (mmol/L)

20

15

** 10

**

**

** 5

30 25 20 15 10

0

CON

DM

H (300)

M (100)

L (30)

mg/kg

Compound K

5 0

20

40

60

80

100

120

Time (min) Fig. 2. The effect of CK on FBG of control and diabetic rats. ⁎⁎ P b 0.01 vs DM group (n = 10).

Fig. 3. The effect of CK on OGTT of control and diabetic rats (n = 10).

62

S. Jiang et al. / Fitoterapia 95 (2014) 58–64 20

**

TG TC

4.0

**

**

3.5

* TG and TC (mmol/L)

FINS (mU/L)

15

10

5

3.0

**

**

**

2.5 2.0 1.5

**

**

**

**

1.0 0.5

0 COM

DM

H (300)

M (100)

L (30)

mg/kg

CON

Compound K Fig. 4. The effect of CK on FINS of control and diabetic rats. ⁎ P b 0.05, ⁎⁎ P b 0.01 vs DM group (n = 10).

as compared with those in the DM group. After CK treatment, the skeletal muscle tissue of rats in CK-treated groups showed a significant increase in pPI3Kp85 and pAkt expression compared with those in the DM group (Fig. 7c, d). Fig. 7e showed that CK treatment significantly enhanced Glut4 protein level in diabetic rats. The results of real-time qPCR and western blot analysis indicate that the improvement of insulin resistance by CK is closely related to PI3K/Akt signaling pathway.

4. Discussion T2DM has increased rapidly and is now considered as a worldwide epidemic in the past decades [17]. Therefore, the appropriate experimental animal model for the research on better treatments and novel prevention strategies in T2DM is very important [18]. Among the animal models available, inherited hyperglycemia and obesity in certain species have been used in the investigations, such as ob/ob mice, KK-ay mice, and Zucker rats [19–21]. However, those inbred diabetic models are comparatively expensive and not easy to breed, which limit the application widely. Some other experimental diabetic animal 0

-1

ISI

-2

-3

-4

**

**

**

**

-5

-6 CON

DM

H (300)

M (100)

0.0

L (30)

mg/kg

Compound K Fig. 5. The effect of CK on ISI of control and diabetic rats. ⁎⁎ P b 0.01 vs DM group (n = 10).

DM

H (300)

M (100)

L (30)

mg/kg

Compound K Fig. 6. Effects of CK on TG and TC of control and diabetic rats. ⁎⁎ P b 0.01 vs DM group (n = 10).

models were also available for study of T2DM, which possessed pathological features resembling those of T2DM [22]. However, these diabetic animal models do not develop or express the full spectrum of symptoms seen in humans [23]. In recent years, some researchers have already developed a rat model by feeding the animal with high-fat diet following low-dose STZ, which would closely mimic the natural history of the disease events as well as the metabolic characteristics of human T2DM [14,15]. The aim of our study was to investigate into the establishment of a diabetic animal model of insulin resistance, and the effects of CK on some plasma metabolic indexes, fasting blood glucose and insulin sensitivity in the diabetic rats. After the treatment with HFD and low-dose STZ, plasma insulin, glucose, TG and TC of the rats increased compared with those of rats given the control diet. These data were in agreement with those from several other reports and confirmed that feeding the animal with high-fat diet following low-dose STZ led to the development of T2DM model with insulin resistance [24–26]. In oriental medicine, some herbs and natural compounds have been found to have anti-diabetic activity [27]. P. ginseng has been utilized as a traditional herb in Asian countries [28]. Ginsenosides, a class of steroid glycosides and triterpene saponins, contained in P. ginseng have been reported to exert a variety of biological activities targeting diabetes, cancer, inflammation, and allergy [29,30]. CK is a final metabolite of panaxadiol ginsenosides and its hypoglycemic effect has been reported [12,13]; however, the exact molecular mechanism of anti-diabetic is still unclear. The present work is the study to explore the hypoglycemic effect of CK on T2DM rats induced by HFD/STZ. According to our results, CK could exhibited dose-dependently reduction of FBG, TG and TC of diabetic rats, which were supported by the results of previous studies with db/db mice [31]. In the current study, CK could improve the bodyweight, food-intake and the glucose tolerance of normal and diabetic rats induced by HFD/STZ. CK treatment also enhanced FINS and ISI. These results confirmed the effects of CK on improving hyperglycemia and insulin resistance in a rat model of T2DM. The skeletal muscle tissue plays an important role in the equilibrium process of energy since it consumes more than

S. Jiang et al. / Fitoterapia 95 (2014) 58–64

A

B

D

E

63

C

Fig. 7. Effect of CK on PI3K/Akt signaling pathway in skeletal muscle tissue of control and diabetic rats by western blot analysis. (A) the expression of InsR; (B) the expression of IRS1; (C) the expression of PI3Kp85; (D) the expression of pAkt; (E) the expression of Glut4. ⁎ P b 0.05, ⁎⁎ P b 0.01 vs DM group (n = 3).

