JOURNAL OF TISSUE ENGINEERING AND REGENERATIVE MEDICINE RESEARCH J Tissue Eng Regen Med (2014) Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/term.1911
ARTICLE
Effects of naringin on the proliferation and osteogenic differentiation of human amniotic fluid-derived stem cells Meimei Liu1, Yan Li2* and Shang-Tian Yang1* 1 2
William G. Lowrie Department of Chemical and Biomolecular Engineering, Ohio State University, Columbus, OH, USA Department of Chemical and Biomedical Engineering, FAMU-FSU College of Engineering, Florida State University, Tallahassee, FL, USA
Abstract Human amniotic fluid-derived stem cells (hAFSCs) are a novel cell source for generating osteogenic cells to treat bone diseases. Effective induction of osteogenic differentiation from hAFSCs is critical to fulfil their therapeutic potential. In this study, naringin, the main active compound of Rhizoma drynariae (a Chinese herbal medicine), was used to stimulate the proliferation and osteogenic differentiation of hAFSCs. The results showed that naringin enhanced the proliferation and alkaline phosphatase activity (ALP) of hAFSCs in a dose-dependent manner in the range 1–100 μg/ml, while an inhibition effect was observed at 200 μg/ml. Consistently, the calcium content also increased with naringin concentration up to 100 μg/ml. The enhanced osteogenic differentiation of hAFSCs by naringin was further confirmed by the dose-dependent upregulation of marker genes, including osteopontin (OPN) and Collagen I from RT–PCR analysis. The increased osteoprotegerin (OPG) expression and minimal expression of receptor activator of nuclear factor-κB ligand (RANKL) suggested that naringin also inhibited osteoclastogenesis of hAFSCs. In addition, the gene expressions of bone morphogenetic protein 4 (BMP4), runt-related transcription factor 2 (RUNX2), β-catenin and Cyclin D1 also increased significantly, indicating that naringin promotes the osteogenesis of hAFSCs via the BMP and Wnt–β-catenin signalling pathways. These results suggested that naringin can be used to upregulate the osteogenic differentiation of hAFSCs, which could provide an attractive and promising treatment for bone disorders. Copyright © 2014 John Wiley & Sons, Ltd. Received 12 July 2013; Revised 21 March 2014; Accepted 20 April 2014
Keywords amniotic fluid-derived stem cell; naringin; osteogenic differentiation; proliferation; mesenchymal stem cells; signalling pathways
1. Introduction Bone diseases, especially osteoporosis, bring serious issues to public health. Osteoporosis is characterized by low bone mineral density and microarchitecture deterioration, resulting in structural instability of bone tissue and a high *Correspondence to: Shang-Tian Yang, William G. Lowrie Department of Chemical and Biomolecular Engineering, Ohio State University, 140 West 19th Avenue, Columbus, OH 43210, USA. E-mail: [email protected] Yan Li, Department of Chemical and Biomedical Engineering, FAMU-FSU College of Engineering, Florida State University, 2525 Pottsdamer St., Tallahassee, Florida 32310USA. E-mail: [email protected] Copyright © 2014 John Wiley & Sons, Ltd.
fracture risk. Oestrogen withdrawal is the most wellrecognized cause of osteoporosis (NIH, 2000), which happens more commonly in the senior society and results in excess morbidity, mortality and decreased quality of life. More than 200 million people in the world and 44 million in the USA suffer from osteoporosis (Reginster and Burlet, 2006), and more than 1.5 million fractures associated with osteoporosis occur each year in America (Orsini et al., 2005). National costs on the medical care expenses related to bone fractures were more than $17 billion in 2005, and a cumulative cost of $474 billion is estimated for the next two decades (AAOS, 2008). Oestrogen replacement therapy (ERT) has been considered to be the most effective treatment for osteoporosis in the past 10 years. However, long-term use of oestrogen could increase the risk of breast
M. Liu et al.
cancer, endometrial carcinoma and cardiovascular diseases (Jiao et al., 2009; NIH, 2000). Bisphosphonate therapy is another method developed in the last decade. Nevertheless, it only inhibits the resorption of osteoclasts and can cause acute incapacitating bone, joint and muscle pain (Licata, 2005; Rotella, 2002). Amniotic fluid-derived stem cells (AFSCs) are a novel cell source for tissue engineering and regenerative medicine because they have high potential to differentiate into osteoblasts, chondrocytes and adipocytes, as well as the cell types in other germ layers (De Coppi et al., 2007; Guan et al., 2011; Ma et al., 2012). AFSCs possess the phenotype of mesenchymal stem cells (MSCs) but express both embryonic and adult stem cell markers (Yeh et al., 2010). MSCs have promising capacities to heal bone fractures and thus have attracted much attention in treating bone diseases (Egermann et al., 2005). Animal studies showed that MSCs could possibly be involved in bone formation through intravenous infusion to target bones (Liu et al., 2014c). Compared to bone marrowderived MSCs, AFSCs have higher self-renewal capacity and are more potent for lineage-specific differentiation (De Coppi et al., 2007; Liu et al., 2014b Trohatou et al., 2013). Compared to pluripotent stem cells, AFSCs are not tumourigenic and present no ethical concerns for clinical use. Therefore, AFSCs are superior candidates for cell-based therapies, especially for the treatment of bone disorders. Rhizoma drynariae is a traditional Chinese herbal medicine, which has been commonly used to treat orthopaedic disorders and bone healing for thousands of years (Wong et al., 2007). Modern pharmacological study indicates that naringin, a polymethoxylated flavonoid, is the main active compound of Rhizoma drynariae. Naringin has been found to enhance the alkaline phosphatase level of osteoblastic MC3T3-E1 cells (Jeong et al., 2005) and the differentiation and maturation of rat calvarial osteoblasts (Zhai et al., 2013). A recent study showed that gelatin composite containing naringin enhanced the osteoclast activity of mixed bone cells (Chen et al., 2013). In vivo, naringin has been found to protect against ovariectomyinduced bone loss in mice, which might be mediated through ligand-dependent activation of oestrogen receptors in osteoblastic cells (Pang et al., 2010). In a rat osteoporosis model, naringin was found to reverse ovariectomy-induced bone loss by increasing bone mineral density, bone volume and trabecular thickness (Li et al., 2013c). Because of the positive effects of naringin on treating bone tissues and cells, naringin has been used recently to stimulate the proliferation and osteogenic differentiation of bone marrow-derived MSCs (Li et al., 2013c; Zhang et al., 2009b). However, its effects on the underlying signal transduction pathways have not been investigated. Since AFSCs are superior candidates for cell-based therapies and may provide a better cell source for osteogenic differentiation (De Coppi et al., 2007; Rodrigues et al., 2012; Roubelakis et al., 2007), the potential of using naringin to regulate and enhance human AFSC osteogenic differentiation was investigated in this study. For the first time, the role of naringin in regulating the signalling Copyright © 2014 John Wiley & Sons, Ltd.
pathways involved in the osteogenic differentiation of AFSCs was also elucidated and is reported in this paper.
2. Materials and methods 2.1. Culture of human amniotic fluid-derived stem cells (hAFSCs) Human AFSCs were kindly provided by Dr Anthony Atala and Dr James Yoo at Wake Forest Institute. The cells were isolated and cultured as previously described (De Coppi et al., 2007). All culture reagents were purchased from Life Technologies unless otherwise noted. The cells were cultured in growth medium, which contained α-minimum essential medium (α-MEM) supplemented with 15% embryonic stem cell qualified-fetal bovine serum (ES-FBS), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 18% Chang B and 2% Chang C (Irvine Scientific, Santa Ana, CA, USA). The hAFSCs were maintained at 37°C in a humidified 5% CO2 incubator and subcultured at 70% confluence. The culture medium was changed every 3 days. Cells at passages 16–18 were used in this study.
2.2. hAFSC treatment with naringin Naringin (≥90% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The hAFSCs (1 × 104 cells/ml) were seeded in 48-, 24- and six-well plates and cultured in growth medium until 70–80% confluence. Then, the cells were cultured in differentiation medium, which contained α-MEM, 17% FBS (Atlanta Biologicals, Atlanta, GA, USA), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. Various amounts of naringin were added in the differentiation medium to final concentrations of 1, 10, 100 and 200 μg/ml, respectively (Zhang et al., 2009b). Cells cultured in medium without naringin were used as negative control. Media were changed every 3 days. The cells were evaluated for proliferation (1–4 days) and alkaline phosphatase (ALP) activity as an early marker (day 7). Calcium deposition (day 21), osteogenic gene expression (day 21) and alizarin red S staining (days 21 and 28) were evaluated for late stages of osteogenic differentiation. For each assay, the time window was chosen based on the stage of the markers. To test the effects of Wnt signalling and bone morphogenetic protein (BMP) signalling, 0.2 μg/ml Wnt-inhibitor DKK-1 (Peprotech, Rocky Hill, NJ, USA) or 1 μg/ml BMP-inhibitor noggin (Sigma-Aldrich) was added to the hAFSCs treated with 100 μg/ml naringin. After 7 days of culture, the cells were analysed for ALP activity, an early marker of osteogenesis.
2.3. Cell proliferation analysis The hAFSCs (5 × 103 per well) were seeded in a 48-well plate. After 24 h of incubation, the growth medium was changed into naringin-containing media at a concentration of 0 (Control), 1, 10, 100, and 200 μg/ml accordingly. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Cells were incubated at 37°C in a humidified 5% CO2 incubator for 1, 2, 3 or 4 days. After that, the medium was replaced with 500 μl of 10% Alamar Blue (AbD Serotec, Raleigh, NC) solution at 37°C for 3 h. The fluorescence of the medium was then monitored in triplicate at 535 nm excitation wavelength and 590 nm emission wavelength using a GENios Pro plate reader (Tecan, Research Triangle Park, NC). A standard calibration curve was established between the fluorescence intensity and the cell numbers counted by hemacytometer. Cell proliferation was indicated by the fold increase of the measured fluorescence intensity compared to the intensity of starting cells.
2.4. Alkaline phosphatase activity assay Osteogenesis of hAFSCs was induced in differentiation medium containing naringin. At day 7, the cells were washed twice with PBS and lysed with lysis buffer, consisting of 20 mM Tris–HCl, pH 7.5, 150 mM NaCl and 1% Triton X-100, for 5 min. The chromogenic substrate for ALP was p-nitrophenyl phosphate (pNPP; SigmaAldrich). 50 μl lysed sample was mixed with 50 μl pNPP (1 mg/ml) substrate solution containing 1.0 mg/ml pNPP, 0.2 M Tris buffer and 5 mM MgCl2 at 37°C for 15 min on a Belly Button Shaker (MidSci, St. Louis, MO, USA). The reaction was stopped by adding 25 μl 3 N NaOH. Absorbance of p-nitrophenol released in the samples was measured at 405 nm, using a SpectraMAX 250 microplate reader (Molecular Devices, Sunnyvale, CA, USA). The protein concentration of cell lysate was determined using the Bradford assay at 595 nm on a microplate spectrophotometer (Bio-Rad, USA). The ALP activity was normalized according to the total protein content of cell lysate and expressed as nM (p-nitrophenyl)/min/mg protein.
