International Journal of Biological Macromolecules 66 (2014) 354–361
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Effects of polysaccharides from abalone (Haliotis discus hannai Ino) on HepG2 cell proliferation Yu-Ming Wang a,1 , Feng-Juan Wu a,1 , Lei Du b , Guo-Yun Li a , Koretaro Takahashi b , Yong Xue a , Chang-Hu Xue a,∗ a b
College of Food Science and Engineering, Ocean University of China, No. 5 Yushan Road, Qingdao, Shandong Province 266003, PR China Division of Marine Life Science, Faculty of Fisheries Sciences, Hokkaido University, Hakodate 041-8611, Japan
a r t i c l e
i n f o
Article history: Received 2 December 2013 Received in revised form 7 January 2014 Accepted 17 January 2014 Available online 15 February 2014 Keywords: Abalone Polysaccharide Proliferation Cell cycle Serum supplement
a b s t r a c t Three polysaccharides, AAP, AVAP I, and AVAP II, were isolated from abalone Haliotis discus hannai Ino. The polysaccharides’ compositions were analysed, and their effects on HepG2 cell proliferation were assessed. AVAP I had a greater growth-stimulatory effect than AAP or AVAP II. The oligosaccharide of AVAP I (Oli-AVAP I) exhibited the same growth effects, but rhamnose, the primary monosaccharide of AVAP I and Oli-AVAP I, did not exhibit this activity. Moreover, AVAP I dramatically reduced the mRNA levels of CDK6 and Cyclin E1 but significantly increased Cyclin B1, CDK1 and Cyclin F. Interestingly, AVAP I remained able to induce cell proliferation in a low serum concentration medium. AVAP I could therefore promote HepG2 cell proliferation by regulating gene expression and accelerating the cell cycle process. AVAP I may be useful as a serum supplement for stimulating the proliferation of mammalian cells. Our results offer a comprehensive method for utilising the abalone viscera, which is usually discarded as waste. © 2014 Published by Elsevier B.V.
1. Introduction Abalone, Haliotis discus hannai Ino, is a large, single-shelled marine mollusc of the genus Haliotis. Abalone is widely cultured in East Asia as an economically important food resource [1]. Owing to its nutritive and pharmaceutical value, abalone has received extensive attention [1–5]. Abalone viscera accounts for 15–25% of the total body weight of the abalone, and this visceral matter is normally discarded as industrial waste [3]. The visceral waste contains many proteins, polysaccharides and fatty acids [4]. A substantial number of studies have been published regarding the activities of abalone polysaccharides, including antitumour [4], immunoregulatory [5] and antioxidative [6] activities. However, there are few reports concerning the cytoproliferative activity of the polysaccharides from pleopods and from the viscera of H. discus hannai Ino. There has been a rapid development in the fields of cell therapy and regenerative medicine and in the production of bio-medicine using mammalian cell culture [7]. Accelerating cell proliferation is fundamental for these applications. It has been reported that sericin, a protein derived from silkworms, is a good supplement
∗ Corresponding author. Tel.: +86 0532 82032468; fax: +86 0532 82032597. E-mail address: [email protected] (C.-H. Xue). 1 These authors have the same attribute to the article. 0141-8130/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.ijbiomac.2014.01.032
for cell culture media to accelerate the proliferation of mammalian cells [8,9]. Sericin was added to freezing media as an alternative to foetal bovine serum (FBS) and successfully improved the survival of various cell lines during cryopreservation [10,11]. Cell proliferation depends on intracellular signal transduction mediated by receptors, such as enzyme-linked receptors and protein degradation-dependent receptors [12]. Cyclins are positive regulators of cell cycle progression that are produced at specific periods during the cell cycle, and their expression levels and locations are tightly controlled [13]. Cyclins are the positive regulatory subunits of a class of protein kinases termed cyclin-dependent kinases (CDKs) [14]. Earlier studies have reported that sulphated polysaccharides from the sea cucumber Stichopus iaponicus could induce the proliferation of rat astrocytes by causing the accumulation of Cyclin D1, which integrates with the extracellular signals to activate CDK4 and/or CDK6 [15]. Progesterone was also able to promote the viability of mouse embryonic stem cells through the up-regulation of cyclins and cyclin-dependent kinases [16]. In the present study, three types of polysaccharides, AAP, AVAP I, and AVAP II, were isolated from the abalone H. discus hannai Ino and purified. The polysaccharides’ compositions were subsequently identified. We investigated the cell proliferation activity of these polysaccharides, and further studies examined AVAP I and the relationship between its composition and its effects on cell proliferation. We also examined whether the cell cycle-regulating genes were involved in inducing proliferation. Our results indicated
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
that AVAP I had a significant effect on HepG2 cell proliferation and could be used as a supplement for stimulating the proliferation of mammalian cells.
