Reprod Dom Anim doi: 10.1111/rda.12452 ISSN 0936–6768
Effects of FGF10 on Bovine Oocyte Meiosis Progression, Apoptosis, Embryo Development and Relative Abundance of Developmentally Important Genes In Vitro RF Pomini Pinto1, PK Fontes1, B Loureiro2, AC Sousa Castilho1, J Sousa Ticianelli1, E Montanari Razza1, RA Satrapa1, J Buratini3 and C Moraes Barros1 1 Department of Pharmacology, Institute of Biosciences, S~ ao Paulo State University (UNESP), Botucatu, SP, Brazil; 2Laboratory of Animal ao Paulo Reproductive Physiology, University of Vila Velha (UVV), Vila Velha, ES, Brazil; 3Department of Phisiology, Institute of Biosciences, S~ State University, Botucatu, SP, Brazil
Contents Fibroblast growth factor (FGF10) acts at the cumulus oocyte complex, increasing the expression of cumulus cell expansionrelated genes and oocyte competency genes. We tested the hypothesis that addition of FGF10 to the maturation medium improves oocyte maturation, decreases the percentage of apoptotic oocytes and increases development to the blastocyst stage while increasing the relative abundance of developmentally important genes (COX2, CDX2 and PLAC8). In all experiments, oocytes were matured for 22 h in TCM-199 supplemented with 0, 2.5, 10 or 50 ng/ml FGF10. In Experiment 1, after maturation, oocytes were stained with Hoechst to evaluate meiosis progression (metaphase I, intermediary phases and extrusion of the first polar body) and submitted to the TUNEL assay to evaluate apoptosis. In Experiment 2, oocytes were fertilized and cultured to the blastocyst stage. Blastocysts were frozen for analysis of COX2, CDX2 and PLAC8 relative abundance. In Experiment 1, 2.5 ng/ml FGF10 increased (p < 0.05) the percentage of oocytes with extrusion of the first polar body (35%) compared to 0, 10 and 50 ng/ml FGF10 (21, 14 and 12%, respectively) and FGF10 decreased the percentage of oocytes that were TUNEL positive in all doses studied. In Experiment 2, there was no difference in the percentage of oocytes becoming blastocysts between treatments and control. Real-time RT-PCR showed a tendency of 50 ng/ml FGF10 to increase the relative abundance of COX2 and PLAC8 and of 10 ng/ml FGF10 to increase CDX2. In conclusion, the addition of FGF10 to the oocyte maturation medium improves oocyte maturation in vitro, decreases the percentage of apoptotic oocytes and tends to increase the relative abundance of developmentally important genes.
Introduction In vitro maturation (IVM) of immature oocytes is widely used in assisted reproduction technologies in cattle and is increasingly used to treat human infertility. The developmental competence of IVM oocytes, however, is lower than pre-ovulatory, in vivo-matured oocytes (Humblot et al. 2005). A low-efficiency IVM alters embryo development, survival and implantation (Eppig 2001; Rizos et al. 2002; Gilchrist et al. 2004; McNatty et al. 2004; Gilchrist 2011). Poor oocyte development might be caused by an absence of nutrients and important development-stimulating growth factors in the maturation medium (Rizos et al. 2002, 2003; Lonergan et al. 2003). The fibroblast growth factors (FGFs) are a family of 22 proteins that act as important regulators of proliferation, morphogenesis and angiogenesis in many types of cells and tissues (Ornitz 2000; Ornitz and Itoh 2001). © 2014 Blackwell Verlag GmbH
Several FGFs are expressed in oocytes and follicular cells from cows, mice and pigs (Puscheck et al. 1997; Schams et al. 2009) and are considered mediators of folliculogenesis and oogenesis in the bovine species. Receptors for FGF1 and FGF2 (FGFR1 and FGFR2) are also found in embryos up to the 8-cell zygote (Ozawa et al. 2013), stage in which the transcripts are only from the maternal genome (Gilchrist et al. 2008). The importance of these receptors, whose ligands are FGF2 and FGF10 (Powers et al. 2000; B€ ottcher and Niehrs 2005), have been demonstrated in knock-out mouse studies that showed a lethal effect after the postimplantation stage (Deng et al. 1994, 1997; Yamaguchi et al. 1994; Arman et al. 1998). Furthermore, blocking FGFR activity during bovine oocyte IVM reduces embryo development to the blastocyst stage (Zhang and Ealy 2012). Fibroblast growth factor 10 has been given special attention as a regulator of follicle and oocyte development (Buratini et al. 2005a,b). Addition of FGF10 to oocyte IVM medium improves the expansion of cumulus cells, increases the relative abundance of genes related to this process (Caixeta et al. 2013), increases the number of oocytes with extrusion of the first polar body and improves development to the blastocyst stage (Zhang et al. 2010). To better understand the mechanisms by which FGF10 enhances developmental competence when added to the IVM medium, we tested the effects of FGF10 on the progression of meiosis and the incidence of apoptosis in oocytes matured in vitro. In addition, to assess the potential beneficial effect of FGF10 via improvement of the embryonic-maternal interface, we tested the hypothesis that the addition of FGF10 to the IVM medium would enhance the relative abundance of genes (COX2, CDX2 and PLAC8) controlling this process in in vitro-produced bovine embryos (Charpigny et al. 1997; Wang et al. 2002; Hall et al. 2005).
Material and Methods Oocyte in vitro maturation Bovine ovaries from Nelore and cross-bred cows were collected in an abattoir located 47 km from the laboratory and transported in a 0.9% NaCl aqueous solution at 37°C. Immature cumulus oocyte complexes (COCs) were obtained by aspiration of 2–8-mm follicles. The oocytes were classified according to their morphology (Khurana and Niemann 2000), and only those with
2
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros
a homogeneous cytoplasm and surrounded by at least one layer of cumulus cells were used. The COCs were incubated in groups of 15–25. Each 90 ll droplet of maturation medium consisted of TCM199 (Sigma-Aldrich, Saint Louis, MO, USA) (Earle’s salt) supplemented with 2 lg/ml sodium pyruvate (Sigma-Aldrich), 75 lg/ml gentamicin (Sigma-Aldrich), 10 UI/ml LH (Lutropinâ), 1 lg/ml FSH (Folltropinâ), 10 lg/ml estradiol 17b (Sigma-Aldrich) and 4 mg/ml bovine serum albumin (BSA). The droplets were covered with mineral oil (Sigma-Aldrich) and preincubated under the maturation conditions for a minimum of 2 h (38.5°C, 5% CO2 in air with 100% humidity). In all experiments, each maturation drop received human recombinant FGF10 (R&D Systems, Minneapolis, MN, USA) at 0, 2.5, 10 or 50 ng/ml diluted in PBS/0.1% BSA. Oocytes were matured for 22 h. In vitro fertilization and embryo culture In vitro fertilization took place in droplets (90 ll) containing Tyrode’s albumin lactate pyruvate (TALP) supplemented with 6 mg/ml fatty acid-free BSA (SigmaAldrich), 2 lg/ml sodium pyruvate (Sigma-Aldrich), 75 lg/ml gentamicin (Sigma-Aldrich), 11 lg/ml heparin and 44 lg/ml PHE (2 mM penicillamine, 1 mM hypotaurine, 250 mM epinephrine; Sigma-Aldrich). All experiments were carried out using a pool of two frozen semen samples from Nelore bulls. Semen was thawed at 37°C for 30 s, and spermatozoa were washed in a discontinuous Percoll gradient (Pharmacia, Uppsala, Sweden). After removal of the supernatant, spermatozoa were re-suspended in IVF medium, and the sperm suspension (1 9 106 cells/ml) was added into each droplet. All oocytes were placed in the fertilization drops with sperm. The samples were incubated 38.5°C in a saturated humidity atmosphere containing 5% CO2 for 12–18 h. Embryos were cultured in synthetic oviduct fluid medium (SOF, Holm et al. 1999) supplemented with 2% sodium pyruvate (Sigma-Aldrich) and 5% BSA (Gibco) under mineral oil in a humidified atmosphere of 5% CO2 at 38.5°C. Twelve to 18 h post-insemination (hpi), presumptive zygotes were denuded of surrounding cumulus cells by repeated pipetting. Afterwards, the plates with oocytes were placed in a plastic bag (25915 cm), where a gaseous mixture was injected (5% O2, 5% CO2 and 90% N2). From the initial number of oocytes, cleavage and blastocyst rates were calculated at 72 hpi and day 8 post-insemination, respectively. Culture medium was replaced at 72 hpi. Experiment 1: Effect of FGF10 on percentage of apoptosis and meiosis progression in in vitro-matured bovine oocytes This experiment was designed to test the effects of FGF10 on percentage of apoptosis and meiosis progression in in vitro-matured bovine oocytes. Oocytes were selected, treated with FGF10 (0, 2.5, 10 or 50 ng/ml) and matured as described above. After 22 h of maturation, oocytes were removed from maturation drops,