2.5. Alizarin red S (ARS) staining ARS staining was performed to evaluate the calcium deposition in cells of the osteogenic lineage obtained from hAFSCs. The cells were evaluated after 21 and 28 days; however, little positive staining was observed for cells at 21 days. Briefly, cells cultured in a 24-well plate for 21–28 days were rinsed twice with PBS, fixed with 10% v/v formalin and then stained with 1% w/v ARS solution. Orange red staining indicated the location and intensity of the calcium deposition. The presence of calcium was observed using a light microscope Olympus IX71 (Olympus Corporation, Tokyo, Japan).
2.6. Calcium assay To quantify mineralization, the calcium deposition in hAFSCs after 21 days was measured using Calcium Assay (Genzyme Diagnostics, Charlottetown, PE, Canada). Samples were added with 1 M acetic acid and placed on a vortex overnight at 4°C to extract the calcium from the mineralized matrix. In a 96-well clear polycarbonate Copyright © 2014 John Wiley & Sons, Ltd.
plate, 15 μl cell extract was mixed with 150 μl Calcium Assay reagent and incubated for 30 s at room temperature. The absorbance at 650 nm was determined using a SpectraMAX 250 microplate reader. The samples were measured in triplicate and compared to the calcium calibration curve. The calcium deposition was normalized by cell number and expressed as mM/cell.
2.7. Reverse transcriptase–polymerase chain reaction (RT–PCR) Total RNA was isolated from hAFSCs treated with different concentrations of naringin, using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). RNA concentrations were measured using a ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). After that, 1 μg RNA was initially reverse-transcribed into cDNA using the SuperScript™ III First-Strand Synthesis System (Invitrogen). Then 200 ng of the cDNA was used as a template for the amplification of the target genes, using the Quick-Load® Taq 2× Master Mix Kit (BioLabs, Ipswich, MA, USA). The primer sequences of the analysed genes and PCR conditions are listed in Table 1. For osteogenic differentiation, the genes osteopontin (OPN), collagen I and ALP were measured. For the bone morphogenetic protein (BMP) pathway, the genes runt-related transcription factor 2 (RUNX2) and BMP4 were measured. For the Wnt pathway, β-catenin and Cyclin D1 were analysed. For osteoclast differentiation, osteoprotegerin (OPG) and receptor activator of nuclear factor-κB ligand (RANKL) were measured. The housekeeping gene, glyceraldehyde3-phosphate dehydrogenase (GAPDH), was used as an endogenous reference gene. Amplified products were fractionated in a 2% agarose (Fisher-Scientific, Pittsburgh, PA, USA) gel at 70 V for 80 min and visualized and photographed using a Gel Doc 2000 Gel Documentation System (Bio-Rad, Hercules, CA, USA). The expression level of each gene was analysed using ImageJ Software and normalized to GAPDH expression.
2.8. Statistical analysis Unless otherwise noted, all experiments and samples were triplicated. Experimental results are presented as mean ± standard deviation (SD) (n = 3) and analysed using one-way ANOVA, followed by paired Tukey–Kramer analysis using JMP 7.0 (SAS Institute Inc., Cary, NC, USA), with p < 0.05 considered as significant.
3. Results 3.1. Effect of naringin on the proliferation of hAFSCs The stimulation effect of naringin on the proliferation of hAFSCs during 4 days of culture was evaluated at various J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al. Table 1. Primers used in the RT-PCR for osteogenic differentiation of hAFSCs Gene RUNX2 OPN Collagen I ALP Cyclin D1 β-Catenin BMP4 OPG RANKL GAPDH
Forward primer*
Reverse primer*
Tm (ºC)**
AGTGGACGAGGCAAGAGTTTC GAGACCCTTCCAAGTAAGTCCA ACAGCCGCTTCACCTACAGC CCCAAAGGCTTCTTCTTG CCCTCGGTGTCCTACTTCA TGGCAACCAAGAAAGCAAG CGAATGCTGATGGTCGTTT TGCTGTTCCTACAAAGTTTACG CCAGCATCAAAATCCCAAGT GTGGTCTCCTCTGACTTCAACA
CCTTCTGGGTTCCCGAGGT GATGTCCTCGTCTGTAGCATCA TGCACTTTTGGTTTTTGGTCAT CTGGTAGTTGTTGTGAGC GTTTGTTCTCCTCCGCCTCT CTGAACAAGAGTCCCAAGGAG CAGGGATGCTGCTGAGGTTA CTTTGAGTGCTTTAGTGCGTG CCCCAAAGTATGTTGCATCCTG CTCTTCCTCTTGTGCTCTTGCT
62 62 52 Touch down 55 55 Touch down 52 Touch down 62
*Sequences are depicted in the 5′–3′ direction. **Tm is the annealing temperature at which the primer binds to the RNA template during polymerase chain reaction. Touch down, Tm 62–52°C, decrease 0.5°C/cycle and the following cycles were run at 52°C. All the genes used 35 cycles. Osteogenic genes, osteopontin (OPN), collagen I and alkaline phosphatase (ALP). Genes in bone morphogenetic protein (BMP) pathway, runt-related transcription factor 2 (RUNX2) and BMP4. Genes in Wnt pathway, β-catenin and Cyclin D1. Genes in osteoclast differentiation, osteoprotegerin (OPG) and receptor activator of nuclear factor-κB ligand (RANKL). Housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
concentrations (1–200 μg/ml) (Figure 1). In the presence of naringin, the proliferation fold of hAFSCs increased in a dose-dependent manner in the range 1–100 μg/ml. For example, on day 3, naringin increased the proliferation from 18.8 ± 1.0-fold in the control to 19.6 ± 0.4-, 22.8 ± 0.6- (p < 0.05) and 25.5 ± 0.6-fold (p < 0.05) at 1, 10 and 100 μg/ml, respectively. The use of 100 μg/ml naringin, the most effective concentration, increased the proliferation by 27.7 ± 5.8%, 31.7 ± 10.0%, 35.4 ± 3.1% and 19.4 ± 2.5% compared to the control on days 1, 2, 3 and 4, respectively. However, 200 μg/ml naringin slightly inhibited the proliferation of hAFSCs by 2–5% compared to control, indicating that a high concentration (≥200 μg/ml) of naringin may be harmful to cell growth. Thus, naringin within the range 0–100 μg/ml had no cytotoxic effect and stimulated the proliferation of hAFSCs.
3.2. Effect of naringin on ALP activity of hAFSCs ALP activity was used to indicate the early osteogenic differentiation of hAFSCs. Naringin was shown to increase the ALP activity of hAFSCs in a dose-dependent manner
Figure 1. Effect of naringin on the proliferation of hAFSCs: N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 Copyright © 2014 John Wiley & Sons, Ltd.
in the range 1–100 μg/ml after 7 days of culture (Figure 2). Compared to the control, ALP activity increased 44 ± 17%, 57 ± 13% and 163 ± 40% in the presence of 1 μg/ml, 10 μg/ml and 100 μg/ml naringin, respectively (p < 0.05 for all three concentrations). The ALP activity of hAFSCs treated with 200 μg/ml naringin also increased 74 ± 14%, but was lower than that treated with 100 μg/ml naringin (p < 0.05).
3.3. Effect of naringin on calcium deposition The ARS staining after 28 days of naringin treatment was performed to detect the presence of calcium. In the presence of naringin, more calcium deposition was observed compared to the control group (Figure 3A). At the concentration of 1–100 μg/ml naringin, calcium deposition increased in a dose-dependent manner, while cells treated with 200 μg/ml naringin (N200) produced less calcium than the 100 μg/ml naringin group (N100). The osteogenic differentiation of the cells was further investigated by quantifying the calcium content (Figure 3B).
Figure 2. ALP activity of hAFSCs after naringin treatment; percentage increase was calculated as (N1 – N0)/N0; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Figure 3. Osteogenic differentiation of hAFSCs after naringin treatment: (A) alizarin red S (ARS) staining of hAFSCs after naringin treatment; (B) calcium deposition of naringin-treated hAFSCs. The percentage increase was calculated as (Ni – N0)/N0; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05
Consistently, naringin increased calcium deposition in a dose-dependent manner, especially at concentrations of 10–100 μg/ml. Compared to the control group, the calcium content increased 31 ± 25%, 44 ± 21% (p < 0.05) and 239 ± 67% (p < 0.05) in the presence of 1, 10 and 100 μg/ml naringin, respectively. The calcium content in the N200 group was much lower than that of the N100 group and only increased 15 ± 24% compared to control. Hence, both calcium quantification and ARS staining results confirmed that naringin promoted calcium deposition in hAFSCs.
3.4. Effect of naringin on the expression of osteogenic markers The RT–PCR results for osteogenic differentiation of hAFSCs showed that the osteogenic marker genes, including OPN and Collagen I, were significantly upregulated with naringin treatment compared to the control group at day 21 (Figure 4A, B). The gene expression of ALP was lower than that of OPN and Collagen I for the N1, N10 and N100 groups, probably because ALP is an early marker of osteogenic differentiation. In general, naringin increased the expression of osteogenic differentiation markers in a dose-dependent manner at concentrations of 1–100 μg/ml, while at 200 μg/ml the expression levels were reduced.
3.5. Effect of naringin on the expression of inhibition markers of osteoclastogenesis The gene expression of OPG was also markedly increased by naringin in a dose-dependent manner at concentrations Copyright © 2014 John Wiley & Sons, Ltd.
of 1–100 μg/ml (Figure 4C, D). Meanwhile, little expression of RANKL was observed in the presence of naringin. It should be noted that RANKL expression was observed in the presence of curculigoside, an active component in another Chinese herbal medicine in our study (Liu et al., 2014a). Hence, the minimal RANKL expression was not due to the detection method. The ratio between mRNA expressions of OPG to RANKL (OPG:RANKL) is usually used as an indicator of osteoclastogenesis inhibition. The dose-dependent expression of OPG and minimal expression of RANKL indicated that naringin promoted the expression of inhibiting factors for osteoclastogenesis by increasing the relative portion of OPG, thus enhancing the osteogenic differentiation of hAFSCs.