2. Materials and methods 2.1. Materials Fresh abalones, cultivated in Jiaonan, Shandong Province, China, were collected in the Nanshan aquatic market of Qingdao, shelled, eviscerated, vacuum freeze-dried and crushed. DEAEcellulose anion-exchange resin was from Whatman (Brentford, England), and SephacrylTM S-300 HR was from Pharmacia Co. (Uppsala, Sweden). A TSK G4000 PWXL column was from TOSOH Biosep (Tokyo, Japan). The human hepatoma cell line HepG2 was purchased from the Institute of Basic Medicine, Shandong Academy of Medical Sciences, China; 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl (MTT) was purchased from Sigma (St. Louis, MO, USA). RPMI 1640 Medium and newborn calf serum (NCS) were purchased from GIBCO (Grand Island, NY). The EdU cell proliferation detection kit was purchased from RIBOBIO (China); Moloney murine leukaemia virus (MMLV) reverse transcriptase was obtained from Promega (Madison, WI). TRIzol reagent was obtained from Invitrogen (Carlsbad, CA, USA). Maxima SYBR Green qPCR master mix was purchased from Fermentas (Glen Burnie, MD). Rhamnose monosaccharide standard was purchased from Sigma (St. Louis, MO, USA). Other reagents are analytic reagents (ARs).
2.2. Preparation of the polysaccharides and oligosaccharides from abalone pleopods and viscera and component analysis 2.2.1. Preparation of the polysaccharides from abalone pleopods and viscera and component analysis The preparation of crude abalone polysaccharides was based on the method reported previously [17]. The crude polysaccharides were fractionated by anion-exchange chromatography on a DEAE-cellulose column (2.6 cm × 40 cm). The carbohydrates were detected by the phenol–sulphuric acid method [18]. Then, the fractions were further purified by a Sephacryl S-300 HR column (2.0 cm × 100 cm) with ammonium acetate. The major fractions, named AAP, AVAP I, and AVAP II, were concentrated, desalted and freeze-dried for further experiments. Protein content was determined as described by the Lowry method [19]. Sulphate content
355
was determined according to the method of Ohira and Toda [20]. The monosaccharide composition was analysed by HPLC [21]. 2.2.2. Preparation of oligosaccharides of AVAP I The oligosaccharides of AVAP I were obtained by the partial depolymerisation of the polysaccharide with 0.05 M H2 SO4 at 100 ◦ C for 3 h. The oligosaccharide mixture was fractionated by gel filtration on a Bio-Gel P-4 column (2.6 cm × 120 cm) eluted with 0.3 M NH4 HCO3 at a flow rate of 0.3 mL/min and monitored by an RI detector from Agilent. The pooled oligosaccharide fractions were lyophilised. Negative-ion ES-MS was conducted on an LTQ-Orbitrap XL FT MS (Thermo Fisher Scientific, San-Jose, CA). The source parameters for FTMS detection were optimised using Arixtra to minimise the in-source fragmentation and sulphate loss and maximise the signal:noise ratio in the negative-ion mode. The optimised parameters included a spray voltage of 4.2 kV, a capillary voltage of −40 V, a tube lens voltage of −50 V, a capillary temperature of 275 ◦ C, a sheath flow rate of 30 L/min, and an auxiliary gas flow rate of 6 L/min. The external calibration of mass spectra routinely produced a mass accuracy of better than 3 ppm. All FT mass spectra were acquired at a resolution of 60,000 with a 150−2000 Da mass range. 