vortexed in hyaluronidase (1000 UI) to remove the cumulus cells and submitted to the TUNEL assay as described in Loureiro et al. (2011). Briefly, oocytes were fixed in 50 ll microdrops of 4% (w/v) paraformaldehyde in PBS for 1 h and then permeabilized in 0.5% (v/v) Triton X-100 containing 0.1% (w/v) sodium citrate for 1 h. Positive controls for the TUNEL assay were incubated in DNase (50 U/ml) at 37°C in the dark for 1 h. Positive controls and experimental oocytes were washed in PBS-PVP and incubated with 25 ll TUNEL reaction mixture for 1 h at 37°C. Negative controls were incubated without the enzyme. Each oocyte was washed thrice in PBS-PVP, slides were mounted with 5 ll microdrop of glycerol with Hoechst 33342 (1 lg/ml). Labelling was observed using an epifluorescence microscope (Leica Dx, S~ao Paulo, Brazil). Each oocyte was analyzed for TUNEL-positive nuclei using the FITC filter. Meiosis stage was analyzed using the DAPI filter. The stages of nuclear maturation were evaluated as previously described (Laforest 2005). Oocytes that contained one visible metaphasic plate were considered to be in metaphase I (MI) of meiosis. Oocytes that contained two separated DNA materials inside the cell were considered to be in an intermediary stage (anaphase I, telophase I or metaphase II without extrusion of the first polar body). Oocytes whose extrusion of the polar body could be visualized were considered to be in metaphase II with extrusion of the first polar body (mature oocytes). The experiment was replicated five times with 54–99 oocytes per replicate. Experiment 2: Effect of FGF10 during oocyte maturation on relative abundance of COX2, CDX2 and PLAC8 in the blastocyst stage embryo This experiment was designed to test the effects of addition of FGF10 on oocyte maturation markers COX2, CDX2 and PLAC8 in bovine blastocysts. Oocytes were matured and treated with different concentrations of FGF10 (0, 2.5, 10 or 50 ng/ml). After maturation, oocytes were fertilized, and putative zygotes were cultured until day 8 as described above. On day 8, blastocyst development was recorded and blastocysts were washed in PBS/PVP and frozen for RNA extraction. Total blastocyst RNA was extracted from pools of 5 embryos (5 replicates pools of 5 embryos, 25 embryos per treatment group) using the RNeasy kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s instructions. Total extracted RNA was stored at 80°C until RT-PCR analysis. RNA samples (8 ll) were incubated with DNase I (1 U/lg; Invitrogen) and reversetranscribed with SuperScript III (Invitrogen) and oligo-dT primers. Real-time RT-PCR analysis was performed with an ABI 7500 using Power Sybr Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). Reactions were carried out in 25 ll volumes under the following PCR cycling conditions: 95°C for 10 min, followed by 40 cycles at 95°C for 10 s and annealing for 1 min. Specific primers (Table 1) were designed using INTEGRATED DNA TECHNOLOGIES software (http://idtdna.com). Each sample was analyzed in duplicate, and the specificity of each PCR product was determined by melting © 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
3
Table 1. Primer sequences
Genes
Sequence
COX2
S:50 AAGCCTAGCACTTTCGGTGGAGAA30 A:50 TCCAGAGTGGGAAGAGCTTGCATT30 S:50 TGGAGCTGGAGAAGGAGTTTCACT30 A:50 TCCTTCGCTCTGCGGTTCTGAAAT30 S:50 GACTGGCAGACTGGCATCTT30 A:50 CTCATGGCGACACTTGATCC30 S:50 GCCATGGAGCGCTTTGG30 A:50 CCACAGTCAGCAATGGTGATCT30
CDX2 PLAC8 PPIA
Annealing temp (°C)
Base pairs
Primer efficiency (%)
60
168
95
56
133
93
60
140
98
60
65
102
curve analysis and amplicon size determination in agarose gels. Negative controls (water replacing cDNA) were run on every plate. To select the most stable housekeeping gene for detailed analysis of each cell type, peptidylprolyl isomerase A (PPIA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and histone H2AFZ (H2AFZ) amplification profiles were compared using the geNorm applet for Microsoft Excel (medgen.ugent. be/genorm; (Ramakers et al. 2003). Based on this comparison, the relative quantification was performed with PPIA. The relative abundance of each target gene was calculated using the ΔΔCt method with efficiency correction (Pfaffl 2001). The mean efficiency value for each gene was calculated from the amplification profiles of individual samples with LINREGPCR software (Ramakers et al. 2003).
groups (21, 14 and 12%, respectively). This same concentration decreased (p < 0.05) the percentage of oocytes at the intermediary phase (35 vs 53, 48 and 53%, for 2.5, 10, 50 ng/ml FGF10 and control group, respectively). There was no difference in the percentage of oocytes in the MI stage between all groups. Meiosis progression was not different between 10 ng/ml FGF10, 50 ng/ml FGF10 and control (Fig. 1). Addition of FGF10 to the maturation medium significantly decreased the percentage of oocytes that were TUNEL positive from 33 in the control group to 15, 5 and 6 in the 2.5, 10 and 50 ng/ml FGF10 groups, respectively (Fig. 2). The same was true when TUNELpositive oocytes were analyzed separately in the maturation stages (Fig. 3). The reduction was greater at FGF10 concentrations of 10 and 50 ng/ml. Apoptosis reduction was significant in all stages analyzed.
Statistical analysis Data on meiosis progression, percentage of oocytes that were TUNEL positive and its interactions (meiosis stage*apoptosis) and embryo development to the blastocyst stage were analyzed by least-squares analysis of variance using the General Linear Models procedure of SAS (SAS for Windows, Version 9.0, Cary, NC, USA). Differences in individual mean values were analyzed through pairwise comparisons (probability of difference analysis [PDIFF]; SAS Institute Inc.). Percentage data were arcsin-transformed before analysis. Replicate was considered a random effect, and treatment was considered fixed. Data for target mRNA abundance were transformed to logarithms if not normally distributed. ANOVA was used to test for effects of FGF10 on mRNA. Differences between means were determined with the orthogonal contrast test. Data are presented as the means SEM. Significant differences were considered when p < 0.05, and 0.1 > p > 0.05 was considered a tendency.
Experiment 2: Effect of FGF10 during oocyte maturation on relative abundance of COX2, CDX2 and PLAC8 mRNA and bovine embryo development Real-time RT-PCR showed that FGF10 tended to increase the relative abundance of specific genes in the blastocysts depending on the concentration added to the maturation medium. Addition of 50 ng/ml FGF10 tended to increase the relative abundance of COX2 (p = 0.07) and PLAC8 (p = 0.09) in day 8 blastocysts, while addition of 10 ng/ml FGF10 tended to increase
Percentage of oocytes (%)
70 60
MI
Intermediary phase
Polar body extrusion a
a
ab
50 b
40 30
e
d d
20
d
10 0
Results Experiment 1: Effect of FGF10 on meiosis progression and percentage of apoptosis in in vitro-matured bovine oocytes Addition of FGF10 at 2.5 ng/ml hastened oocyte maturation by increasing (p < 0.05) the percentage of oocytes with extrusion of the first polar body (35%) when compared to control and 10 and 50 ng/ml FGF © 2014 Blackwell Verlag GmbH
Control
2.5
10
50
FGF10 (ng/ml) Fig. 1. Effects of FGF10 at different concentrations on the percentages of oocytes in metaphase I, in intermediary phases (anaphase I/ telophase I/metaphase II) and with extrusion of the first polar body. Oocytes were stained with Hoechst after 22 h of maturation. Values are presented as LSmeans SEM. The experiment was replicated five times (54-99 oocytes/replicate) with a total of 393 oocytes. For each maturation phase, results associated to bars with different letters differed significantly (p < 0.05)
Percentage of TUNEL-Positive oocytes (%)
4
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros 40
Table 2. Oocyte number, cleavage (recorded at D3) and blastocyst (recorded at D8) ratios from control and FGF10 treatment groups (LSmeans SEM; n = 5 replicates)
a
35 30
FGF10 (ng/ml)
25 b
20 15 10
c
c
10
50
Control 2.5 10 50
Oocyte (n) 170 135 165 169
Cleavage (%) 70.36 71.94 71.29 60.93
3.72 4.99 3.72 3.72
Blastocyst (%) 13.34 17.75 10.76 13.71
3.29 3.81 3.29 3.29
5 0
Control
2.5
FGF10 (ng/mL) Fig. 2. Effects of FGF10 at different concentrations on the percentage of TUNEL-positive oocytes. FGF10 decreased the percentage of apoptotic oocytes at all concentrations when compared with control. Values are presented as LSmeans SEM. The experiment was replicated five times (54–99 oocytes/replicate) with a total of 393 oocytes. Results associated to bars with different letters differed significantly (p < 0.05)
a
b d c e
c e
e
Fig. 3. Effects of FGF10 at different concentrations on the percentage of TUNEL positive in the different stages of oocyte maturation. FGF10 decreased the percentage of apoptotic oocytes at all concentrations in the differential stages of maturation. Values are presented as LSmeans SEM. Results associated to bars with different letters differed significantly (p < 0.05)
Fig. 4. Effect of FGF10 during in vitro maturation on the relative abundance of CDX2, COX2 and PLAC8 in in vitro-produced bovine blastocysts (n = 5; 5 blastocysts per pool). The results are presented as the means SEM and represent the relative abundance of the gene of interest normalized to PPIA through the ΔΔCt method. *COX2 and PLAC8 mRNA abundance tended to increase at 50 ng/ml of FGF10 (p = 0.07 and p = 0.09, respectively). **CDX2 mRNA abundance tended to increase at 10 ng/ml of FGF10 (p = 0.08). Statistical difference was considered when p ≤ 0.05 and tendency when 0.05 < p < 0.1
the relative abundance of CDX2 (p = 0.08) in day 8 blastocysts (Fig. 4). There was no difference in the percentage of oocytes that cleaved or became morulae and blastocysts between the control and FGF groups (Table 2).