30% of the total body energy and is the primary target of insulin, which is responsible for the glucose uptake, disposal and storage [32]. Impaired insulin-mediated glucose uptake of skeletal muscle is believed to be a primary defect in the development of whole-body insulin resistance [33]. Insulin resistance in T2DM exhibits many defects such as downregulation of receptor, reduction of receptor substrate levels, impairment of kinase activity, and so on [34]. Earlier studies have confirmed that InsR, IRS1, PI3K, Akt and Glut4 are critical nodes of the insulin signaling pathway [35–38]. The present results showed that CK could promote the expression of InsR, IRS1, PI3Kp85, pAkt and Glut4 in diabetic rats. Our research indicates that the hypoglycemic activity of CK could be mediated by improving insulin sensitivity, which might be related to PI3K/Akt signaling pathway in skeletal muscle tissue. In summary, CK exerts potent and efficacious hypoglycemic, hypolipidemic and insulin-sensitizing effects in HFD/ STZ-induced diabetic rats in this study. These beneficial effects are mediated by activation of PI3K/Akt signaling pathway. Therefore, what we hold firmly in our mind is that CK can be developed into a promising drug used for the treatment of diabetes mellitus in the future if enough further researches on it can be performed. Acknowledgments This work was funded by the project of the Education Department of Jilin Province (2014203), the Health Department of Jilin Province (2013Q013), the Administration of Traditional

Chinese Medicine of Jilin Province (2012163), and supported by the Development and Reform Commission of Jilin Province. References [1] Zimmet P, Alberti K, Shaw GJ. Global and societal implications of the diabetes epidemic. Nature 2001;414:782–7. [2] Kahn SE. The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia 2003;46:3–19. [3] Salas SJ, Martinez GM, Bullo M. The role of diet in the prevention of type 2 diabetes. Nutr Metab Cardiovasc Dis 2011;21:32–48. [4] Attele AS, Wu JA, Yuan CS. Ginseng pharmacology: multiple constituents and multiple actions. Biochem Pharmacol 1999;58:1685–93. [5] Yang Z, Wang JR, Niu T. Inhibition of p-glycoprotein leads to improved oral bioavailability of compound K, an anticancer metabolite of red ginseng extract produced by gut microflora. Drug Metab Dispos 2012;40:1538–44. [6] Wang CZ, Du GJ, Zhang Z. Ginsenoside compound K, not Rb1, possesses potential chemopreventive activities in human colorectal cancer. Int J Oncol 2012;40:1970–6. [7] Choi K, Kim M, Ryu J. Ginsenosides compound K and Rh(2) inhibit tumor necrosis factor-alpha-induced activation of the NF-kappa B and JNK pathways in human astroglial cells. Neurosci Lett 2007;421:37–41. [8] Choi K, Choi C. Proapoptotic ginsenosides compound K and Rh enhance Fas-induced cell death of human astrocytoma cells through distinct apoptotic signaling pathways. Cancer Res Treat 2009;41:36–44. [9] Cho SH, Chung KS, Choi JH. Compound K, a metabolite of ginseng saponin, induces apoptosis via caspase-8-dependent pathway in HL-60 human leukemia cells. BMC Cancer 2009;449:1–13. [10] Park JS, Shin JA, Jung JS. Anti-inflammatory mechanism of compound K in activated microglia and its neuroprotective effect on experimental stroke in mice. J Pharmacol Exp Ther 2012;341:59–67. [11] Lee HU, Bae EA, Han MJ. Hepatoprotective effect of ginsenoside Rb1 and compound K on tert-butyl hydroperoxide-induced liver injury. Liver Int 2005;25:1069–73.