2.3. Cell lines and culture conditions Human hepatoblastoma HepG2 cells were cultured in RPMI 1640 medium supplemented with 10% NCS, 100 U/mL penicillin, and 100 g/mL streptomycin in a water-saturated atmosphere of 5% CO2 at 37 ◦ C. The medium was changed every other day. Before treatment, cells were plated at an appropriate density on culture plates according to each experimental scale and cultured for 24 h. 2.4. MTT assay HepG2 cells were plated at a density of 2.0 × 104 cells/100 L in 96-well plates. After being treated with the indicated concentrations of AAP, AVAP I, or AVAP II for a set time, the medium was aspirated, the cells were washed twice with phosphate buffer saline (PBS), and MTT (0.5 g/L), dissolved in RPMI 1640 medium was added to each well. After an additional 4-h incubation at 37 ◦ C in the CO2 incubator, the medium was removed, and 200 L acidified dimethylcarbinol was added to each well. The absorbance at 570 nm of solubilised MTT formazan products was measured using
Fig. 1. The negative-ESI-MS of Oli-AVAP I. The m/z represents the mass-to-charge ratio.
356
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
a microplate reader (Bio-Rad, USA). Cell viability was expressed as a percentage of the value in the control. 2.5. EdU (5-ethynyl-2 -deoxyuridine) proliferation assay Proliferating HepG2 cells were measured by the EdU cell proliferation detection kit (RIBOBIO, China) according to the manufacturer’s protocol. Briefly, HepG2 cells were cultured in 96-well plates at 2.0 × 104 cells/100 L, pre-treated with AVAP I or medium for 24 h, and then exposed to 50 M EdU for an additional 2 h at 37 ◦ C. After washing with PBS three times, the cells in each well were reacted with 1*Apollo reaction cocktail for 30 min. Subsequently, cell nuclei were stained with 1*Hoechst 33342 for 30 min and visualised under a fluorescent microscope. The percentage of EdU-positive cells was calculated from five random fields. 2.6. RNA isolation and quantitative real-time PCR HepG2 cells were plated at a density of 1.0 × 105 cells/100 L in 6-well plates. After being treated with the indicated concentrations of AVAP I for 6 h, total cellular RNA was extracted from the adherent cultured HepG2 cells using TRIzol reagent according to the manufacturer’s recommendations. The concentration of total RNA was assessed with a Nanodrop 2000 (Thermo Scientific, USA). A first-strand complementary DNA was prepared from 1 g total RNA from each sample using MMLV reverse transcriptase and random primers. Quantitative real-time PCR was performed as described previously [22]. The primer sequences are listed in Table 1. The expression signal of the housekeeping gene -actin served as an internal control for normalisation. The gene expression level was analysed by relative quantification using the standard curve method.
Fig. 2. The effects of AAP, AVAP I and AVAP II on HepG2 cell viability. HepG2 cells were treated with 200 g/mL AAP, AVAP I and AVAP II for 48 h, and the cell viability was measured by the MTT assay. Data represent the mean ± S.D. of three independent experiments. *P < 0.05, **P < 0.01, compared to the control group.
determined by the Lowry method was approximately 1.11%, 4.44% and 4.12%, respectively. 3.2. Preparation and ESI-MS analysis of oligomers of AVAP I (Oli-AVAP I)
All results are presented as the means ± S.D. Comparison between means was assessed by unpaired Student’s t test using SPSS 10.0 software. P < 0.05 was considered statistically significant. Unless otherwise specified, all assays were performed in triplicate.