Discussion Addition of FGF10 to the oocyte maturation medium decreased the percentage of apoptotic oocytes and showed a tendency to increase the relative abundance of three developmentally important genes (COX2, CDX2 and PLAC8) in day 8 blastocysts. Furthermore, FGF10 during IVM influenced oocyte meiosis progression, but it did not increase development to the blastocyst stage in this study. Fibroblast growth factor 1, 2, 6 and 8 can decrease cell death through anti-oxidative actions (Kwabi-Addo et al. 2004). The anti-apoptotic effect of FGF10 was reported by Upadhyay et al. (2004, 2005), who observed a decrease in apoptosis caused by asbestos in epithelial cell culture through the activation of the MAPK/ERK pathway. Other anti-apoptotic actions of FGF10 include protection of DNA against oxidative stress also through the MAPK/ERK pathway. In bovines, the MAPK pathway is responsible for oocyte activation and development. If this pathway is not activated, the oocytes will stay in the germinal vesicle state (Kubelka et al. 2000; Lonergan et al. 2003). However, if the phosphatidylinositol triphosphate (PI3K) or the serine/threonine protein kinase (Akt) pathway is not activated, the oocytes will go through the vesicle germinative stage but stay at the metaphase I stage, which suggests the importance of this pathway after the resumption of meiosis (Anas et al. 1998; Shimada et al. 2001). Furthermore, Hoshino and Sato (2008) showed in mice that inactivation of Akt signalling blocks the extrusion of the first polar body. Addition of FGF10 to embryonic liver culture induces Akt signalling pathway activation and cell proliferation (Mavila et al. 2012). According to our data, it is possible that FGF10 acts through the PI3K/Akt pathway because the addition of 2.5 ng/ml FGF10 to the maturation medium did not alter the percentage of oocytes in metaphase I but increased the development after this stage through the polar body extrusion stage. The activation of PI3K/Akt pathway would also act to decrease apoptosis through the regulation of BCL2 genes, similar to insulin growth factor I (Tomek and Smiljakovic 2005; Jousan and Hansen 2007; Hansen and Fear 2011). In this study, all © 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
5
doses used were able to decrease apoptosis, with 10 and 50 ng/ml showing the greatest effects. Even though FGF10 improved oocyte maturation and decreased apoptosis, it was not able to improve embryo development to the morulae and blastocyst stage. This result contrasts with Zhang et al. (2010), who observed that the addition of 0.5 ng/ml FGF10 to the maturation medium increased the percentage of oocytes that reached the blastocyst stage at day 7 in vitro. However, when analyzing day 8 blastocysts, 50 ng/ml FGF10 had equivalent results to 0.5 ng/ml. In their work, FSH concentration in the maturation medium was higher than ours (25 vs 1 lg/ml FSH). The amount of FSH in the medium can affect the FGF10 action through the increase in number of FGF receptors in granulosa cells (Buratini et al. 2007). When oocytes were devoided of cumulus cells, FGF10 was not able to improve maturation in vitro (Zhang et al. 2010). It is possible that different dosages of FGF10 are needed at different developmental stages of the oocyte and embryo. In Zhang’s work, the greater benefits to the oocyte meiotic maturation required 50 ng/ml FGF10, while extrusion of the first polar body had the best rates with 0.5 and 50 ng/ml. In our study, an intermediary dose (2.5 ng/ml) had the greatest extrusion of the first polar body rates. While 10 and 50 ng/ml FGF10 showed a greater decrease in apoptosis when compared with 2.5 ng/ml FGF10. Expression of FGF’s receptors is affected by FSH concentration in the maturation media (Caixeta et al. 2013). It is likely, though, that FGF10 action is being mediated indirectly by the presence of FSH, which regulates the expression of FGF receptors. The effects of FGF10 on oocyte maturation in vitro were also observed in the expression of developmentally important genes. In blastocysts, COX2 is necessary during the implantation period, being involved in elongation and embryonic-maternal communication (Charpigny et al. 1997; Wang et al. 2002). Blastocysts with higher expression of COX2 have higher pregnancy ratios compared to blastocysts that have lower expression of COX2, which results in non-pregnant cows or abortion (El-Sayed et al. 2006). The expression of COX2 in embryos derived from oocytes matured in the presence of FGF10 has not been described. However, Caixeta et al. (2013) showed that maturation of cumulus oocyte complexes with FGF10 for 22 h
References Anas MK, Shimada M, Terada T, 1998: Possible role for phosphatidylinositol 3-kinase in regulating meiotic maturation of bovine oocytes in vitro. Theriogenology 50, 347–356. Arman E, Haffner-Krausz R, Chen Y, Heath JK, Lonai P, 1998: Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci U S A 95, 5082–5087. B€ ottcher RT, Niehrs C, 2005: Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 26, 63–77.
© 2014 Blackwell Verlag GmbH
increases the expression of COX2 in the cumulus cells. In these cells, COX2 is a target gene for EGF-like factors and one of the genes responsible for cumulus cell expansion (Fru et al. 2007; Portela et al. 2011). In the present study, 10 ng/ml FGF10 tended to increase the relative abundance of CDX2, while 50 ng/ml FGF10 tended to increase the relative abundance of COX2 and PLAC8. CDX2 is a transcription factor expressed in the trophectoderm and is necessary for implantation and placental development (Hall et al. 2005). PLAC8 is an invasion protein, while CDX2 is expressed in the trophectoderm and is related to placental development. Both PLAC8 and CDX2 have higher expression in embryos that successfully implant and generate a pregnancy (El-Sayed et al. 2006). CDX2knockout mouse embryos fail to implant due to a loss of trophoblastic epithelial cell integrity and an increase in apoptosis in these same cells (Chawengsaksophak et al. 1997; Rossant 2001). Additionally, endometrium expression of PLAC8 is higher in pregnant cows, suggesting the important role of this gene in the embryonic-maternal interface (Galaviz-Hernandez et al. 2003; Klein et al. 2006). In an ovine trophoblastic cell line, Yang et al. (2011) showed that addition of FGF10 can increase proliferation and migration. It was our hypothesis that, even though addition of FGF10 to the oocyte maturation medium did not influence the percentage of embryos that developed to the blastocyst stage, FGF10 might have been acting to improve embryo quality by increasing the relative abundance of genes important for development and survival. We have concluded that addition of FGF10 to the maturation medium can improve oocyte and embryo quality by decreasing apoptosis, increasing meiosis progression and increasing the relative abundance of developmentally important genes. Conflict of interest None of the authors have any conflict of interest to declare.
Author contributions Pomini Pinto, Fonte, Sousa Castilho, Satrapa, Montanari Razza, Sousa Ticianelli worked on the experiments. Moraes Barros, Buratini and Loureiro analyzed the data. Loureiro designed the study and wrote the manuscript.
Buratini J, Glapinski VF, Giometti IC, Teixeira AB, Costa IB, Avellar MC, Barros CM, Price CA, 2005a: Expression of fibroblast growth factor-8 and its cognate receptors, fibroblast growth factor receptor (FGFR)-3c and-4, in fetal bovine preantral follicles. Mol Reprod Dev 70, 255–261. Buratini J, Teixeira AB, Costa IB, Glapinski VF, Pinto MG, Giometti IC, Barros CM, Cao M, Nicola ES, Price CA, 2005b: Expression of fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and -4, in bovine antral follicles. Reproduction 130, 343–350. Buratini J, Pinto MG, Castilho AC, Amorim RL, Giometti IC, Portela VM, Nicola ES,
Price CA, 2007: Expression and function of fibroblast growth factor 10 and its receptor, fibroblast growth factor receptor 2B, in bovine follicles. Biol Reprod 77, 743–750. Caixeta ES, Machado MF, Ripamonte P, Price CA, Buratini J, 2013: Effects of FSH on the expression of receptors for oocyte-secreted factors and members of the EGF-like family during in vitro maturation in cattle. Reprod Fertil Dev 25, 890–899. Charpigny G, Reinaud P, Tamby JP, Creminon C, Guillomot M, 1997: Cyclooxygenase-2 unlike cyclooxygenase-1 is highly expressed in ovine embryos during the implantation period. Biol Reprod 57, 1032–1040.