3.6. Effects of naringin on BMP and Wnt–βcatenin pathways The BMP and Wnt signalling pathways have been reported to be involved in the osteogenic differentiation of MSCs (Huang et al., 2007). Therefore, the effects of different concentrations of naringin on the BMP and Wnt signalling pathways in hAFSCs were studied on day 21 (Figure 5). As can be seen in Figure 5A, B, two BMPrelated regulators, BMP4 and RUNX2, were upregulated in naringin groups in a dose-dependent manner in the range 1–100 μg/ml, while the expression was reduced at 200 μg/ml. In addition, the gene expression levels of two Wnt-related regulators, β-catenin and its target gene cyclin D1 were evaluated (Figure 5C, D). Both of these regulators were significantly upregulated in the presence J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al.
Figure 4. RT–PCR analysis of naringin-enhanced osteogenic differentiation of hAFSCs: (A) OPN, Collagen I and ALP gene expression; (B) OPN, Collagen I and ALP expression normalized to GAPDH; (C) OPG and RUNXL gene expression; (D) OPG and RUNXL gene expression normalized to GAPDH. N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05
of naringin in a dose-dependent manner in the range 1–100 μg/ml, while 200 μg/ml significantly inhibited their expressions. To confirm the effects of BMP and Wnt signalling, BMP-inhibitor noggin or Wnt-inhibitor DKK-1 were added to the naringin-treated hAFSC cultures. As shown in Figure 6, the ALP activities were reduced by > 33% in the presence of these inhibitors, from 1.49 ± 0.16 nM/min/mg protein for the culture without inhibitors to 0.93 ± 0.30 nM/min/mg protein for the culture treated with noggin and 0.98 ± 0.16 nM/min/mg protein for the culture treated with DKK-1 (p < 0.05).
4. Discussion The extract of Chinese herb Rhizoma drynariae has been used to treat bone fractures in Asia for thousands of years. The hypothesis of the present study is that naringin, the main effective component of Rhizoma drynariae, should promote the proliferation and osteogenesis of hAFSCs. The results from this study clearly demonstrated the enhancing effect of naringin on hAFSCs’ osteogenic differentiation regulated by the BMP and Wnt signalling pathways.
Figure 5. RT–PCR analysis of naringin-enhanced BMP and Wnt signalling of hAFSCs. (A) Gene expression of BMP pathway-related regulators BMP4 and RUNX2; (B) BMP4 and RUNX2 gene expression normalized to GAPDH; (C) gene expression of Wnt pathway-related regulators β-catenin and Cyclin D1; (D) β-catenin and Cyclin D1 gene expression normalized to GAPDH; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 Copyright © 2014 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Figure 6. Effect of Wnt inhibitor DKK-1 or BMP inhibitor noggin on ALP activity of hAFSCs treated with naringin: N0, control; N100, 100 μg/ml naringin; N100 + DKK-1, 100 μg/ml naringin plus 0.2 μg/ml DKK-1; N100 + noggin, 100 μg/ml naringin plus 1 μg/ml noggin; *p < 0.05
The addition of naringin exhibited a biphasic effect on cell proliferation and ALP activity of hAFSCs. At a concentration of 200 μg/ml, naringin suppressed the growth and moderately increased the ALP activity of hAFSCs, while at lower concentrations (1–100 μg/ml), naringin significantly enhanced cell proliferation and ALP activity in a dose-dependent manner. The process of osteogenesis can be depicted in three major stages: the osteoprogenitor stage, the preosteoblast stage and the mature osteoblast stage (Zhang et al., 2009a). In this study, it was found that osteogenesis of hAFSCs was promoted by naringin at both early and late stages. The promotion of earlier stages was evidently observed by the upregulation of ALP activity on day 7. ALP, a significant enzyme in the process of bone formation, enhances the mineralization of bone matrix by transforming the phosphoric ester into inorganic phosphorus to increase the phosphorus concentration (Jiao et al., 2009). In this study, ALP was used as an indicator of early osteogenic differentiation of hAFSCs. The enhancement of late stages of osteogenesis was demonstrated by the expression of marker genes, including OPN and Collagen I on day 21, and extracellular mineralization and calcium content during days 21–28. Therefore, naringin could enhance osteogenesis of hAFSCs at both early and late stages. It should be noted that late osteogenic markers were observed after 14 days when a cocktail of inducers, including β-glycerol phosphate, dexamethasone and ascorbic acid 2-P, was used to induce osteogenic differentiation (Mathews et al., 2012). However, in our study only a single factor, naringin, was used in order to study its effects on osteogenic differentiation, and thus the late osteogenic markers were observed at a later time point (21–28 days). Bone remodelling includes two processes, bone formation and bone resorption. Osteoblasts are responsible to secrete new bone (bone formation), and osteoclasts deal with breaking bone down (bone resorption). An imbalance in the regulation of bone formation and bone resorption results in many bone diseases, such as Copyright © 2014 John Wiley & Sons, Ltd.
osteoporosis (Hadjidakis and Androulakis, 2006). OPG is a decoy receptor binding to RANKL (receptor activator of nuclear factor- B ligand), whose expression is critical for the maturation and activity of osteoclasts (Boyce and Xing, 2008). Therefore, OPG expression in osteoblasts inhibits osteoclast differentiation. The OPG:RANKL ratio is a good indicator in the regulation of osteogenesis and osteoclastogenesis. An increase in the OPG:RANKL ratio favours bone formation, while a decrease in the ratio favours bone resorption. Our study showed that naringin significantly increased the OPG expression with minimal RANKL expression during osteogenic differentiation of hAFSCs, indicating the inhibition effect of naringintreated cells on osteoclastogenesis. Thus, naringin may be used to enhance osteogenic differentiation of hAFSCs and other MSCs to heal bone-resorbing diseases, such as osteoporosis and bone-erosive rheumatoid arthritis. Osteogenesis is a complicated process involving several signalling pathways, including the BMP and canonical Wnt pathways (Huang et al., 2007; Peng et al., 2003; Zhang et al., 2010). The upregulation of mRNA expression of BMP-related regulators (BMP4 and RUNX2) and Wnt-related regulators (β-catenin and Cyclin D1) was observed in our study. In addition, in the presence of noggin, the inhibitor for the BMP signal pathway, or DKK-1, the inhibitor for Wnt–β-catenin signalling, ALP activity was remarkably reduced (Figure 6). Hence, our results suggested the involvement of both BMP and Wnt signalling pathways in the hAFSC osteogenic process after naringin treatment (Figure 7). BMPs are
Figure 7. Schematic illustration of BMP and Wnt signalling pathways in naringin-enhanced osteogenic differentiation of hAFSCs. BMP induces RUNX2 expression, which regulates the expression of other factors that act during terminal osteogenic differentiation. Wnt signalling contributes to osteoblast differentiation through β-catenin activation, which is responsible for the differentiation of mature osteoblasts and bone formation. Cyclin D1 is a target gene of the Wnt pathway, which is upregulated when Wnt–β-catenin signalling is activated J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al.
responsible for maintaining the skeleton and facilitate the recruitment of osteoblast precursors to a certain location during embryonic development (Ryoo et al., 2006). They are essential to inducing ectopic bone formation, especially for the osteogenic differentiation of non-bone cells (Bandyopadhyay et al., 2013). It has been reported that BMPs promote osteoblastic differentiation by upregulating the expression of structural bone proteins, such as Collagen I, and enhancing the mineralization of bone matrix (Rawadi et al., 2003). RUNX2 is an important downstream regulator of the BMP pathway (Lian et al., 2006; Ryoo et al., 2006). It is considered as the master osteogenic transcription factor in the osteoblast maturation process and plays an essential role in the gene expression of osteoblast markers (Komori, 2011). It was reported that BMP induced the expression of RUNX2, which regulates other factors that act during terminal osteogenic differentiation and bone-specific extracellular matrix secretion (Lee et al., 2003; Nishio et al., 2006; Ryoo et al., 2006). In our study, the BMP-related regulators RUNX2 and BMP4 were found to be closely associated with the enhancing effect of naringin, suggesting the involvement of the BMP signalling pathway in the naringin-promoted osteogenic process of hAFSCs. Wnt–β-catenin signalling is another critical pathway for osteogenic differentiation and bone formation (Day et al., 2005; Huang et al., 2007). Wnts participate in embryonic skeletal patterning, fetal skeletal development and adult skeletal remodelling (Huang et al., 2007). Activation of canonical Wnt signalling resulted in higher bone density (Babij et al., 2003; Boyden et al., 2002) and higher expression of alkaline phosphatase (Bain et al., 2003; Rawadi et al., 2003). Previous studies have shown that Wnt signalling contributed to osteoblast differentiation through the activation of β-catenin (Bain et al., 2003; Rossini et al., 2013; Westendorf et al., 2004). β-catenin activity is significant for the differentiation of mature osteoblasts and bone formation (Day et al., 2005; Hu et al., 2005). Cyclin D1 is a target gene of the Wnt pathway, which was upregulated when Wnt–β-catenin signalling was activated (Shtutman et al., 1999). In this study, the mRNA expressions of β-catenin and Cyclin D1 were enhanced in the presence of naringin, suggesting that Wnt–β-catenin signalling was involved in the naringin-enhanced osteogenesis of hAFSCs. RUNX2 was reported to integrate Wnt signalling for mediating the process of osteoblast differentiation (Gaur et al., 2005; Hamidouche et al., 2008) and it was also involved in BMP signalling, as discussed above. Therefore, RUNX2 behaves as cross-talking regulator between the BMP and Wnt–β-catenin signalling pathways. Most osteoprotective medicines have some adverse effects. For instance, increased risk of cancer (Krieger et al., 2005) and cardiovascular diseases (Teede, 2003) were reported to be associated with hormone replacement therapy. It has also been reported that anti-resorptive bisphosphonate might result in upper gastrointestinal tract complications (Marshall, 2002) as well as long-range effects on the skeleton, especially in regard to bone Copyright © 2014 John Wiley & Sons, Ltd.
turnover and strength (Arum, 2008). The present study showed that 1–100 μg/ml naringin had no cytotoxicity to hAFSCs, indicated by the enhanced cell proliferation, which diminished at 200 μg/ml. Dose-dependent cytotoxicity effects of Chinese herbal medicines on embryonic stem and cancer cells have also been observed in our recent studies (Li et al., 2013a, 2013b). Because naringin is a natural compound present in Rhizoma drynariae and grapefruit, and has been widely used as a nutrient supplement, naringin itself could be used as an osteoprotecitve medicine as well as an enhancer for osteogenic differentiation of hAFSCs.