The oligosaccharides of AVAP I were obtained by the partial depolymerisation of the polysaccharide with 0.05 M H2 SO4 at 100 ◦ C for 3 h. The oligosaccharide mixture was purified by gel chromatography on a Bio-Gel P-4 and detected by an RI detector. Nine major fractions of AVAP I oligosaccharide were collected. The main oligosaccharide (Oli-AVAP I) was analysed by negative-ion ESIMS, as shown in Fig. 1. This analysis demonstrated that Oli-AVAP I is a mixture of dp4–dp5 oligomers, mainly 2Rha–2GlcA–2SO3 accounting for approximately 80% of the Oli-AVAP I. The other components were similar, with minor differences in the number of sugar residues or sulphates.
3. Results
3.3. The effects of AAP, AVAP I and AVAP II on HepG2 cell viability
3.1. Isolation, purification and chemical analysis of the polysaccharides
To analyse the role of the abalone polysaccharides AAP, AVAP I and AVAP II on the growth of HepG2 cells, the cell viability were first evaluated by the MTT assay. As shown in Fig. 2, the three polysaccharides exhibited different effects on HepG2 cells. AAP inhibited growth, but AVAP I and AVAP II both increased the cell viability to 2.22-fold and 1.13-fold (P < 0.01, P < 0.05) of control, respectively. AVAP I had a greater effect than AVAP II; thus the subsequent experiments focused on AVAP I.
2.7. Statistical analysis
Three polysaccharides, AAP, AVAP I and AVAP II, were isolated and purified from the pleopods and viscera of H. discus hannai Ino. The extracted crude polysaccharide was firstly purified by ion-exchange chromatography on a DEAE-cellulose column and the main polysaccharide fraction from the pleopods was eluted with 0.42–0.60 mol/L NaCl and collected, two fractions from the viscera were respectively eluted with 0.28–0.40 mol/L NaCl and 0.44–0.56 mol/L NaCl and collected. The pooled polysaccharide fractions were desalted and then further fractionated on a Sephacryl S-300/HR column based on molecular mass. Information about their composition is shown in Table 2. For AAP, four monosaccharides, GlcA, GalN, Fuc and Gal, in a molar ratio of 2.14:2.37:2.94:1, were determined to be the main components. AAP is a glycosaminoglycan (GAG)-like polysaccharide. AVAP I and AVAP II, from the viscera of the abalone, had a similar monosaccharide composition, mainly composed of Rha, GlcA and Gal, which is distinct from AAP. The sulphate content of AAP, AVAP I and AVAP II was determined by ion chromatography and found to be 21.5%, 15.2% and 20.9%, respectively. The protein content
3.4. The proliferation effect of AVAP I, Oli-AVAP I and rhamnose (Rha) on HepG2 cells Oli-AVAP I was the main oligosaccharide of AVAP I, and Rha was the primary monosaccharide comprising AVAP I and Oli-AVAP I. To further investigate the effects of these components on HepG2 cell proliferation and the relationship between them, AVAP I, Oli-AVAP I and Rha were applied to cells. As shown in Fig. 3, both AVAP I and Oli-AVAP I could promote cell proliferation significantly compared to the control group in a dose-dependent manner. The effect of OliAVAP I was weaker than AVAP I in inducing cell proliferation (Fig. 3A and B). In contrast, Rha had no proliferative effect on HepG2 cells, and at certain concentrations, it inhibited cell growth (Fig. 3C).
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
357
Table 1 Sequences of the primers used in quantitative real-time PCR. Gene name
Accession no.