6
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros
Chawengsaksophak K, James R, Hammond VE, K€ ontgen F, Beck F, 1997: Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386, 84–87. Deng CX, Wynshaw-Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P, 1994: Murine FGFR-1 is required for early postimplantation growth and axial organization. Genes Dev 8, 3045–3057. Deng C, Bedford M, Li C, Xu X, Yang X, Dunmore J, Leder P, 1997: Fibroblast growth factor receptor-1 (FGFR-1) is essential for normal neural tube and limb development. Dev Biol 185, 42–54. El-Sayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E, Sirard MA, Schellander K, Tesfaye D, 2006: Large-scale transcriptional analysis of bovine embryo biopsies in relation to pregnancy success after transfer to recipients. Physiol Genomics 28, 84–96. Eppig JJ, 2001: Oocyte control of ovarian follicular development and function in mammals. Reproduction 122, 829–838. Fru KN, Cherian-Shaw M, Puttabyatappa M, VandeVoort CA, Chaffin CL, 2007: Regulation of granulosa cell proliferation and EGF-like ligands during the periovulatory interval in monkeys. Hum Reprod 22, 1247–1252. Galaviz-Hernandez C, Stagg C, de Ridder G, Tanaka TS, Ko MS, Schlessinger D, Nagaraja R, 2003: Plac8 and Plac9, novel placental-enriched genes identified through microarray analysis. Gene 309, 81–89. Gilchrist RB, 2011: Recent insights into oocyte-follicle cell interactions provide opportunities for the development of new approaches to in vitro maturation. Reprod Fertil Dev 23, 23–31. Gilchrist RB, Ritter LJ, Armstrong DT, 2004: Oocyte-somatic cell interactions during follicle development in mammals. Anim Reprod Sci 82–83, 431–446. Gilchrist RB, Lane M, Thompson JG, 2008: Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum Reprod Update 14, 159–177. Hall VJ, Ruddock NT, French AJ, 2005: Expression profiling of genes crucial for placental and preimplantation development in bovine in vivo, in vitro, and nuclear transfer blastocysts. Mol Reprod Dev 72, 16–24. Hansen PJ, Fear JM, 2011: Cheating death at the dawn of life: developmental control of apoptotic repression in the preimplantation embryo. Biochem Biophys Res Commun 413, 155–158. Holm P, Booth PJ, Schmidt MH, Greve T, Callesen H, 1999: High bovine blastocyst development in a static in vitro production system using SOFaa medium supplemented with sodium citrate and myo-inositol with or without serum-proteins. Theriogenology 52, 683–700. Hoshino Y, Sato E, 2008: Protein kinase B (PKB/Akt) is required for the completion of meiosis in mouse oocytes. Dev Biol 314, 215–223. Humblot P, Holm P, Lonergan P, Wrenzycki C, Lequarre AS, Joly CG, Herrmann D, Lopes A, Rizos D, Niemann H, Callesen H, 2005: Effect of stage of follicular growth during super-
ovulation on developmental competence of bovine oocytes. Theriogenology 63, 1149–1166. Jousan FD, Hansen PJ, 2007: Insulin-like growth factor-I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti-apoptotic actions requiring PI3K signaling. Mol Reprod Dev 74, 189–196. Khurana NK, Niemann H, 2000: Energy metabolism in preimplantation bovine embryos derived in vitro or in vivo. Biol Reprod 62, 847–856. Klein C, Bauersachs S, Ulbrich SE, Einspanier R, Meyer HH, Schmidt SE, Reichenbach HD, Vermehren M, Sinowatz F, Blum H, Wolf E, 2006: Monozygotic twin model reveals novel embryo-induced transcriptome changes of bovine endometrium in the preattachment period. Biol Reprod 74, 253–264. Kubelka M, Motlık J, Schultz RM, Pavlok A, 2000: Butyrolactone I reversibly inhibits meiotic maturation of bovine oocytes, without influencing chromosome condensation activity. Biol Reprod 62, 292– 302. Kwabi-Addo B, Ozen M, Ittmann M, 2004: The role of fibroblast growth factors and their receptors in prostate cancer. Endocr Relat Cancer 11, 709–724. Laforest M, 2005: Le contr^ ole de la maturation nucleaire des ovocytes porcins. Implication de la phosphodiesterase de type 3 et de l’AMPK (50 adenosine monophosphate-activated protein kinase). Universite Laval, Quebec, Canada. Lonergan P, Rizos D, Gutierrez-Adan A, Fair T, Boland MP, 2003: Oocyte and embryo quality: effect of origin, culture conditions and gene expression patterns. Reprod Domest Anim 38, 259–267. Loureiro B, Oliveira LJ, Favoreto MG, Hansen PJ, 2011: Colony-stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am J Reprod Immunol 65, 578–588. Mavila N, James D, Utley S, Cu N, Coblens O, Mak K, Rountree CB, Kahn M, Wang KS, 2012: Fibroblast growth factor receptor-mediated activation of AKT-b-catenin-CBP pathway regulates survival and proliferation of murine hepatoblasts and hepatic tumor initiating stem cells. PLoS ONE 7, e50401. McNatty KP, Moore LG, Hudson NL, Quirke LD, Lawrence SB, Reader K, Hanrahan JP, Smith P, Groome NP, Laitinen M, Ritvos O, Juengel JL, 2004: The oocyte and its role in regulating ovulation rate: a new paradigm in reproductive biology. Reproduction 128, 379–386. Ornitz DM, 2000: FGFs, heparan sulfate and FGFRs: complex interactions essential for development. BioEssays 22, 108–112. Ornitz DM, Itoh N, 2001: Fibroblast growth factors. Genome Biol, 2, REVIEWS3005. Ozawa M, Yang QE, Ealy AD, 2013: The expression of fibroblast growth factor receptors during early bovine conceptus development and pharmacological analysis of their actions on trophoblast growth in vitro. Reproduction 145, 191–201. Pfaffl MW, 2001: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45.
Portela VM, Zamberlam G, Goncßalves PB, de Oliveira JF, Price CA, 2011: Role of angiotensin II in the periovulatory epidermal growth factor-like cascade in bovine granulosa cells in vitro. Biol Reprod 85, 1167–1174. Powers CJ, McLeskey SW, Wellstein A, 2000: Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 7, 165–197. Puscheck EE, Patel Y, Rappolee DA, 1997: Fibroblast growth factor receptor (FGFR)-4, but not FGFR-3 is expressed in the pregnant ovary. Mol Cell Endocrinol 132, 169–176. Ramakers C, Ruijter JM, Deprez RH, Moorman AF, 2003: Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62–66. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P, 2002: Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 61, 234–248. Rizos D, Gutierrez-Adan A, Perez-Garnelo S, De La Fuente J, Boland MP, Lonergan P, 2003: Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biol Reprod 68, 236–243. Rossant J, 2001: Stem cells in the mammalian blastocyst. Harvey Lect 97, 17–40. Schams D, Steinberg V, Steffl M, Meyer HH, Berisha B, 2009: Expression and possible role of fibroblast growth factor family members in porcine antral follicles during final maturation. Reproduction 138, 141–149. Shimada M, Zeng WX, Terada T, 2001: Inhibition of phosphatidylinositol 3-kinase or mitogen-activated protein kinase kinase leads to suppression of p34 (cdc2) kinase activity and meiotic progression beyond the meiosis I stage in porcine oocytes surrounded with cumulus cells. Biol Reprod 65, 442–448. Tomek W, Smiljakovic T, 2005: Activation of Akt (protein kinase B) stimulates metaphase I to metaphase II transition in bovine oocytes. Reproduction 130, 423–430. Upadhyay D, Bundesmann M, Panduri V, Correa-Meyer E, Kamp DW, 2004: Fibroblast growth factor-10 attenuates H2O2-induced alveolar epithelial cell DNA damage: role of MAPK activation and DNA repair. Am J Respir Cell Mol Biol 31, 107–113. Upadhyay D, Panduri V, Kamp DW, 2005: Fibroblast growth factor-10 prevents asbestos-induced alveolar epithelial cell apoptosis by a mitogen-activated protein kinase-dependent mechanism. Am J Respir Cell Mol Biol 32, 232–238. Wang H, Wen Y, Mooney S, Behr B, Polan ML, 2002: Phospholipase A(2) and cyclooxygenase gene expression in human preimplantation embryos. J Clin Endocrinol Metab 87, 2629–2634. Yamaguchi TP, Harpal K, Henkemeyer M, Rossant J, 1994: fgfr-1 is required for embryonic growth and mesodermal
© 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
patterning during mouse gastrulation. Genes Dev 8, 3032–3044. Yang QE, Giassetti MI, Ealy AD, 2011: Fibroblast growth factors activate mitogen-activated protein kinase pathways to promote migration in ovine trophoblast cells. Reproduction 141, 707–714. Zhang K, Ealy AD, 2012: Disruption of fibroblast growth factor receptor signaling in bovine cumulus-oocyte complexes
© 2014 Blackwell Verlag GmbH
7
during in vitro maturation reduces subsequent embryonic development. Domest Anim Endocrinol 42, 230–238. Zhang K, Hansen PJ, Ealy AD, 2010: Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 140, 815–826.