5. Conclusions Osteoporosis can lead to fractures and deformities and is a crucial public health problem. Osteogenic cells differentiated from hAFSCs could be used to augment bone formation and consequently in the treatment of osteoporosis and other bone-related diseases. The Chinese herb Rhizoma drynariae, which is safe and cheap, has been used for fracture and bone healing for thousands of years. The present study demonstrated that naringin, the main effective component of Rhizoma drynariae, could promote proliferation and osteogenesis and concurrently inhibit osteoclastogenesis of hAFSCs. Moreover, the results also suggested that naringin may promote the osteogenic differentiation of hAFSCs through both BMP and Wnt–βcatenin signal transduction pathways. Due to its therapeutic efficiency, economic and safety advantages, naringinenhanced osteogenesis of hAFSCs would be an attractive treatment strategy to augment bone formation in patients with osteoporosis and other bone disorders.
Conflict of interest The authors have declared that there is no conflict of interest.
Ethics statement The hAFSCs used in this study were obtained from Dr Anthony Atala and Dr James Yoo of the Wake Forest Institute for Regenerative Medicine (Winston-Salem, NC, USA) and their use in this study caused no ethical issues or concerns. No approval for their use in the research by any institutional or national ethical committee was required.
Acknowledgements This study was supported in part by Alumni Grants for Graduate Research and Scholarship (AGGRS) of Ohio State University. We would like to acknowledge Dr Anthony Atala and Dr James Yoo of the Wake Forest Institute for Regenerative Medicine (Winston-Salem, NC) for kindly providing hAFSCs used in this study. We also would like to acknowledge Dr Sebastien Sart for assistance in ImageJ analysis. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
References AAOS. 2008; Burden of Musculoskeletal Diseases in the United States: Prevalence, Societal and Economic Cost. American Academy of Orthopaedic Surgeons: Rosemont, IL, USA. Arum SM. 2008; New developments surrounding the safety of bisphosphonates. Curr Opin Endocrinol Diabetes Obes 15: 508–513. Babij P, Zhao WG, Small C et al. 2003; High bone mass in mice expressing a mutant LRP5 gene. J Bone Miner Res 18: 960–974. Bain G, Muller T, Wang X et al. 2003; Activated β-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP2-mediated signal transduction. Biochem Biophys Res Commun 301: 84–81. Bandyopadhyay A, Yadav PS, Prashar P. 2013; BMP signaling in development and diseases: a pharmacological perspective. Biochem Pharmacol 85: 857–j864. Boyce BF, Xing LP. 2008; Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys 473: 139–146. Boyden LM, Mao JH, Belsky J et al. 2002; High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 346: 1513–1521. Chen KY, Lin KC, Chen YS et al. 2013; A novel porous gelatin composite containing naringin for bone repair. Evid Based Compl Alternat Med 28394: 1. Day TF, Guo X, Garrett-Beal L et al. 2005; Wnt/β-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell 8: 739–750. De Coppi P, Bartsch G Jr, Siddiqui MM et al. 2007; Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol 25: 100–106. Egermann M, Goldhahn J, Schneider E. 2005; Animal models for fracture treatment in osteoporosis. Osteoporos Int 16: S129–138. Gaur T, Lengner CJ, Hovhannisyan H et al. 2005; Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 280: 33132–33140. Guan X, Delo DM, Atala A et al. 2011; In vitro cardiomyogenic potential of human amniotic fluid stem cells. J Tissue Eng Regen Med 5: 220–228. Hadjidakis DJ, Androulakis II. 2006; Bone remodeling. Ann NY Acad Sci 1092: 385–396. Hamidouche Z, Hay E, Vaudin P et al. 2008; FHL2 mediates dexamethasone-induced mesenchymal cell differentiation into osteoblasts by activating Wnt/β-catenin signaling-dependent Runx2 expression. FASEB J 22: 3813–3822. Hu H, Hilton MJ, Tu X et al. 2005; Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 132: 49–50. Huang W, Yang S, Shao J et al. 2007; Signaling and transcriptional regulation in osteoblast commitment and differentiation. Front Biosci 12: 3068–3092. Jeong JC, Lee JW, Yoon CH et al. 2005; Stimulative effects of Rhizoma drynariae extracts on the proliferation and differentiation of osteoblastic MC3T3-E1 cells. J Ethnopharmacol 96: 489–495. Copyright © 2014 John Wiley & Sons, Ltd.
Jiao L, Cao DP, Qin LP et al. 2009; Antiosteoporotic activity of phenolic compounds from Curculigo orchioides. Phytomedicine 16: 874–881. Komori T. 2011; Signaling networks in RUNX2-dependent bone development. J Cell Biochem 112: 750–755. Krieger N, Lowy I, Aronowitz R et al. 2005; Hormone replacement therapy, cancer, controversies, and women’s health: historical, epidemiological, biological, clinical, and advocacy perspectives. J Epidemiol Commun Health 59: 740–748. Lee MH, Kim YJ, Kim HJ et al. 2003; BMP-2induced Runx2 expression is mediated by Dlx5, and TGFβ1 opposes the BMP-2induced osteoblast differentiation by suppression of Dlx5 expression. J Biol Chem 278: 34387–34394. Li D, Isherwood S, Motz A et al. 2013a; Cellbased screening of traditional Chinese medicines for proliferation enhancers of mouse embryonic stem cells. Biotechnol Prog 29: 738–744. Li D, Zang R, Yang ST et al. 2013b; Cell-based high-throughput proliferation and cytotoxicity assays for screening traditional Chinese herbal medicines. Proc Biochem 48: 517–524. Li N, Jiang Y, Wooley PH et al. 2013c; Naringin promotes osteoblast differentiation and effectively reverses ovariectomy-associated osteoporosis. J Orthop Sci 18: 478–485. Lian JB, Stein GS, Javed A et al. 2006; Networks and hubs for the transcriptional control of osteoblastogenesis. Rev Endocr Metab Disord 7: 1–6. Licata AA. 2005; Discovery, clinical development, and therapeutic uses of bisphosphonates. Ann Pharmacother 39: 668–677. Liu M, Li Y, Yang ST. 2014a; Curculigoside improves osteogenesis of human amniotic fluid derived stem cells. Stem Cells Dev 23: 146–154. Liu M, Li Y, Yang ST. 2014b; Expansion of human amniotic fluid stem cells in threedimensional fibrous scaffolds in stirred bioreactors. Biochem Eng J 82: 71–80. Liu Y, Wu J, Zhu Y et al. 2014c; Therapeutic application of mesenchymal stem cells in bone and joint diseases. Clin Exp Med 14: 13–14. Ma X, Zhang S, Zhou J et al. 2012; Clone-derived human AF-amniotic fluid stem cells are capable of skeletal myogenic differentiation in vitro and in vivo. J Tissue Eng Regen Med 6: 598–513. Mathews S, Bhonde R, Gupta PK et al. 2012; Extracellular matrix protein mediated regulation of the osteoblast differentiation of bone marrow derived human mesenchymal stem cells. Differentiation 84: 185–192. Marshall JK. 2002; The gastrointestinal tolerability and safety of oral bisphosphonates. Expert Opin Drug Safety 1: 71–78. NIH. 2000; Osteoporosis prevention, diagnosis, and therapy. NIH Consens Statement Online 17: 1–6. Nishio Y, Dong YF, Paris M et al. 2006; Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene 372: 62–70. Orsini LS, Rousculp MD, Long SR et al. 2005; Health care utilization and expenditures in the United States: a study of osteoporosisrelated fractures. Osteoporos Int 16: 359–371. Pang WY, Wang XL, Mok SK et al. 2010; Naringin improves bone properties in
ovariectomized mice and exerts oestrogenlike activities in rat osteoblast-like (UMR106) cells. Br J Pharmacol 159: 1693–1703. Peng Y, Kang Q, Cheng H et al. 2003; Transcriptional characterization of bone morphogenetic proteins (BMPs)-mediated osteogenic signaling. J Cell Biochem 90: 1149–1165. Rawadi G, Vayssiere B, Dunn F et al. 2003; BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res 18: 1842–1853. Reginster JY, Burlet N. 2006; Osteoporosis: a still increasing prevalence. Bone 38: 4. Rodrigues MT, Lee SJ, Gomes ME et al. 2012; Amniotic fluid-derived stem cells as a cell source for bone tissue engineering. Tissue Eng A 18: 2518–2527. Rossini M, Gatti D, Adami S. 2013; Involvement of WNT/β-catenin signaling in the treatment of osteoporosis. Calcif Tissue Int 93: 121–132. Rotella DP. 2002; Osteoporosis: challenges and new opportunities for therapy. Curr Opin Drug Discov Dev 5: 477–486. Roubelakis MG, Pappa KI, Bitsika V et al. 2007; Molecular and proteomic characterization of human mesenchymal stem cells derived from amniotic fluid: comparison to bone marrow mesenchymal stem cells. Stem Cells Dev 16: 931–952. Ryoo HM, Lee MH, Kim YJ. 2006; Critical molecular switches involved in BMP-2induced osteogenic differentiation of mesenchymal cells. Gene 366: 51–57. Shtutman M, Zhurinsky J, Simcha I et al. 1999; The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A 96: 5522–5527. Teede HJ. 2003; Hormone replacement therapy, cardiovascular and cerebrovascular disease. Best Pract Res Clin Endoc Metab 17: 73–80. Trohatou O, Anagnou NP, Roubelakis MG. 2013; Human amniotic fluid stem cells as an attractive tool for clinical applications. Curr Stem Cell Res Ther 8: 125–132. Westendorf JJ, Kahler RA, Schroeder TM. 2004; Wnt signaling in osteoblasts and bone diseases. Gene 341: 19–29. Wong R, Rabie B, Bendeus M et al. 2007; The effects of Rhizoma curculiginis and Rhizoma drynariae extracts on bones. Chin Med 2: 13. Yeh YC, Wei HJ, Lee WY et al. 2010; Cellular cardiomyoplasty with human amniotic fluid stem cells: in vitro and in vivo studies. Tissue Eng A 16: 1925–1936. Zhai YK, Niu YB, Pan YL et al. 2013; Effects of naringin on proliferation, differentiation and maturation of rat calvarial osteoblasts in vitro. Zhongguo Zhong Yao Za Zhi 38: 105–111. Zhang JF, Li G, Chan CY et al. 2010; Flavonoids of Herba epimedii regulate osteogenesis of human mesenchymal stem cells through BMP and Wnt/β-catenin signaling pathway. Mol Cell Endocrinol 314: 70–74. Zhang JF, Li G, Meng CL et al. 2009a. Total flavonoids of Herba epimedii improves osteogenesis and inhibits osteoclastogenesis of human mesenchymal stem cells. Phytomedicine 16: 521–529. Zhang P, Dai KR, Yan SG et al. 2009b; Effects of naringin on the proliferation and osteogenic differentiation of human bone mesenchymal stem cell. Eur J Pharmacol 607: 1. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
ARTICLE
Effects of naringin on the proliferation and osteogenic differentiation of human amniotic fluid-derived stem cells Meimei Liu1, Yan Li2* and Shang-Tian Yang1* 1 2
William G. Lowrie Department of Chemical and Biomolecular Engineering, Ohio State University, Columbus, OH, USA Department of Chemical and Biomedical Engineering, FAMU-FSU College of Engineering, Florida State University, Tallahassee, FL, USA
Abstract Human amniotic fluid-derived stem cells (hAFSCs) are a novel cell source for generating osteogenic cells to treat bone diseases. Effective induction of osteogenic differentiation from hAFSCs is critical to fulfil their therapeutic potential. In this study, naringin, the main active compound of Rhizoma drynariae (a Chinese herbal medicine), was used to stimulate the proliferation and osteogenic differentiation of hAFSCs. The results showed that naringin enhanced the proliferation and alkaline phosphatase activity (ALP) of hAFSCs in a dose-dependent manner in the range 1–100 μg/ml, while an inhibition effect was observed at 200 μg/ml. Consistently, the calcium content also increased with naringin concentration up to 100 μg/ml. The enhanced osteogenic differentiation of hAFSCs by naringin was further confirmed by the dose-dependent upregulation of marker genes, including osteopontin (OPN) and Collagen I from RT–PCR analysis. The increased osteoprotegerin (OPG) expression and minimal expression of receptor activator of nuclear factor-κB ligand (RANKL) suggested that naringin also inhibited osteoclastogenesis of hAFSCs. In addition, the gene expressions of bone morphogenetic protein 4 (BMP4), runt-related transcription factor 2 (RUNX2), β-catenin and Cyclin D1 also increased significantly, indicating that naringin promotes the osteogenesis of hAFSCs via the BMP and Wnt–β-catenin signalling pathways. These results suggested that naringin can be used to upregulate the osteogenic differentiation of hAFSCs, which could provide an attractive and promising treatment for bone disorders. Copyright © 2014 John Wiley & Sons, Ltd. Received 12 July 2013; Revised 21 March 2014; Accepted 20 April 2014
Keywords amniotic fluid-derived stem cell; naringin; osteogenic differentiation; proliferation; mesenchymal stem cells; signalling pathways
1. Introduction Bone diseases, especially osteoporosis, bring serious issues to public health. Osteoporosis is characterized by low bone mineral density and microarchitecture deterioration, resulting in structural instability of bone tissue and a high *Correspondence to: Shang-Tian Yang, William G. Lowrie Department of Chemical and Biomolecular Engineering, Ohio State University, 140 West 19th Avenue, Columbus, OH 43210, USA. E-mail: [email protected] Yan Li, Department of Chemical and Biomedical Engineering, FAMU-FSU College of Engineering, Florida State University, 2525 Pottsdamer St., Tallahassee, Florida 32310USA. E-mail: [email protected] Copyright © 2014 John Wiley & Sons, Ltd.