64

S. Jiang et al. / Fitoterapia 95 (2014) 58–64

[12] Han GC, Ko SK, Sung JH. Compound K enhances insulin secretion with beneficial metabolic effects in db/db mice. J Agric Food Chem 2007;55:10641–8. [13] Li W, Zhang M, Gu J. Hypoglycemic effect of protopanaxadiol-type ginsenosides and compound K on type 2 diabetes mice induced by high-fat diet combining with streptozotocin via suppression of hepatic gluconeogenesis. Fitoterapia 2012;83:192–8. [14] Srinivasan K, Viswanad B, Ramarao P. Combination of high-fat diet-fed and low-dose streptozotocin-treated rat: A model for type 2 diabetes and pharmacological screening. Pharmacol Res 2005;52:313–20. [15] Benny K, Huat T, Chee HT. Anti-diabetic activity of the semi-purified fractions of Averrhoa bilimbi in high fat diet fed-streptozotocininduced diabetic rats. Life Sci 2005;76:2827–39. [16] Kenneth J, Thomas D. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 2001;25:402–8. [17] Buse JB. Type 2 diabetes mellitus in 2010: individualizing treatment targets in diabetes care. Nat Rev Endocrinol 2011;7:67–8. [18] Oron HM, Kamari Y, Grussman E. Metabolic syndrome: comparison of the two commonly used animal models. Am J Hypertens 2008;21:1018–22. [19] Weigle DS, Bukowski TR, Foster DC. Recombinant ob protein reduces feeding and body weight in the ob/ob mouse. J Clin Invest 1995;96:2065–70. [20] Suzuki Y, Unno T, Ushitani M. Anti-obesity activity of extracts from Lagerstroemia speciosa L. leaves on female KK-Ay mice. J Nutr Sci Vitaminol 1999;45:791–5. [21] Okuno A, Tamemoto H, Tobe K. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J Clin Invest 1998;101:1354–61. [22] Srinivasan K, Ramarao P. Animal models in type 2 diabetes research: an overview. Indian J Med Res 2007;125:451–72. [23] Vanderford NL. Regulation of MafA expression in pancreatic beta-cells in db/db mice with diabetes. Diabetes 2010;59:1709–920. [24] Busserolles J, Gueux E, Rock E. Oligofructose protects against the hypertriglyceridemic and pro-oxidative effects of a high fructose diet in rats. J Nutr 2003;133:1903–8.

[25] Thresher JS, Podolin DA, Wei Y. Comparison of the effects of sucrose and fructose on insulin action and glucose tolerance. Am J Physiol Regul Integr Comp Physiol 2000;279:1334–40. [26] Busserolles J, Rock E, Gueux E. Short-term consumption of a highsucrose diet has a prooxidant effect in rats. Br J Nutr 2002;87:337–42. [27] Sung HK, Sun HH, Se YC. Anti-diabetic effect of cinnamon extract on blood glucose in db/db mice. J Ethnopharmacol 2006;104:119–23. [28] Xiang YZ, Shang HC, Gao XM. A comparison of the ancient use of ginseng in traditional Chinese medicine with modern pharmacological experiments and clinical trials. Phytother Res 2008;22:851–8. [29] Lorne JH, Michael JW. Inflammation, cancer, and targets of ginseng. J Nutr 2007;137:1835–55. [30] Lee SJ, Ko WG, Kim JH. Induction of apoptosis by a novel intestinal metabolite of ginseng saponin via cytochrome c-mediated activation of caspase-3 protease. Biochem Pharmacol 2000;60:677–85. [31] Yoon SH, Han EJ, Sung JH. Anti-diabetic effects of compound K versus metformin versus compound K-metformin combination therapy in diabetic db/db mice. Biol Pharm Bull 2007;30:2196–200. [32] Smith AG, Muscat GE. Skeletal muscle and nuclear hormone receptors: implications for cardiovascular and metabolic disease. Int J Biochem Cell Biol 2000;537:2047–63. [33] Garvey WT. Glucose transport and NIDDM. Diabetes Care 1992;15:396–417. [34] Pessin JE, Saltiel AR. Signaling pathways in insulin action: molecular targets of insulin resistance. J Clin Invest 2000;106:165–9. [35] Draznin B. Molecular mechanisms of insulin resistance: serine phosphorylation of insulin receptor substrate-1 and increased expression of p85a: the two sides of a coin. Diabetes 2006;55:2392–7. [36] Youngren JF. Regulation of insulin receptor function. Cell Mol Life Sci 2007;64:873–91. [37] Manning BD, Cantley LC. AKT/PKB signaling: navigating downstream. Cell 2007;129:1261–74. [38] Taniguchi CM, Emanuelli B, Kahn CR. Critical nodes in signaling pathways: insights into insulin action. Nat Rev Mol Cell Biol 2006;7:85–96.