Submitted: 10 Jun 2014; Accepted: 9 Oct 2014 Author’s address (for correspondence): C M Barros, Department of Pharmacology, Institute of Biosciences, S~ao Paulo State University (UNESP), Botucatu, S~ao Paulo, Brazil. E-mail: [email protected]
Effects of FGF10 on Bovine Oocyte Meiosis Progression, Apoptosis, Embryo Development and Relative Abundance of Developmentally Important Genes In Vitro RF Pomini Pinto1, PK Fontes1, B Loureiro2, AC Sousa Castilho1, J Sousa Ticianelli1, E Montanari Razza1, RA Satrapa1, J Buratini3 and C Moraes Barros1 1 Department of Pharmacology, Institute of Biosciences, S~ ao Paulo State University (UNESP), Botucatu, SP, Brazil; 2Laboratory of Animal ao Paulo Reproductive Physiology, University of Vila Velha (UVV), Vila Velha, ES, Brazil; 3Department of Phisiology, Institute of Biosciences, S~ State University, Botucatu, SP, Brazil
Contents Fibroblast growth factor (FGF10) acts at the cumulus oocyte complex, increasing the expression of cumulus cell expansionrelated genes and oocyte competency genes. We tested the hypothesis that addition of FGF10 to the maturation medium improves oocyte maturation, decreases the percentage of apoptotic oocytes and increases development to the blastocyst stage while increasing the relative abundance of developmentally important genes (COX2, CDX2 and PLAC8). In all experiments, oocytes were matured for 22 h in TCM-199 supplemented with 0, 2.5, 10 or 50 ng/ml FGF10. In Experiment 1, after maturation, oocytes were stained with Hoechst to evaluate meiosis progression (metaphase I, intermediary phases and extrusion of the first polar body) and submitted to the TUNEL assay to evaluate apoptosis. In Experiment 2, oocytes were fertilized and cultured to the blastocyst stage. Blastocysts were frozen for analysis of COX2, CDX2 and PLAC8 relative abundance. In Experiment 1, 2.5 ng/ml FGF10 increased (p < 0.05) the percentage of oocytes with extrusion of the first polar body (35%) compared to 0, 10 and 50 ng/ml FGF10 (21, 14 and 12%, respectively) and FGF10 decreased the percentage of oocytes that were TUNEL positive in all doses studied. In Experiment 2, there was no difference in the percentage of oocytes becoming blastocysts between treatments and control. Real-time RT-PCR showed a tendency of 50 ng/ml FGF10 to increase the relative abundance of COX2 and PLAC8 and of 10 ng/ml FGF10 to increase CDX2. In conclusion, the addition of FGF10 to the oocyte maturation medium improves oocyte maturation in vitro, decreases the percentage of apoptotic oocytes and tends to increase the relative abundance of developmentally important genes.
Introduction In vitro maturation (IVM) of immature oocytes is widely used in assisted reproduction technologies in cattle and is increasingly used to treat human infertility. The developmental competence of IVM oocytes, however, is lower than pre-ovulatory, in vivo-matured oocytes (Humblot et al. 2005). A low-efficiency IVM alters embryo development, survival and implantation (Eppig 2001; Rizos et al. 2002; Gilchrist et al. 2004; McNatty et al. 2004; Gilchrist 2011). Poor oocyte development might be caused by an absence of nutrients and important development-stimulating growth factors in the maturation medium (Rizos et al. 2002, 2003; Lonergan et al. 2003). The fibroblast growth factors (FGFs) are a family of 22 proteins that act as important regulators of proliferation, morphogenesis and angiogenesis in many types of cells and tissues (Ornitz 2000; Ornitz and Itoh 2001). © 2014 Blackwell Verlag GmbH
Several FGFs are expressed in oocytes and follicular cells from cows, mice and pigs (Puscheck et al. 1997; Schams et al. 2009) and are considered mediators of folliculogenesis and oogenesis in the bovine species. Receptors for FGF1 and FGF2 (FGFR1 and FGFR2) are also found in embryos up to the 8-cell zygote (Ozawa et al. 2013), stage in which the transcripts are only from the maternal genome (Gilchrist et al. 2008). The importance of these receptors, whose ligands are FGF2 and FGF10 (Powers et al. 2000; B€ ottcher and Niehrs 2005), have been demonstrated in knock-out mouse studies that showed a lethal effect after the postimplantation stage (Deng et al. 1994, 1997; Yamaguchi et al. 1994; Arman et al. 1998). Furthermore, blocking FGFR activity during bovine oocyte IVM reduces embryo development to the blastocyst stage (Zhang and Ealy 2012). Fibroblast growth factor 10 has been given special attention as a regulator of follicle and oocyte development (Buratini et al. 2005a,b). Addition of FGF10 to oocyte IVM medium improves the expansion of cumulus cells, increases the relative abundance of genes related to this process (Caixeta et al. 2013), increases the number of oocytes with extrusion of the first polar body and improves development to the blastocyst stage (Zhang et al. 2010). To better understand the mechanisms by which FGF10 enhances developmental competence when added to the IVM medium, we tested the effects of FGF10 on the progression of meiosis and the incidence of apoptosis in oocytes matured in vitro. In addition, to assess the potential beneficial effect of FGF10 via improvement of the embryonic-maternal interface, we tested the hypothesis that the addition of FGF10 to the IVM medium would enhance the relative abundance of genes (COX2, CDX2 and PLAC8) controlling this process in in vitro-produced bovine embryos (Charpigny et al. 1997; Wang et al. 2002; Hall et al. 2005).
Material and Methods Oocyte in vitro maturation Bovine ovaries from Nelore and cross-bred cows were collected in an abattoir located 47 km from the laboratory and transported in a 0.9% NaCl aqueous solution at 37°C. Immature cumulus oocyte complexes (COCs) were obtained by aspiration of 2–8-mm follicles. The oocytes were classified according to their morphology (Khurana and Niemann 2000), and only those with
2
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros
a homogeneous cytoplasm and surrounded by at least one layer of cumulus cells were used. The COCs were incubated in groups of 15–25. Each 90 ll droplet of maturation medium consisted of TCM199 (Sigma-Aldrich, Saint Louis, MO, USA) (Earle’s salt) supplemented with 2 lg/ml sodium pyruvate (Sigma-Aldrich), 75 lg/ml gentamicin (Sigma-Aldrich), 10 UI/ml LH (Lutropinâ), 1 lg/ml FSH (Folltropinâ), 10 lg/ml estradiol 17b (Sigma-Aldrich) and 4 mg/ml bovine serum albumin (BSA). The droplets were covered with mineral oil (Sigma-Aldrich) and preincubated under the maturation conditions for a minimum of 2 h (38.5°C, 5% CO2 in air with 100% humidity). In all experiments, each maturation drop received human recombinant FGF10 (R&D Systems, Minneapolis, MN, USA) at 0, 2.5, 10 or 50 ng/ml diluted in PBS/0.1% BSA. Oocytes were matured for 22 h. In vitro fertilization and embryo culture In vitro fertilization took place in droplets (90 ll) containing Tyrode’s albumin lactate pyruvate (TALP) supplemented with 6 mg/ml fatty acid-free BSA (SigmaAldrich), 2 lg/ml sodium pyruvate (Sigma-Aldrich), 75 lg/ml gentamicin (Sigma-Aldrich), 11 lg/ml heparin and 44 lg/ml PHE (2 mM penicillamine, 1 mM hypotaurine, 250 mM epinephrine; Sigma-Aldrich). All experiments were carried out using a pool of two frozen semen samples from Nelore bulls. Semen was thawed at 37°C for 30 s, and spermatozoa were washed in a discontinuous Percoll gradient (Pharmacia, Uppsala, Sweden). After removal of the supernatant, spermatozoa were re-suspended in IVF medium, and the sperm suspension (1 9 106 cells/ml) was added into each droplet. All oocytes were placed in the fertilization drops with sperm. The samples were incubated 38.5°C in a saturated humidity atmosphere containing 5% CO2 for 12–18 h. Embryos were cultured in synthetic oviduct fluid medium (SOF, Holm et al. 1999) supplemented with 2% sodium pyruvate (Sigma-Aldrich) and 5% BSA (Gibco) under mineral oil in a humidified atmosphere of 5% CO2 at 38.5°C. Twelve to 18 h post-insemination (hpi), presumptive zygotes were denuded of surrounding cumulus cells by repeated pipetting. Afterwards, the plates with oocytes were placed in a plastic bag (25915 cm), where a gaseous mixture was injected (5% O2, 5% CO2 and 90% N2). From the initial number of oocytes, cleavage and blastocyst rates were calculated at 72 hpi and day 8 post-insemination, respectively. Culture medium was replaced at 72 hpi. Experiment 1: Effect of FGF10 on percentage of apoptosis and meiosis progression in in vitro-matured bovine oocytes This experiment was designed to test the effects of FGF10 on percentage of apoptosis and meiosis progression in in vitro-matured bovine oocytes. Oocytes were selected, treated with FGF10 (0, 2.5, 10 or 50 ng/ml) and matured as described above. After 22 h of maturation, oocytes were removed from maturation drops,