fracture risk. Oestrogen withdrawal is the most wellrecognized cause of osteoporosis (NIH, 2000), which happens more commonly in the senior society and results in excess morbidity, mortality and decreased quality of life. More than 200 million people in the world and 44 million in the USA suffer from osteoporosis (Reginster and Burlet, 2006), and more than 1.5 million fractures associated with osteoporosis occur each year in America (Orsini et al., 2005). National costs on the medical care expenses related to bone fractures were more than $17 billion in 2005, and a cumulative cost of $474 billion is estimated for the next two decades (AAOS, 2008). Oestrogen replacement therapy (ERT) has been considered to be the most effective treatment for osteoporosis in the past 10 years. However, long-term use of oestrogen could increase the risk of breast
M. Liu et al.
cancer, endometrial carcinoma and cardiovascular diseases (Jiao et al., 2009; NIH, 2000). Bisphosphonate therapy is another method developed in the last decade. Nevertheless, it only inhibits the resorption of osteoclasts and can cause acute incapacitating bone, joint and muscle pain (Licata, 2005; Rotella, 2002). Amniotic fluid-derived stem cells (AFSCs) are a novel cell source for tissue engineering and regenerative medicine because they have high potential to differentiate into osteoblasts, chondrocytes and adipocytes, as well as the cell types in other germ layers (De Coppi et al., 2007; Guan et al., 2011; Ma et al., 2012). AFSCs possess the phenotype of mesenchymal stem cells (MSCs) but express both embryonic and adult stem cell markers (Yeh et al., 2010). MSCs have promising capacities to heal bone fractures and thus have attracted much attention in treating bone diseases (Egermann et al., 2005). Animal studies showed that MSCs could possibly be involved in bone formation through intravenous infusion to target bones (Liu et al., 2014c). Compared to bone marrowderived MSCs, AFSCs have higher self-renewal capacity and are more potent for lineage-specific differentiation (De Coppi et al., 2007; Liu et al., 2014b Trohatou et al., 2013). Compared to pluripotent stem cells, AFSCs are not tumourigenic and present no ethical concerns for clinical use. Therefore, AFSCs are superior candidates for cell-based therapies, especially for the treatment of bone disorders. Rhizoma drynariae is a traditional Chinese herbal medicine, which has been commonly used to treat orthopaedic disorders and bone healing for thousands of years (Wong et al., 2007). Modern pharmacological study indicates that naringin, a polymethoxylated flavonoid, is the main active compound of Rhizoma drynariae. Naringin has been found to enhance the alkaline phosphatase level of osteoblastic MC3T3-E1 cells (Jeong et al., 2005) and the differentiation and maturation of rat calvarial osteoblasts (Zhai et al., 2013). A recent study showed that gelatin composite containing naringin enhanced the osteoclast activity of mixed bone cells (Chen et al., 2013). In vivo, naringin has been found to protect against ovariectomyinduced bone loss in mice, which might be mediated through ligand-dependent activation of oestrogen receptors in osteoblastic cells (Pang et al., 2010). In a rat osteoporosis model, naringin was found to reverse ovariectomy-induced bone loss by increasing bone mineral density, bone volume and trabecular thickness (Li et al., 2013c). Because of the positive effects of naringin on treating bone tissues and cells, naringin has been used recently to stimulate the proliferation and osteogenic differentiation of bone marrow-derived MSCs (Li et al., 2013c; Zhang et al., 2009b). However, its effects on the underlying signal transduction pathways have not been investigated. Since AFSCs are superior candidates for cell-based therapies and may provide a better cell source for osteogenic differentiation (De Coppi et al., 2007; Rodrigues et al., 2012; Roubelakis et al., 2007), the potential of using naringin to regulate and enhance human AFSC osteogenic differentiation was investigated in this study. For the first time, the role of naringin in regulating the signalling Copyright © 2014 John Wiley & Sons, Ltd.
pathways involved in the osteogenic differentiation of AFSCs was also elucidated and is reported in this paper.
2. Materials and methods 2.1. Culture of human amniotic fluid-derived stem cells (hAFSCs) Human AFSCs were kindly provided by Dr Anthony Atala and Dr James Yoo at Wake Forest Institute. The cells were isolated and cultured as previously described (De Coppi et al., 2007). All culture reagents were purchased from Life Technologies unless otherwise noted. The cells were cultured in growth medium, which contained α-minimum essential medium (α-MEM) supplemented with 15% embryonic stem cell qualified-fetal bovine serum (ES-FBS), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 18% Chang B and 2% Chang C (Irvine Scientific, Santa Ana, CA, USA). The hAFSCs were maintained at 37°C in a humidified 5% CO2 incubator and subcultured at 70% confluence. The culture medium was changed every 3 days. Cells at passages 16–18 were used in this study.
2.2. hAFSC treatment with naringin Naringin (≥90% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The hAFSCs (1 × 104 cells/ml) were seeded in 48-, 24- and six-well plates and cultured in growth medium until 70–80% confluence. Then, the cells were cultured in differentiation medium, which contained α-MEM, 17% FBS (Atlanta Biologicals, Atlanta, GA, USA), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. Various amounts of naringin were added in the differentiation medium to final concentrations of 1, 10, 100 and 200 μg/ml, respectively (Zhang et al., 2009b). Cells cultured in medium without naringin were used as negative control. Media were changed every 3 days. The cells were evaluated for proliferation (1–4 days) and alkaline phosphatase (ALP) activity as an early marker (day 7). Calcium deposition (day 21), osteogenic gene expression (day 21) and alizarin red S staining (days 21 and 28) were evaluated for late stages of osteogenic differentiation. For each assay, the time window was chosen based on the stage of the markers. To test the effects of Wnt signalling and bone morphogenetic protein (BMP) signalling, 0.2 μg/ml Wnt-inhibitor DKK-1 (Peprotech, Rocky Hill, NJ, USA) or 1 μg/ml BMP-inhibitor noggin (Sigma-Aldrich) was added to the hAFSCs treated with 100 μg/ml naringin. After 7 days of culture, the cells were analysed for ALP activity, an early marker of osteogenesis.
2.3. Cell proliferation analysis The hAFSCs (5 × 103 per well) were seeded in a 48-well plate. After 24 h of incubation, the growth medium was changed into naringin-containing media at a concentration of 0 (Control), 1, 10, 100, and 200 μg/ml accordingly. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Cells were incubated at 37°C in a humidified 5% CO2 incubator for 1, 2, 3 or 4 days. After that, the medium was replaced with 500 μl of 10% Alamar Blue (AbD Serotec, Raleigh, NC) solution at 37°C for 3 h. The fluorescence of the medium was then monitored in triplicate at 535 nm excitation wavelength and 590 nm emission wavelength using a GENios Pro plate reader (Tecan, Research Triangle Park, NC). A standard calibration curve was established between the fluorescence intensity and the cell numbers counted by hemacytometer. Cell proliferation was indicated by the fold increase of the measured fluorescence intensity compared to the intensity of starting cells.
2.4. Alkaline phosphatase activity assay Osteogenesis of hAFSCs was induced in differentiation medium containing naringin. At day 7, the cells were washed twice with PBS and lysed with lysis buffer, consisting of 20 mM Tris–HCl, pH 7.5, 150 mM NaCl and 1% Triton X-100, for 5 min. The chromogenic substrate for ALP was p-nitrophenyl phosphate (pNPP; SigmaAldrich). 50 μl lysed sample was mixed with 50 μl pNPP (1 mg/ml) substrate solution containing 1.0 mg/ml pNPP, 0.2 M Tris buffer and 5 mM MgCl2 at 37°C for 15 min on a Belly Button Shaker (MidSci, St. Louis, MO, USA). The reaction was stopped by adding 25 μl 3 N NaOH. Absorbance of p-nitrophenol released in the samples was measured at 405 nm, using a SpectraMAX 250 microplate reader (Molecular Devices, Sunnyvale, CA, USA). The protein concentration of cell lysate was determined using the Bradford assay at 595 nm on a microplate spectrophotometer (Bio-Rad, USA). The ALP activity was normalized according to the total protein content of cell lysate and expressed as nM (p-nitrophenyl)/min/mg protein.