Forward primer
Reverse primer
CDK1 CDK4 CDK6 Cyclin B1 Cyclin D1 Cyclin E1 Cyclin F -Actin
NM NM NM NM NM NM NM NM
AAGTTCAAGTTTCGTAATGC GCATCCCAATGTTGTCCG CCCTGTCTCACCCATACT GAGTGAGTGCCACGAACA AACACGGCTCACGCTTAC GGATGTTGACTGCCTTGA AGGGTGGGAGCATAGCAT GTGGACATCCGCAAAGAC
ACTGTTCTTCCCTGTTGC AGGCAGCCCAATCAGGTC TCCAGATAGCAATCCTCC CTACACCCAGCAGAAACC CCAGACCCTCAGACTTGC CACCACTGATACCCTGAAA GAGACACGGAAGGGACAGA AAAGGGTGTAACGCAACTAA
001130829.1 000075.3 001145306.1 031966.3 053056.2 001238.2 001761.2 001101.3
Furthermore, the EdU proliferation assay was performed. EdU is a nucleoside analogue of thymidine that is only incorporated into DNA during active DNA synthesis by proliferating cells. After incorporation, a fluorescent molecule was added that reacted specifically with EdU, allowing the fluorescent visualisation of proliferating cells to directly reflect the cell proliferation [23]. In our study, the proportion of EdU-positive cells was increased in the AVAP I group compared to the control (Fig. 4A). Quantitative analysis demonstrated that this change was statistically significant (Fig. 4B). To the best of our knowledge, this was the first demonstration that the polysaccharides from the abalone viscera could regulate cell cycle progression. 3.5. AVAP I accelerated the proliferation of HepG2 cells in different conditions The purity of serum is a serious concern in cell culture, as the serum is highly vulnerable to microbial contamination. In this study, we tried to reduce the amount of serum and investigated the effect of AVAP I on HepG2 cell culture. In a different experimental setup with cells grown in media containing 10% serum or a gradient serum concentration (8%, 6% and 4%), AVAP I significantly promoted proliferation compared to the control group in a dose-dependent manner (Fig. 5A). Similar results were obtained when cells were cultured in the absence of serum. When the serum concentration was only 2%, HepG2 cells grew slowly, but the cells partially recovered their proliferation in the presence of AVAP I (Fig. 5B). These results suggested that the addition of AVAP I to the medium enhanced the proliferation of HepG2 cells, indicating that AVAP I could be a potent and effective supplement of serum for HepG2 cell culture. 3.6. Effect of AVAP I on HepG2 cell cycle pathway genes To establish the mechanism of the proliferative acceleration induced by AVAP I in HepG2 cells, we investigated the status of the major genes of the G1 to S phase transition (Cyclin D1, Cyclin E1, CDK4 and CDK6) and the genes of the G2 to M phase transition (Cyclin B1, CDK1 and Cyclin F) in HepG2 cells treated with AVAP I (Fig. 6). Quantitative real-time PCR showed that after treatment with 200 g/mL AVAP I for 6 h, the mRNA levels of CDK6 and Cyclin E1 were significantly decreased to 68.33% and 72.41%, respectively (P < 0.01), when compared to the control group. Cyclin D1 and CDK4 mRNA levels did not show any major changes in comparison with the control group. These results showed that the cells transitioning from the G1 to S phase after treatment with AVAP I were fewer
than those in the control group. In contrast, AVAP I enhanced the mRNA levels of CDK1 and Cyclin F to 1.12 and 1.17-fold, respectively (P < 0.05). These results suggested that after the treatment with AVAP I, more cells were transitioning from G2 to M phase in comparison with the control group. Therefore, the results indicated that AVAP I accelerates the cell cycle by regulating the expression of the cell cycle relative genes.