vortexed in hyaluronidase (1000 UI) to remove the cumulus cells and submitted to the TUNEL assay as described in Loureiro et al. (2011). Briefly, oocytes were fixed in 50 ll microdrops of 4% (w/v) paraformaldehyde in PBS for 1 h and then permeabilized in 0.5% (v/v) Triton X-100 containing 0.1% (w/v) sodium citrate for 1 h. Positive controls for the TUNEL assay were incubated in DNase (50 U/ml) at 37°C in the dark for 1 h. Positive controls and experimental oocytes were washed in PBS-PVP and incubated with 25 ll TUNEL reaction mixture for 1 h at 37°C. Negative controls were incubated without the enzyme. Each oocyte was washed thrice in PBS-PVP, slides were mounted with 5 ll microdrop of glycerol with Hoechst 33342 (1 lg/ml). Labelling was observed using an epifluorescence microscope (Leica Dx, S~ao Paulo, Brazil). Each oocyte was analyzed for TUNEL-positive nuclei using the FITC filter. Meiosis stage was analyzed using the DAPI filter. The stages of nuclear maturation were evaluated as previously described (Laforest 2005). Oocytes that contained one visible metaphasic plate were considered to be in metaphase I (MI) of meiosis. Oocytes that contained two separated DNA materials inside the cell were considered to be in an intermediary stage (anaphase I, telophase I or metaphase II without extrusion of the first polar body). Oocytes whose extrusion of the polar body could be visualized were considered to be in metaphase II with extrusion of the first polar body (mature oocytes). The experiment was replicated five times with 54–99 oocytes per replicate. Experiment 2: Effect of FGF10 during oocyte maturation on relative abundance of COX2, CDX2 and PLAC8 in the blastocyst stage embryo This experiment was designed to test the effects of addition of FGF10 on oocyte maturation markers COX2, CDX2 and PLAC8 in bovine blastocysts. Oocytes were matured and treated with different concentrations of FGF10 (0, 2.5, 10 or 50 ng/ml). After maturation, oocytes were fertilized, and putative zygotes were cultured until day 8 as described above. On day 8, blastocyst development was recorded and blastocysts were washed in PBS/PVP and frozen for RNA extraction. Total blastocyst RNA was extracted from pools of 5 embryos (5 replicates pools of 5 embryos, 25 embryos per treatment group) using the RNeasy kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s instructions. Total extracted RNA was stored at 80°C until RT-PCR analysis. RNA samples (8 ll) were incubated with DNase I (1 U/lg; Invitrogen) and reversetranscribed with SuperScript III (Invitrogen) and oligo-dT primers. Real-time RT-PCR analysis was performed with an ABI 7500 using Power Sybr Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). Reactions were carried out in 25 ll volumes under the following PCR cycling conditions: 95°C for 10 min, followed by 40 cycles at 95°C for 10 s and annealing for 1 min. Specific primers (Table 1) were designed using INTEGRATED DNA TECHNOLOGIES software (http://idtdna.com). Each sample was analyzed in duplicate, and the specificity of each PCR product was determined by melting © 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
3
Table 1. Primer sequences
Genes
Sequence
COX2
S:50 AAGCCTAGCACTTTCGGTGGAGAA30 A:50 TCCAGAGTGGGAAGAGCTTGCATT30 S:50 TGGAGCTGGAGAAGGAGTTTCACT30 A:50 TCCTTCGCTCTGCGGTTCTGAAAT30 S:50 GACTGGCAGACTGGCATCTT30 A:50 CTCATGGCGACACTTGATCC30 S:50 GCCATGGAGCGCTTTGG30 A:50 CCACAGTCAGCAATGGTGATCT30
CDX2 PLAC8 PPIA
Annealing temp (°C)
Base pairs
Primer efficiency (%)
60
168
95
56
133
93
60
140
98
60
65
102
curve analysis and amplicon size determination in agarose gels. Negative controls (water replacing cDNA) were run on every plate. To select the most stable housekeeping gene for detailed analysis of each cell type, peptidylprolyl isomerase A (PPIA), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and histone H2AFZ (H2AFZ) amplification profiles were compared using the geNorm applet for Microsoft Excel (medgen.ugent. be/genorm; (Ramakers et al. 2003). Based on this comparison, the relative quantification was performed with PPIA. The relative abundance of each target gene was calculated using the ΔΔCt method with efficiency correction (Pfaffl 2001). The mean efficiency value for each gene was calculated from the amplification profiles of individual samples with LINREGPCR software (Ramakers et al. 2003).
groups (21, 14 and 12%, respectively). This same concentration decreased (p < 0.05) the percentage of oocytes at the intermediary phase (35 vs 53, 48 and 53%, for 2.5, 10, 50 ng/ml FGF10 and control group, respectively). There was no difference in the percentage of oocytes in the MI stage between all groups. Meiosis progression was not different between 10 ng/ml FGF10, 50 ng/ml FGF10 and control (Fig. 1). Addition of FGF10 to the maturation medium significantly decreased the percentage of oocytes that were TUNEL positive from 33 in the control group to 15, 5 and 6 in the 2.5, 10 and 50 ng/ml FGF10 groups, respectively (Fig. 2). The same was true when TUNELpositive oocytes were analyzed separately in the maturation stages (Fig. 3). The reduction was greater at FGF10 concentrations of 10 and 50 ng/ml. Apoptosis reduction was significant in all stages analyzed.
Statistical analysis Data on meiosis progression, percentage of oocytes that were TUNEL positive and its interactions (meiosis stage*apoptosis) and embryo development to the blastocyst stage were analyzed by least-squares analysis of variance using the General Linear Models procedure of SAS (SAS for Windows, Version 9.0, Cary, NC, USA). Differences in individual mean values were analyzed through pairwise comparisons (probability of difference analysis [PDIFF]; SAS Institute Inc.). Percentage data were arcsin-transformed before analysis. Replicate was considered a random effect, and treatment was considered fixed. Data for target mRNA abundance were transformed to logarithms if not normally distributed. ANOVA was used to test for effects of FGF10 on mRNA. Differences between means were determined with the orthogonal contrast test. Data are presented as the means SEM. Significant differences were considered when p < 0.05, and 0.1 > p > 0.05 was considered a tendency.
Experiment 2: Effect of FGF10 during oocyte maturation on relative abundance of COX2, CDX2 and PLAC8 mRNA and bovine embryo development Real-time RT-PCR showed that FGF10 tended to increase the relative abundance of specific genes in the blastocysts depending on the concentration added to the maturation medium. Addition of 50 ng/ml FGF10 tended to increase the relative abundance of COX2 (p = 0.07) and PLAC8 (p = 0.09) in day 8 blastocysts, while addition of 10 ng/ml FGF10 tended to increase
Percentage of oocytes (%)
70 60
MI
Intermediary phase
Polar body extrusion a
a
ab
50 b
40 30
e
d d
20
d
10 0
Results Experiment 1: Effect of FGF10 on meiosis progression and percentage of apoptosis in in vitro-matured bovine oocytes Addition of FGF10 at 2.5 ng/ml hastened oocyte maturation by increasing (p < 0.05) the percentage of oocytes with extrusion of the first polar body (35%) when compared to control and 10 and 50 ng/ml FGF © 2014 Blackwell Verlag GmbH
Control
2.5
10
50
FGF10 (ng/ml) Fig. 1. Effects of FGF10 at different concentrations on the percentages of oocytes in metaphase I, in intermediary phases (anaphase I/ telophase I/metaphase II) and with extrusion of the first polar body. Oocytes were stained with Hoechst after 22 h of maturation. Values are presented as LSmeans SEM. The experiment was replicated five times (54-99 oocytes/replicate) with a total of 393 oocytes. For each maturation phase, results associated to bars with different letters differed significantly (p < 0.05)
Percentage of TUNEL-Positive oocytes (%)
4
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros 40
Table 2. Oocyte number, cleavage (recorded at D3) and blastocyst (recorded at D8) ratios from control and FGF10 treatment groups (LSmeans SEM; n = 5 replicates)
a
35 30
FGF10 (ng/ml)
25 b
20 15 10
c
c
10
50
Control 2.5 10 50
Oocyte (n) 170 135 165 169
Cleavage (%) 70.36 71.94 71.29 60.93
3.72 4.99 3.72 3.72
Blastocyst (%) 13.34 17.75 10.76 13.71
3.29 3.81 3.29 3.29
5 0
Control
2.5
FGF10 (ng/mL) Fig. 2. Effects of FGF10 at different concentrations on the percentage of TUNEL-positive oocytes. FGF10 decreased the percentage of apoptotic oocytes at all concentrations when compared with control. Values are presented as LSmeans SEM. The experiment was replicated five times (54–99 oocytes/replicate) with a total of 393 oocytes. Results associated to bars with different letters differed significantly (p < 0.05)
a
b d c e
c e
e
Fig. 3. Effects of FGF10 at different concentrations on the percentage of TUNEL positive in the different stages of oocyte maturation. FGF10 decreased the percentage of apoptotic oocytes at all concentrations in the differential stages of maturation. Values are presented as LSmeans SEM. Results associated to bars with different letters differed significantly (p < 0.05)
Fig. 4. Effect of FGF10 during in vitro maturation on the relative abundance of CDX2, COX2 and PLAC8 in in vitro-produced bovine blastocysts (n = 5; 5 blastocysts per pool). The results are presented as the means SEM and represent the relative abundance of the gene of interest normalized to PPIA through the ΔΔCt method. *COX2 and PLAC8 mRNA abundance tended to increase at 50 ng/ml of FGF10 (p = 0.07 and p = 0.09, respectively). **CDX2 mRNA abundance tended to increase at 10 ng/ml of FGF10 (p = 0.08). Statistical difference was considered when p ≤ 0.05 and tendency when 0.05 < p < 0.1
the relative abundance of CDX2 (p = 0.08) in day 8 blastocysts (Fig. 4). There was no difference in the percentage of oocytes that cleaved or became morulae and blastocysts between the control and FGF groups (Table 2).