2.5. Alizarin red S (ARS) staining ARS staining was performed to evaluate the calcium deposition in cells of the osteogenic lineage obtained from hAFSCs. The cells were evaluated after 21 and 28 days; however, little positive staining was observed for cells at 21 days. Briefly, cells cultured in a 24-well plate for 21–28 days were rinsed twice with PBS, fixed with 10% v/v formalin and then stained with 1% w/v ARS solution. Orange red staining indicated the location and intensity of the calcium deposition. The presence of calcium was observed using a light microscope Olympus IX71 (Olympus Corporation, Tokyo, Japan).
2.6. Calcium assay To quantify mineralization, the calcium deposition in hAFSCs after 21 days was measured using Calcium Assay (Genzyme Diagnostics, Charlottetown, PE, Canada). Samples were added with 1 M acetic acid and placed on a vortex overnight at 4°C to extract the calcium from the mineralized matrix. In a 96-well clear polycarbonate Copyright © 2014 John Wiley & Sons, Ltd.
plate, 15 μl cell extract was mixed with 150 μl Calcium Assay reagent and incubated for 30 s at room temperature. The absorbance at 650 nm was determined using a SpectraMAX 250 microplate reader. The samples were measured in triplicate and compared to the calcium calibration curve. The calcium deposition was normalized by cell number and expressed as mM/cell.
2.7. Reverse transcriptase–polymerase chain reaction (RT–PCR) Total RNA was isolated from hAFSCs treated with different concentrations of naringin, using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). RNA concentrations were measured using a ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). After that, 1 μg RNA was initially reverse-transcribed into cDNA using the SuperScript™ III First-Strand Synthesis System (Invitrogen). Then 200 ng of the cDNA was used as a template for the amplification of the target genes, using the Quick-Load® Taq 2× Master Mix Kit (BioLabs, Ipswich, MA, USA). The primer sequences of the analysed genes and PCR conditions are listed in Table 1. For osteogenic differentiation, the genes osteopontin (OPN), collagen I and ALP were measured. For the bone morphogenetic protein (BMP) pathway, the genes runt-related transcription factor 2 (RUNX2) and BMP4 were measured. For the Wnt pathway, β-catenin and Cyclin D1 were analysed. For osteoclast differentiation, osteoprotegerin (OPG) and receptor activator of nuclear factor-κB ligand (RANKL) were measured. The housekeeping gene, glyceraldehyde3-phosphate dehydrogenase (GAPDH), was used as an endogenous reference gene. Amplified products were fractionated in a 2% agarose (Fisher-Scientific, Pittsburgh, PA, USA) gel at 70 V for 80 min and visualized and photographed using a Gel Doc 2000 Gel Documentation System (Bio-Rad, Hercules, CA, USA). The expression level of each gene was analysed using ImageJ Software and normalized to GAPDH expression.
2.8. Statistical analysis Unless otherwise noted, all experiments and samples were triplicated. Experimental results are presented as mean ± standard deviation (SD) (n = 3) and analysed using one-way ANOVA, followed by paired Tukey–Kramer analysis using JMP 7.0 (SAS Institute Inc., Cary, NC, USA), with p < 0.05 considered as significant.
3. Results 3.1. Effect of naringin on the proliferation of hAFSCs The stimulation effect of naringin on the proliferation of hAFSCs during 4 days of culture was evaluated at various J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al. Table 1. Primers used in the RT-PCR for osteogenic differentiation of hAFSCs Gene RUNX2 OPN Collagen I ALP Cyclin D1 β-Catenin BMP4 OPG RANKL GAPDH
Forward primer*
Reverse primer*
Tm (ºC)**
AGTGGACGAGGCAAGAGTTTC GAGACCCTTCCAAGTAAGTCCA ACAGCCGCTTCACCTACAGC CCCAAAGGCTTCTTCTTG CCCTCGGTGTCCTACTTCA TGGCAACCAAGAAAGCAAG CGAATGCTGATGGTCGTTT TGCTGTTCCTACAAAGTTTACG CCAGCATCAAAATCCCAAGT GTGGTCTCCTCTGACTTCAACA
CCTTCTGGGTTCCCGAGGT GATGTCCTCGTCTGTAGCATCA TGCACTTTTGGTTTTTGGTCAT CTGGTAGTTGTTGTGAGC GTTTGTTCTCCTCCGCCTCT CTGAACAAGAGTCCCAAGGAG CAGGGATGCTGCTGAGGTTA CTTTGAGTGCTTTAGTGCGTG CCCCAAAGTATGTTGCATCCTG CTCTTCCTCTTGTGCTCTTGCT
62 62 52 Touch down 55 55 Touch down 52 Touch down 62
*Sequences are depicted in the 5′–3′ direction. **Tm is the annealing temperature at which the primer binds to the RNA template during polymerase chain reaction. Touch down, Tm 62–52°C, decrease 0.5°C/cycle and the following cycles were run at 52°C. All the genes used 35 cycles. Osteogenic genes, osteopontin (OPN), collagen I and alkaline phosphatase (ALP). Genes in bone morphogenetic protein (BMP) pathway, runt-related transcription factor 2 (RUNX2) and BMP4. Genes in Wnt pathway, β-catenin and Cyclin D1. Genes in osteoclast differentiation, osteoprotegerin (OPG) and receptor activator of nuclear factor-κB ligand (RANKL). Housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
concentrations (1–200 μg/ml) (Figure 1). In the presence of naringin, the proliferation fold of hAFSCs increased in a dose-dependent manner in the range 1–100 μg/ml. For example, on day 3, naringin increased the proliferation from 18.8 ± 1.0-fold in the control to 19.6 ± 0.4-, 22.8 ± 0.6- (p < 0.05) and 25.5 ± 0.6-fold (p < 0.05) at 1, 10 and 100 μg/ml, respectively. The use of 100 μg/ml naringin, the most effective concentration, increased the proliferation by 27.7 ± 5.8%, 31.7 ± 10.0%, 35.4 ± 3.1% and 19.4 ± 2.5% compared to the control on days 1, 2, 3 and 4, respectively. However, 200 μg/ml naringin slightly inhibited the proliferation of hAFSCs by 2–5% compared to control, indicating that a high concentration (≥200 μg/ml) of naringin may be harmful to cell growth. Thus, naringin within the range 0–100 μg/ml had no cytotoxic effect and stimulated the proliferation of hAFSCs.
3.2. Effect of naringin on ALP activity of hAFSCs ALP activity was used to indicate the early osteogenic differentiation of hAFSCs. Naringin was shown to increase the ALP activity of hAFSCs in a dose-dependent manner
Figure 1. Effect of naringin on the proliferation of hAFSCs: N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 Copyright © 2014 John Wiley & Sons, Ltd.
in the range 1–100 μg/ml after 7 days of culture (Figure 2). Compared to the control, ALP activity increased 44 ± 17%, 57 ± 13% and 163 ± 40% in the presence of 1 μg/ml, 10 μg/ml and 100 μg/ml naringin, respectively (p < 0.05 for all three concentrations). The ALP activity of hAFSCs treated with 200 μg/ml naringin also increased 74 ± 14%, but was lower than that treated with 100 μg/ml naringin (p < 0.05).
3.3. Effect of naringin on calcium deposition The ARS staining after 28 days of naringin treatment was performed to detect the presence of calcium. In the presence of naringin, more calcium deposition was observed compared to the control group (Figure 3A). At the concentration of 1–100 μg/ml naringin, calcium deposition increased in a dose-dependent manner, while cells treated with 200 μg/ml naringin (N200) produced less calcium than the 100 μg/ml naringin group (N100). The osteogenic differentiation of the cells was further investigated by quantifying the calcium content (Figure 3B).
Figure 2. ALP activity of hAFSCs after naringin treatment; percentage increase was calculated as (N1 – N0)/N0; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Figure 3. Osteogenic differentiation of hAFSCs after naringin treatment: (A) alizarin red S (ARS) staining of hAFSCs after naringin treatment; (B) calcium deposition of naringin-treated hAFSCs. The percentage increase was calculated as (Ni – N0)/N0; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05
Consistently, naringin increased calcium deposition in a dose-dependent manner, especially at concentrations of 10–100 μg/ml. Compared to the control group, the calcium content increased 31 ± 25%, 44 ± 21% (p < 0.05) and 239 ± 67% (p < 0.05) in the presence of 1, 10 and 100 μg/ml naringin, respectively. The calcium content in the N200 group was much lower than that of the N100 group and only increased 15 ± 24% compared to control. Hence, both calcium quantification and ARS staining results confirmed that naringin promoted calcium deposition in hAFSCs.
3.4. Effect of naringin on the expression of osteogenic markers The RT–PCR results for osteogenic differentiation of hAFSCs showed that the osteogenic marker genes, including OPN and Collagen I, were significantly upregulated with naringin treatment compared to the control group at day 21 (Figure 4A, B). The gene expression of ALP was lower than that of OPN and Collagen I for the N1, N10 and N100 groups, probably because ALP is an early marker of osteogenic differentiation. In general, naringin increased the expression of osteogenic differentiation markers in a dose-dependent manner at concentrations of 1–100 μg/ml, while at 200 μg/ml the expression levels were reduced.
3.5. Effect of naringin on the expression of inhibition markers of osteoclastogenesis The gene expression of OPG was also markedly increased by naringin in a dose-dependent manner at concentrations Copyright © 2014 John Wiley & Sons, Ltd.
of 1–100 μg/ml (Figure 4C, D). Meanwhile, little expression of RANKL was observed in the presence of naringin. It should be noted that RANKL expression was observed in the presence of curculigoside, an active component in another Chinese herbal medicine in our study (Liu et al., 2014a). Hence, the minimal RANKL expression was not due to the detection method. The ratio between mRNA expressions of OPG to RANKL (OPG:RANKL) is usually used as an indicator of osteoclastogenesis inhibition. The dose-dependent expression of OPG and minimal expression of RANKL indicated that naringin promoted the expression of inhibiting factors for osteoclastogenesis by increasing the relative portion of OPG, thus enhancing the osteogenic differentiation of hAFSCs.
3.6. Effects of naringin on BMP and Wnt–βcatenin pathways The BMP and Wnt signalling pathways have been reported to be involved in the osteogenic differentiation of MSCs (Huang et al., 2007). Therefore, the effects of different concentrations of naringin on the BMP and Wnt signalling pathways in hAFSCs were studied on day 21 (Figure 5). As can be seen in Figure 5A, B, two BMPrelated regulators, BMP4 and RUNX2, were upregulated in naringin groups in a dose-dependent manner in the range 1–100 μg/ml, while the expression was reduced at 200 μg/ml. In addition, the gene expression levels of two Wnt-related regulators, β-catenin and its target gene cyclin D1 were evaluated (Figure 5C, D). Both of these regulators were significantly upregulated in the presence J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al.