Discussion Addition of FGF10 to the oocyte maturation medium decreased the percentage of apoptotic oocytes and showed a tendency to increase the relative abundance of three developmentally important genes (COX2, CDX2 and PLAC8) in day 8 blastocysts. Furthermore, FGF10 during IVM influenced oocyte meiosis progression, but it did not increase development to the blastocyst stage in this study. Fibroblast growth factor 1, 2, 6 and 8 can decrease cell death through anti-oxidative actions (Kwabi-Addo et al. 2004). The anti-apoptotic effect of FGF10 was reported by Upadhyay et al. (2004, 2005), who observed a decrease in apoptosis caused by asbestos in epithelial cell culture through the activation of the MAPK/ERK pathway. Other anti-apoptotic actions of FGF10 include protection of DNA against oxidative stress also through the MAPK/ERK pathway. In bovines, the MAPK pathway is responsible for oocyte activation and development. If this pathway is not activated, the oocytes will stay in the germinal vesicle state (Kubelka et al. 2000; Lonergan et al. 2003). However, if the phosphatidylinositol triphosphate (PI3K) or the serine/threonine protein kinase (Akt) pathway is not activated, the oocytes will go through the vesicle germinative stage but stay at the metaphase I stage, which suggests the importance of this pathway after the resumption of meiosis (Anas et al. 1998; Shimada et al. 2001). Furthermore, Hoshino and Sato (2008) showed in mice that inactivation of Akt signalling blocks the extrusion of the first polar body. Addition of FGF10 to embryonic liver culture induces Akt signalling pathway activation and cell proliferation (Mavila et al. 2012). According to our data, it is possible that FGF10 acts through the PI3K/Akt pathway because the addition of 2.5 ng/ml FGF10 to the maturation medium did not alter the percentage of oocytes in metaphase I but increased the development after this stage through the polar body extrusion stage. The activation of PI3K/Akt pathway would also act to decrease apoptosis through the regulation of BCL2 genes, similar to insulin growth factor I (Tomek and Smiljakovic 2005; Jousan and Hansen 2007; Hansen and Fear 2011). In this study, all © 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
5
doses used were able to decrease apoptosis, with 10 and 50 ng/ml showing the greatest effects. Even though FGF10 improved oocyte maturation and decreased apoptosis, it was not able to improve embryo development to the morulae and blastocyst stage. This result contrasts with Zhang et al. (2010), who observed that the addition of 0.5 ng/ml FGF10 to the maturation medium increased the percentage of oocytes that reached the blastocyst stage at day 7 in vitro. However, when analyzing day 8 blastocysts, 50 ng/ml FGF10 had equivalent results to 0.5 ng/ml. In their work, FSH concentration in the maturation medium was higher than ours (25 vs 1 lg/ml FSH). The amount of FSH in the medium can affect the FGF10 action through the increase in number of FGF receptors in granulosa cells (Buratini et al. 2007). When oocytes were devoided of cumulus cells, FGF10 was not able to improve maturation in vitro (Zhang et al. 2010). It is possible that different dosages of FGF10 are needed at different developmental stages of the oocyte and embryo. In Zhang’s work, the greater benefits to the oocyte meiotic maturation required 50 ng/ml FGF10, while extrusion of the first polar body had the best rates with 0.5 and 50 ng/ml. In our study, an intermediary dose (2.5 ng/ml) had the greatest extrusion of the first polar body rates. While 10 and 50 ng/ml FGF10 showed a greater decrease in apoptosis when compared with 2.5 ng/ml FGF10. Expression of FGF’s receptors is affected by FSH concentration in the maturation media (Caixeta et al. 2013). It is likely, though, that FGF10 action is being mediated indirectly by the presence of FSH, which regulates the expression of FGF receptors. The effects of FGF10 on oocyte maturation in vitro were also observed in the expression of developmentally important genes. In blastocysts, COX2 is necessary during the implantation period, being involved in elongation and embryonic-maternal communication (Charpigny et al. 1997; Wang et al. 2002). Blastocysts with higher expression of COX2 have higher pregnancy ratios compared to blastocysts that have lower expression of COX2, which results in non-pregnant cows or abortion (El-Sayed et al. 2006). The expression of COX2 in embryos derived from oocytes matured in the presence of FGF10 has not been described. However, Caixeta et al. (2013) showed that maturation of cumulus oocyte complexes with FGF10 for 22 h
References Anas MK, Shimada M, Terada T, 1998: Possible role for phosphatidylinositol 3-kinase in regulating meiotic maturation of bovine oocytes in vitro. Theriogenology 50, 347–356. Arman E, Haffner-Krausz R, Chen Y, Heath JK, Lonai P, 1998: Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci U S A 95, 5082–5087. B€ ottcher RT, Niehrs C, 2005: Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 26, 63–77.
© 2014 Blackwell Verlag GmbH
increases the expression of COX2 in the cumulus cells. In these cells, COX2 is a target gene for EGF-like factors and one of the genes responsible for cumulus cell expansion (Fru et al. 2007; Portela et al. 2011). In the present study, 10 ng/ml FGF10 tended to increase the relative abundance of CDX2, while 50 ng/ml FGF10 tended to increase the relative abundance of COX2 and PLAC8. CDX2 is a transcription factor expressed in the trophectoderm and is necessary for implantation and placental development (Hall et al. 2005). PLAC8 is an invasion protein, while CDX2 is expressed in the trophectoderm and is related to placental development. Both PLAC8 and CDX2 have higher expression in embryos that successfully implant and generate a pregnancy (El-Sayed et al. 2006). CDX2knockout mouse embryos fail to implant due to a loss of trophoblastic epithelial cell integrity and an increase in apoptosis in these same cells (Chawengsaksophak et al. 1997; Rossant 2001). Additionally, endometrium expression of PLAC8 is higher in pregnant cows, suggesting the important role of this gene in the embryonic-maternal interface (Galaviz-Hernandez et al. 2003; Klein et al. 2006). In an ovine trophoblastic cell line, Yang et al. (2011) showed that addition of FGF10 can increase proliferation and migration. It was our hypothesis that, even though addition of FGF10 to the oocyte maturation medium did not influence the percentage of embryos that developed to the blastocyst stage, FGF10 might have been acting to improve embryo quality by increasing the relative abundance of genes important for development and survival. We have concluded that addition of FGF10 to the maturation medium can improve oocyte and embryo quality by decreasing apoptosis, increasing meiosis progression and increasing the relative abundance of developmentally important genes. Conflict of interest None of the authors have any conflict of interest to declare.
Author contributions Pomini Pinto, Fonte, Sousa Castilho, Satrapa, Montanari Razza, Sousa Ticianelli worked on the experiments. Moraes Barros, Buratini and Loureiro analyzed the data. Loureiro designed the study and wrote the manuscript.
Buratini J, Glapinski VF, Giometti IC, Teixeira AB, Costa IB, Avellar MC, Barros CM, Price CA, 2005a: Expression of fibroblast growth factor-8 and its cognate receptors, fibroblast growth factor receptor (FGFR)-3c and-4, in fetal bovine preantral follicles. Mol Reprod Dev 70, 255–261. Buratini J, Teixeira AB, Costa IB, Glapinski VF, Pinto MG, Giometti IC, Barros CM, Cao M, Nicola ES, Price CA, 2005b: Expression of fibroblast growth factor-8 and regulation of cognate receptors, fibroblast growth factor receptor-3c and -4, in bovine antral follicles. Reproduction 130, 343–350. Buratini J, Pinto MG, Castilho AC, Amorim RL, Giometti IC, Portela VM, Nicola ES,
Price CA, 2007: Expression and function of fibroblast growth factor 10 and its receptor, fibroblast growth factor receptor 2B, in bovine follicles. Biol Reprod 77, 743–750. Caixeta ES, Machado MF, Ripamonte P, Price CA, Buratini J, 2013: Effects of FSH on the expression of receptors for oocyte-secreted factors and members of the EGF-like family during in vitro maturation in cattle. Reprod Fertil Dev 25, 890–899. Charpigny G, Reinaud P, Tamby JP, Creminon C, Guillomot M, 1997: Cyclooxygenase-2 unlike cyclooxygenase-1 is highly expressed in ovine embryos during the implantation period. Biol Reprod 57, 1032–1040.
6
RF Pomini Pinto, PK Fontes, B Loureiro, AC Sousa Castilho, J Sousa Ticianelli, E Montanari Razza, RA Satrapa, J Buratini and C Moraes Barros
Chawengsaksophak K, James R, Hammond VE, K€ ontgen F, Beck F, 1997: Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386, 84–87. Deng CX, Wynshaw-Boris A, Shen MM, Daugherty C, Ornitz DM, Leder P, 1994: Murine FGFR-1 is required for early postimplantation growth and axial organization. Genes Dev 8, 3045–3057. Deng C, Bedford M, Li C, Xu X, Yang X, Dunmore J, Leder P, 1997: Fibroblast growth factor receptor-1 (FGFR-1) is essential for normal neural tube and limb development. Dev Biol 185, 42–54. El-Sayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E, Sirard MA, Schellander K, Tesfaye D, 2006: Large-scale transcriptional analysis of bovine embryo biopsies in relation to pregnancy success after transfer to recipients. Physiol Genomics 28, 84–96. Eppig JJ, 2001: Oocyte control of ovarian follicular development and function in mammals. Reproduction 122, 829–838. Fru KN, Cherian-Shaw M, Puttabyatappa M, VandeVoort CA, Chaffin CL, 2007: Regulation of granulosa cell proliferation and EGF-like ligands during the periovulatory interval in monkeys. Hum Reprod 22, 1247–1252. Galaviz-Hernandez C, Stagg C, de Ridder G, Tanaka TS, Ko MS, Schlessinger D, Nagaraja R, 2003: Plac8 and Plac9, novel placental-enriched genes identified through microarray analysis. Gene 309, 81–89. Gilchrist RB, 2011: Recent insights into oocyte-follicle cell interactions provide opportunities for the development of new approaches to in vitro maturation. Reprod Fertil Dev 23, 23–31. Gilchrist RB, Ritter LJ, Armstrong DT, 2004: Oocyte-somatic cell interactions during follicle development in mammals. Anim Reprod Sci 82–83, 431–446. Gilchrist RB, Lane M, Thompson JG, 2008: Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum Reprod Update 14, 159–177. Hall VJ, Ruddock NT, French AJ, 2005: Expression profiling of genes crucial for placental and preimplantation development in bovine in vivo, in vitro, and nuclear transfer blastocysts. Mol Reprod Dev 72, 16–24. Hansen PJ, Fear JM, 2011: Cheating death at the dawn of life: developmental control of apoptotic repression in the preimplantation embryo. Biochem Biophys Res Commun 413, 155–158. Holm P, Booth PJ, Schmidt MH, Greve T, Callesen H, 1999: High bovine blastocyst development in a static in vitro production system using SOFaa medium supplemented with sodium citrate and myo-inositol with or without serum-proteins. Theriogenology 52, 683–700. Hoshino Y, Sato E, 2008: Protein kinase B (PKB/Akt) is required for the completion of meiosis in mouse oocytes. Dev Biol 314, 215–223. Humblot P, Holm P, Lonergan P, Wrenzycki C, Lequarre AS, Joly CG, Herrmann D, Lopes A, Rizos D, Niemann H, Callesen H, 2005: Effect of stage of follicular growth during super-
ovulation on developmental competence of bovine oocytes. Theriogenology 63, 1149–1166. Jousan FD, Hansen PJ, 2007: Insulin-like growth factor-I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti-apoptotic actions requiring PI3K signaling. Mol Reprod Dev 74, 189–196. Khurana NK, Niemann H, 2000: Energy metabolism in preimplantation bovine embryos derived in vitro or in vivo. Biol Reprod 62, 847–856. Klein C, Bauersachs S, Ulbrich SE, Einspanier R, Meyer HH, Schmidt SE, Reichenbach HD, Vermehren M, Sinowatz F, Blum H, Wolf E, 2006: Monozygotic twin model reveals novel embryo-induced transcriptome changes of bovine endometrium in the preattachment period. Biol Reprod 74, 253–264. Kubelka M, Motlık J, Schultz RM, Pavlok A, 2000: Butyrolactone I reversibly inhibits meiotic maturation of bovine oocytes, without influencing chromosome condensation activity. Biol Reprod 62, 292– 302. Kwabi-Addo B, Ozen M, Ittmann M, 2004: The role of fibroblast growth factors and their receptors in prostate cancer. Endocr Relat Cancer 11, 709–724. Laforest M, 2005: Le contr^ ole de la maturation nucleaire des ovocytes porcins. Implication de la phosphodiesterase de type 3 et de l’AMPK (50 adenosine monophosphate-activated protein kinase). Universite Laval, Quebec, Canada. Lonergan P, Rizos D, Gutierrez-Adan A, Fair T, Boland MP, 2003: Oocyte and embryo quality: effect of origin, culture conditions and gene expression patterns. Reprod Domest Anim 38, 259–267. Loureiro B, Oliveira LJ, Favoreto MG, Hansen PJ, 2011: Colony-stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am J Reprod Immunol 65, 578–588. Mavila N, James D, Utley S, Cu N, Coblens O, Mak K, Rountree CB, Kahn M, Wang KS, 2012: Fibroblast growth factor receptor-mediated activation of AKT-b-catenin-CBP pathway regulates survival and proliferation of murine hepatoblasts and hepatic tumor initiating stem cells. PLoS ONE 7, e50401. McNatty KP, Moore LG, Hudson NL, Quirke LD, Lawrence SB, Reader K, Hanrahan JP, Smith P, Groome NP, Laitinen M, Ritvos O, Juengel JL, 2004: The oocyte and its role in regulating ovulation rate: a new paradigm in reproductive biology. Reproduction 128, 379–386. Ornitz DM, 2000: FGFs, heparan sulfate and FGFRs: complex interactions essential for development. BioEssays 22, 108–112. Ornitz DM, Itoh N, 2001: Fibroblast growth factors. Genome Biol, 2, REVIEWS3005. Ozawa M, Yang QE, Ealy AD, 2013: The expression of fibroblast growth factor receptors during early bovine conceptus development and pharmacological analysis of their actions on trophoblast growth in vitro. Reproduction 145, 191–201. Pfaffl MW, 2001: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45.
Portela VM, Zamberlam G, Goncßalves PB, de Oliveira JF, Price CA, 2011: Role of angiotensin II in the periovulatory epidermal growth factor-like cascade in bovine granulosa cells in vitro. Biol Reprod 85, 1167–1174. Powers CJ, McLeskey SW, Wellstein A, 2000: Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 7, 165–197. Puscheck EE, Patel Y, Rappolee DA, 1997: Fibroblast growth factor receptor (FGFR)-4, but not FGFR-3 is expressed in the pregnant ovary. Mol Cell Endocrinol 132, 169–176. Ramakers C, Ruijter JM, Deprez RH, Moorman AF, 2003: Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339, 62–66. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P, 2002: Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for blastocyst yield and blastocyst quality. Mol Reprod Dev 61, 234–248. Rizos D, Gutierrez-Adan A, Perez-Garnelo S, De La Fuente J, Boland MP, Lonergan P, 2003: Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biol Reprod 68, 236–243. Rossant J, 2001: Stem cells in the mammalian blastocyst. Harvey Lect 97, 17–40. Schams D, Steinberg V, Steffl M, Meyer HH, Berisha B, 2009: Expression and possible role of fibroblast growth factor family members in porcine antral follicles during final maturation. Reproduction 138, 141–149. Shimada M, Zeng WX, Terada T, 2001: Inhibition of phosphatidylinositol 3-kinase or mitogen-activated protein kinase kinase leads to suppression of p34 (cdc2) kinase activity and meiotic progression beyond the meiosis I stage in porcine oocytes surrounded with cumulus cells. Biol Reprod 65, 442–448. Tomek W, Smiljakovic T, 2005: Activation of Akt (protein kinase B) stimulates metaphase I to metaphase II transition in bovine oocytes. Reproduction 130, 423–430. Upadhyay D, Bundesmann M, Panduri V, Correa-Meyer E, Kamp DW, 2004: Fibroblast growth factor-10 attenuates H2O2-induced alveolar epithelial cell DNA damage: role of MAPK activation and DNA repair. Am J Respir Cell Mol Biol 31, 107–113. Upadhyay D, Panduri V, Kamp DW, 2005: Fibroblast growth factor-10 prevents asbestos-induced alveolar epithelial cell apoptosis by a mitogen-activated protein kinase-dependent mechanism. Am J Respir Cell Mol Biol 32, 232–238. Wang H, Wen Y, Mooney S, Behr B, Polan ML, 2002: Phospholipase A(2) and cyclooxygenase gene expression in human preimplantation embryos. J Clin Endocrinol Metab 87, 2629–2634. Yamaguchi TP, Harpal K, Henkemeyer M, Rossant J, 1994: fgfr-1 is required for embryonic growth and mesodermal
© 2014 Blackwell Verlag GmbH
FGF10 on Bovine Oocyte Development
patterning during mouse gastrulation. Genes Dev 8, 3032–3044. Yang QE, Giassetti MI, Ealy AD, 2011: Fibroblast growth factors activate mitogen-activated protein kinase pathways to promote migration in ovine trophoblast cells. Reproduction 141, 707–714. Zhang K, Ealy AD, 2012: Disruption of fibroblast growth factor receptor signaling in bovine cumulus-oocyte complexes
© 2014 Blackwell Verlag GmbH
7
during in vitro maturation reduces subsequent embryonic development. Domest Anim Endocrinol 42, 230–238. Zhang K, Hansen PJ, Ealy AD, 2010: Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 140, 815–826.
Submitted: 10 Jun 2014; Accepted: 9 Oct 2014 Author’s address (for correspondence): C M Barros, Department of Pharmacology, Institute of Biosciences, S~ao Paulo State University (UNESP), Botucatu, S~ao Paulo, Brazil. E-mail: [email protected]