Figure 4. RT–PCR analysis of naringin-enhanced osteogenic differentiation of hAFSCs: (A) OPN, Collagen I and ALP gene expression; (B) OPN, Collagen I and ALP expression normalized to GAPDH; (C) OPG and RUNXL gene expression; (D) OPG and RUNXL gene expression normalized to GAPDH. N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05
of naringin in a dose-dependent manner in the range 1–100 μg/ml, while 200 μg/ml significantly inhibited their expressions. To confirm the effects of BMP and Wnt signalling, BMP-inhibitor noggin or Wnt-inhibitor DKK-1 were added to the naringin-treated hAFSC cultures. As shown in Figure 6, the ALP activities were reduced by > 33% in the presence of these inhibitors, from 1.49 ± 0.16 nM/min/mg protein for the culture without inhibitors to 0.93 ± 0.30 nM/min/mg protein for the culture treated with noggin and 0.98 ± 0.16 nM/min/mg protein for the culture treated with DKK-1 (p < 0.05).
4. Discussion The extract of Chinese herb Rhizoma drynariae has been used to treat bone fractures in Asia for thousands of years. The hypothesis of the present study is that naringin, the main effective component of Rhizoma drynariae, should promote the proliferation and osteogenesis of hAFSCs. The results from this study clearly demonstrated the enhancing effect of naringin on hAFSCs’ osteogenic differentiation regulated by the BMP and Wnt signalling pathways.
Figure 5. RT–PCR analysis of naringin-enhanced BMP and Wnt signalling of hAFSCs. (A) Gene expression of BMP pathway-related regulators BMP4 and RUNX2; (B) BMP4 and RUNX2 gene expression normalized to GAPDH; (C) gene expression of Wnt pathway-related regulators β-catenin and Cyclin D1; (D) β-catenin and Cyclin D1 gene expression normalized to GAPDH; N0, control; N1, 1 μg/ml naringin; N10, 10 μg/ml naringin; N100, 100 μg/ml naringin; N200, 200 μg/ml naringin; *p < 0.05 Copyright © 2014 John Wiley & Sons, Ltd.
J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
Figure 6. Effect of Wnt inhibitor DKK-1 or BMP inhibitor noggin on ALP activity of hAFSCs treated with naringin: N0, control; N100, 100 μg/ml naringin; N100 + DKK-1, 100 μg/ml naringin plus 0.2 μg/ml DKK-1; N100 + noggin, 100 μg/ml naringin plus 1 μg/ml noggin; *p < 0.05
The addition of naringin exhibited a biphasic effect on cell proliferation and ALP activity of hAFSCs. At a concentration of 200 μg/ml, naringin suppressed the growth and moderately increased the ALP activity of hAFSCs, while at lower concentrations (1–100 μg/ml), naringin significantly enhanced cell proliferation and ALP activity in a dose-dependent manner. The process of osteogenesis can be depicted in three major stages: the osteoprogenitor stage, the preosteoblast stage and the mature osteoblast stage (Zhang et al., 2009a). In this study, it was found that osteogenesis of hAFSCs was promoted by naringin at both early and late stages. The promotion of earlier stages was evidently observed by the upregulation of ALP activity on day 7. ALP, a significant enzyme in the process of bone formation, enhances the mineralization of bone matrix by transforming the phosphoric ester into inorganic phosphorus to increase the phosphorus concentration (Jiao et al., 2009). In this study, ALP was used as an indicator of early osteogenic differentiation of hAFSCs. The enhancement of late stages of osteogenesis was demonstrated by the expression of marker genes, including OPN and Collagen I on day 21, and extracellular mineralization and calcium content during days 21–28. Therefore, naringin could enhance osteogenesis of hAFSCs at both early and late stages. It should be noted that late osteogenic markers were observed after 14 days when a cocktail of inducers, including β-glycerol phosphate, dexamethasone and ascorbic acid 2-P, was used to induce osteogenic differentiation (Mathews et al., 2012). However, in our study only a single factor, naringin, was used in order to study its effects on osteogenic differentiation, and thus the late osteogenic markers were observed at a later time point (21–28 days). Bone remodelling includes two processes, bone formation and bone resorption. Osteoblasts are responsible to secrete new bone (bone formation), and osteoclasts deal with breaking bone down (bone resorption). An imbalance in the regulation of bone formation and bone resorption results in many bone diseases, such as Copyright © 2014 John Wiley & Sons, Ltd.
osteoporosis (Hadjidakis and Androulakis, 2006). OPG is a decoy receptor binding to RANKL (receptor activator of nuclear factor- B ligand), whose expression is critical for the maturation and activity of osteoclasts (Boyce and Xing, 2008). Therefore, OPG expression in osteoblasts inhibits osteoclast differentiation. The OPG:RANKL ratio is a good indicator in the regulation of osteogenesis and osteoclastogenesis. An increase in the OPG:RANKL ratio favours bone formation, while a decrease in the ratio favours bone resorption. Our study showed that naringin significantly increased the OPG expression with minimal RANKL expression during osteogenic differentiation of hAFSCs, indicating the inhibition effect of naringintreated cells on osteoclastogenesis. Thus, naringin may be used to enhance osteogenic differentiation of hAFSCs and other MSCs to heal bone-resorbing diseases, such as osteoporosis and bone-erosive rheumatoid arthritis. Osteogenesis is a complicated process involving several signalling pathways, including the BMP and canonical Wnt pathways (Huang et al., 2007; Peng et al., 2003; Zhang et al., 2010). The upregulation of mRNA expression of BMP-related regulators (BMP4 and RUNX2) and Wnt-related regulators (β-catenin and Cyclin D1) was observed in our study. In addition, in the presence of noggin, the inhibitor for the BMP signal pathway, or DKK-1, the inhibitor for Wnt–β-catenin signalling, ALP activity was remarkably reduced (Figure 6). Hence, our results suggested the involvement of both BMP and Wnt signalling pathways in the hAFSC osteogenic process after naringin treatment (Figure 7). BMPs are
Figure 7. Schematic illustration of BMP and Wnt signalling pathways in naringin-enhanced osteogenic differentiation of hAFSCs. BMP induces RUNX2 expression, which regulates the expression of other factors that act during terminal osteogenic differentiation. Wnt signalling contributes to osteoblast differentiation through β-catenin activation, which is responsible for the differentiation of mature osteoblasts and bone formation. Cyclin D1 is a target gene of the Wnt pathway, which is upregulated when Wnt–β-catenin signalling is activated J Tissue Eng Regen Med (2014) DOI: 10.1002/term
M. Liu et al.
responsible for maintaining the skeleton and facilitate the recruitment of osteoblast precursors to a certain location during embryonic development (Ryoo et al., 2006). They are essential to inducing ectopic bone formation, especially for the osteogenic differentiation of non-bone cells (Bandyopadhyay et al., 2013). It has been reported that BMPs promote osteoblastic differentiation by upregulating the expression of structural bone proteins, such as Collagen I, and enhancing the mineralization of bone matrix (Rawadi et al., 2003). RUNX2 is an important downstream regulator of the BMP pathway (Lian et al., 2006; Ryoo et al., 2006). It is considered as the master osteogenic transcription factor in the osteoblast maturation process and plays an essential role in the gene expression of osteoblast markers (Komori, 2011). It was reported that BMP induced the expression of RUNX2, which regulates other factors that act during terminal osteogenic differentiation and bone-specific extracellular matrix secretion (Lee et al., 2003; Nishio et al., 2006; Ryoo et al., 2006). In our study, the BMP-related regulators RUNX2 and BMP4 were found to be closely associated with the enhancing effect of naringin, suggesting the involvement of the BMP signalling pathway in the naringin-promoted osteogenic process of hAFSCs. Wnt–β-catenin signalling is another critical pathway for osteogenic differentiation and bone formation (Day et al., 2005; Huang et al., 2007). Wnts participate in embryonic skeletal patterning, fetal skeletal development and adult skeletal remodelling (Huang et al., 2007). Activation of canonical Wnt signalling resulted in higher bone density (Babij et al., 2003; Boyden et al., 2002) and higher expression of alkaline phosphatase (Bain et al., 2003; Rawadi et al., 2003). Previous studies have shown that Wnt signalling contributed to osteoblast differentiation through the activation of β-catenin (Bain et al., 2003; Rossini et al., 2013; Westendorf et al., 2004). β-catenin activity is significant for the differentiation of mature osteoblasts and bone formation (Day et al., 2005; Hu et al., 2005). Cyclin D1 is a target gene of the Wnt pathway, which was upregulated when Wnt–β-catenin signalling was activated (Shtutman et al., 1999). In this study, the mRNA expressions of β-catenin and Cyclin D1 were enhanced in the presence of naringin, suggesting that Wnt–β-catenin signalling was involved in the naringin-enhanced osteogenesis of hAFSCs. RUNX2 was reported to integrate Wnt signalling for mediating the process of osteoblast differentiation (Gaur et al., 2005; Hamidouche et al., 2008) and it was also involved in BMP signalling, as discussed above. Therefore, RUNX2 behaves as cross-talking regulator between the BMP and Wnt–β-catenin signalling pathways. Most osteoprotective medicines have some adverse effects. For instance, increased risk of cancer (Krieger et al., 2005) and cardiovascular diseases (Teede, 2003) were reported to be associated with hormone replacement therapy. It has also been reported that anti-resorptive bisphosphonate might result in upper gastrointestinal tract complications (Marshall, 2002) as well as long-range effects on the skeleton, especially in regard to bone Copyright © 2014 John Wiley & Sons, Ltd.
turnover and strength (Arum, 2008). The present study showed that 1–100 μg/ml naringin had no cytotoxicity to hAFSCs, indicated by the enhanced cell proliferation, which diminished at 200 μg/ml. Dose-dependent cytotoxicity effects of Chinese herbal medicines on embryonic stem and cancer cells have also been observed in our recent studies (Li et al., 2013a, 2013b). Because naringin is a natural compound present in Rhizoma drynariae and grapefruit, and has been widely used as a nutrient supplement, naringin itself could be used as an osteoprotecitve medicine as well as an enhancer for osteogenic differentiation of hAFSCs.
5. Conclusions Osteoporosis can lead to fractures and deformities and is a crucial public health problem. Osteogenic cells differentiated from hAFSCs could be used to augment bone formation and consequently in the treatment of osteoporosis and other bone-related diseases. The Chinese herb Rhizoma drynariae, which is safe and cheap, has been used for fracture and bone healing for thousands of years. The present study demonstrated that naringin, the main effective component of Rhizoma drynariae, could promote proliferation and osteogenesis and concurrently inhibit osteoclastogenesis of hAFSCs. Moreover, the results also suggested that naringin may promote the osteogenic differentiation of hAFSCs through both BMP and Wnt–βcatenin signal transduction pathways. Due to its therapeutic efficiency, economic and safety advantages, naringinenhanced osteogenesis of hAFSCs would be an attractive treatment strategy to augment bone formation in patients with osteoporosis and other bone disorders.
Conflict of interest The authors have declared that there is no conflict of interest.
Ethics statement The hAFSCs used in this study were obtained from Dr Anthony Atala and Dr James Yoo of the Wake Forest Institute for Regenerative Medicine (Winston-Salem, NC, USA) and their use in this study caused no ethical issues or concerns. No approval for their use in the research by any institutional or national ethical committee was required.
Acknowledgements This study was supported in part by Alumni Grants for Graduate Research and Scholarship (AGGRS) of Ohio State University. We would like to acknowledge Dr Anthony Atala and Dr James Yoo of the Wake Forest Institute for Regenerative Medicine (Winston-Salem, NC) for kindly providing hAFSCs used in this study. We also would like to acknowledge Dr Sebastien Sart for assistance in ImageJ analysis. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
Effects of naringin on osteogenic differentiation of hAFSCs
References AAOS. 2008; Burden of Musculoskeletal Diseases in the United States: Prevalence, Societal and Economic Cost. American Academy of Orthopaedic Surgeons: Rosemont, IL, USA. Arum SM. 2008; New developments surrounding the safety of bisphosphonates. Curr Opin Endocrinol Diabetes Obes 15: 508–513. Babij P, Zhao WG, Small C et al. 2003; High bone mass in mice expressing a mutant LRP5 gene. J Bone Miner Res 18: 960–974. Bain G, Muller T, Wang X et al. 2003; Activated β-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP2-mediated signal transduction. Biochem Biophys Res Commun 301: 84–81. Bandyopadhyay A, Yadav PS, Prashar P. 2013; BMP signaling in development and diseases: a pharmacological perspective. Biochem Pharmacol 85: 857–j864. Boyce BF, Xing LP. 2008; Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys 473: 139–146. Boyden LM, Mao JH, Belsky J et al. 2002; High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 346: 1513–1521. Chen KY, Lin KC, Chen YS et al. 2013; A novel porous gelatin composite containing naringin for bone repair. Evid Based Compl Alternat Med 28394: 1. Day TF, Guo X, Garrett-Beal L et al. 2005; Wnt/β-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell 8: 739–750. De Coppi P, Bartsch G Jr, Siddiqui MM et al. 2007; Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol 25: 100–106. Egermann M, Goldhahn J, Schneider E. 2005; Animal models for fracture treatment in osteoporosis. Osteoporos Int 16: S129–138. Gaur T, Lengner CJ, Hovhannisyan H et al. 2005; Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem 280: 33132–33140. Guan X, Delo DM, Atala A et al. 2011; In vitro cardiomyogenic potential of human amniotic fluid stem cells. J Tissue Eng Regen Med 5: 220–228. Hadjidakis DJ, Androulakis II. 2006; Bone remodeling. Ann NY Acad Sci 1092: 385–396. Hamidouche Z, Hay E, Vaudin P et al. 2008; FHL2 mediates dexamethasone-induced mesenchymal cell differentiation into osteoblasts by activating Wnt/β-catenin signaling-dependent Runx2 expression. FASEB J 22: 3813–3822. Hu H, Hilton MJ, Tu X et al. 2005; Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 132: 49–50. Huang W, Yang S, Shao J et al. 2007; Signaling and transcriptional regulation in osteoblast commitment and differentiation. Front Biosci 12: 3068–3092. Jeong JC, Lee JW, Yoon CH et al. 2005; Stimulative effects of Rhizoma drynariae extracts on the proliferation and differentiation of osteoblastic MC3T3-E1 cells. J Ethnopharmacol 96: 489–495. Copyright © 2014 John Wiley & Sons, Ltd.
Jiao L, Cao DP, Qin LP et al. 2009; Antiosteoporotic activity of phenolic compounds from Curculigo orchioides. Phytomedicine 16: 874–881. Komori T. 2011; Signaling networks in RUNX2-dependent bone development. J Cell Biochem 112: 750–755. Krieger N, Lowy I, Aronowitz R et al. 2005; Hormone replacement therapy, cancer, controversies, and women’s health: historical, epidemiological, biological, clinical, and advocacy perspectives. J Epidemiol Commun Health 59: 740–748. Lee MH, Kim YJ, Kim HJ et al. 2003; BMP-2induced Runx2 expression is mediated by Dlx5, and TGFβ1 opposes the BMP-2induced osteoblast differentiation by suppression of Dlx5 expression. J Biol Chem 278: 34387–34394. Li D, Isherwood S, Motz A et al. 2013a; Cellbased screening of traditional Chinese medicines for proliferation enhancers of mouse embryonic stem cells. Biotechnol Prog 29: 738–744. Li D, Zang R, Yang ST et al. 2013b; Cell-based high-throughput proliferation and cytotoxicity assays for screening traditional Chinese herbal medicines. Proc Biochem 48: 517–524. Li N, Jiang Y, Wooley PH et al. 2013c; Naringin promotes osteoblast differentiation and effectively reverses ovariectomy-associated osteoporosis. J Orthop Sci 18: 478–485. Lian JB, Stein GS, Javed A et al. 2006; Networks and hubs for the transcriptional control of osteoblastogenesis. Rev Endocr Metab Disord 7: 1–6. Licata AA. 2005; Discovery, clinical development, and therapeutic uses of bisphosphonates. Ann Pharmacother 39: 668–677. Liu M, Li Y, Yang ST. 2014a; Curculigoside improves osteogenesis of human amniotic fluid derived stem cells. Stem Cells Dev 23: 146–154. Liu M, Li Y, Yang ST. 2014b; Expansion of human amniotic fluid stem cells in threedimensional fibrous scaffolds in stirred bioreactors. Biochem Eng J 82: 71–80. Liu Y, Wu J, Zhu Y et al. 2014c; Therapeutic application of mesenchymal stem cells in bone and joint diseases. Clin Exp Med 14: 13–14. Ma X, Zhang S, Zhou J et al. 2012; Clone-derived human AF-amniotic fluid stem cells are capable of skeletal myogenic differentiation in vitro and in vivo. J Tissue Eng Regen Med 6: 598–513. Mathews S, Bhonde R, Gupta PK et al. 2012; Extracellular matrix protein mediated regulation of the osteoblast differentiation of bone marrow derived human mesenchymal stem cells. Differentiation 84: 185–192. Marshall JK. 2002; The gastrointestinal tolerability and safety of oral bisphosphonates. Expert Opin Drug Safety 1: 71–78. NIH. 2000; Osteoporosis prevention, diagnosis, and therapy. NIH Consens Statement Online 17: 1–6. Nishio Y, Dong YF, Paris M et al. 2006; Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene 372: 62–70. Orsini LS, Rousculp MD, Long SR et al. 2005; Health care utilization and expenditures in the United States: a study of osteoporosisrelated fractures. Osteoporos Int 16: 359–371. Pang WY, Wang XL, Mok SK et al. 2010; Naringin improves bone properties in
ovariectomized mice and exerts oestrogenlike activities in rat osteoblast-like (UMR106) cells. Br J Pharmacol 159: 1693–1703. Peng Y, Kang Q, Cheng H et al. 2003; Transcriptional characterization of bone morphogenetic proteins (BMPs)-mediated osteogenic signaling. J Cell Biochem 90: 1149–1165. Rawadi G, Vayssiere B, Dunn F et al. 2003; BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res 18: 1842–1853. Reginster JY, Burlet N. 2006; Osteoporosis: a still increasing prevalence. Bone 38: 4. Rodrigues MT, Lee SJ, Gomes ME et al. 2012; Amniotic fluid-derived stem cells as a cell source for bone tissue engineering. Tissue Eng A 18: 2518–2527. Rossini M, Gatti D, Adami S. 2013; Involvement of WNT/β-catenin signaling in the treatment of osteoporosis. Calcif Tissue Int 93: 121–132. Rotella DP. 2002; Osteoporosis: challenges and new opportunities for therapy. Curr Opin Drug Discov Dev 5: 477–486. Roubelakis MG, Pappa KI, Bitsika V et al. 2007; Molecular and proteomic characterization of human mesenchymal stem cells derived from amniotic fluid: comparison to bone marrow mesenchymal stem cells. Stem Cells Dev 16: 931–952. Ryoo HM, Lee MH, Kim YJ. 2006; Critical molecular switches involved in BMP-2induced osteogenic differentiation of mesenchymal cells. Gene 366: 51–57. Shtutman M, Zhurinsky J, Simcha I et al. 1999; The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway. Proc Natl Acad Sci U S A 96: 5522–5527. Teede HJ. 2003; Hormone replacement therapy, cardiovascular and cerebrovascular disease. Best Pract Res Clin Endoc Metab 17: 73–80. Trohatou O, Anagnou NP, Roubelakis MG. 2013; Human amniotic fluid stem cells as an attractive tool for clinical applications. Curr Stem Cell Res Ther 8: 125–132. Westendorf JJ, Kahler RA, Schroeder TM. 2004; Wnt signaling in osteoblasts and bone diseases. Gene 341: 19–29. Wong R, Rabie B, Bendeus M et al. 2007; The effects of Rhizoma curculiginis and Rhizoma drynariae extracts on bones. Chin Med 2: 13. Yeh YC, Wei HJ, Lee WY et al. 2010; Cellular cardiomyoplasty with human amniotic fluid stem cells: in vitro and in vivo studies. Tissue Eng A 16: 1925–1936. Zhai YK, Niu YB, Pan YL et al. 2013; Effects of naringin on proliferation, differentiation and maturation of rat calvarial osteoblasts in vitro. Zhongguo Zhong Yao Za Zhi 38: 105–111. Zhang JF, Li G, Chan CY et al. 2010; Flavonoids of Herba epimedii regulate osteogenesis of human mesenchymal stem cells through BMP and Wnt/β-catenin signaling pathway. Mol Cell Endocrinol 314: 70–74. Zhang JF, Li G, Meng CL et al. 2009a. Total flavonoids of Herba epimedii improves osteogenesis and inhibits osteoclastogenesis of human mesenchymal stem cells. Phytomedicine 16: 521–529. Zhang P, Dai KR, Yan SG et al. 2009b; Effects of naringin on the proliferation and osteogenic differentiation of human bone mesenchymal stem cell. Eur J Pharmacol 607: 1. J Tissue Eng Regen Med (2014) DOI: 10.1002/term