4. Discussion In the present study, we isolated three polysaccharides (AAP, AVAP I and AVAP II) from the abalone H. discus hannai Ino. The composition analysis of the polysaccharides revealed that all three were sulphated, and their sulphate contents were 21.5%, 15.2% and 20.9% for AAP, AVAP I and AVAP II, respectively. The monosaccharide composition of AVAP I and AVAP II was similar and primarily composed of Rha, GlcA and Gal, but the composition of AAP was different, containing GlcA, GalN, Fuc and Gal. Wu et al. recently isolated a sulphated heterosaccharide Hal-B from Haliotis diversicolor Reeve, and discovered that it was primarily composed of Gal and Glc with minor amounts of Xyl, Fuc and GlcA [24]. The composition of these polysaccharides was also different from the glycosaminoglycans from other molluscs, such as Pinctada martensis [25]. Together, these results indicate that the composition of polysaccharides is significantly different in different molluscs and even among the different species of abalone. Very few studies have reported the cytoproliferative effects of marine sulphated polysaccharides. Go et al. found that polysaccharides from Capsosiphon fulvescens could stimulate the growth of IEC-6 cells [12]. Zhang et al. isolated and purified the sulphated polysaccharide from the sea cucumber Stichopus japonicus and found that it stimulated the proliferation of neural stem/progenitor cells [26]. Hatanaka et al. found that a synthetic sulphated polysaccharide could stimulate 3T3-L1 cell proliferation and that the degree of sulphation was an important factor in this process [27]. Our results showed that AVAP I exhibited the strongest proliferation enhancement, but the sulphate content was 15.2%, which was less than those of AAP and AVAP II and suggests that the sulphate content is not the major factor that affects the cell proliferation in this study. In our study, the prominent feature of the three polysaccharides from abalone was their monosaccharide composition. All three polysaccharides were rich in Rha. A recent review summarised that rhamnose-rich oligo- and polysaccharides could stimulate the proliferation of skin fibroblasts and corneal keratocytes and the biosynthesis of collagen [28,29]. Our results showed that AAP,
Table 2 The composition of the polysaccharides AAP, AVAP I and AVAP II isolated from the abalone. Samples
Rha
GlcN
GalN
GlcA
Gal
Man
Xyl
Fuc
Sulphate (%)
Protein (%)
AAP AVAP I AVAP II
0.31 6.40 3.69
0.28 – –
2.14 – –
2.37 3.69 2.04
1.0 1.0 1.0
– 0.37 0.41
0.09 0.39 0.22
2.94 0.23 0.4
21.5 15.2 20.9
1.11 4.44 4.12
358
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
Fig. 3. The effect of AVAP I, Oli-AVAP I and Rha on HepG2 cell viability. HepG2 cells were incubated with different concentrations of AVAP I, Oli-AVAP I and Rha (A–C) for 24 and 48 h, and the cell viability was measured by the MTT assay. Data represent the mean ± S.D. of three independent experiments. *P < 0.05, **P < 0.01, compared to the control group.
which contained the least amount of Rha among the three abalone polysaccharides, did not stimulate proliferation. However, AVAP I contained the highest quantity of Rha and exhibited the strongest proliferation effect, which was 1.9-fold greater than AVAP II. However, when we surveyed the activity of Rha on HepG2 cells, we found that Rha had no effect on HepG2 cell proliferation. This result suggested that rhamnose-rich polysaccharides could stimulate cell proliferation, but the active unit was not the monosaccharide. Previous studies found that rhamnose-rich oligo- and polysaccharides could stimulate cell proliferation and collagen biosynthesis, which might be triggered by the mediation of a specific ␣-l-rhamnose recognizing lectin-site as a receptor, transmitting signals to the cellinterior [30], but more studies should be pursued to uncover this
enigma. Next, we degraded the AVAP I and obtained the oligosaccharide Oli-AVAP I, which was a mixture of dp4–dp5 oligomers. The main composition was 2Rha–2GlcA–2SO3 . We discovered that Oli-AVAP I also stimulated proliferation, but the effect was weaker than it was with AVAP I. Therefore, the active component was not yet clear, and further research was needed. The cell cycle is the series of events that take place in a cell to allow division and duplication. Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs) [13]. Cyclin D binds to CDK4/6, and Cyclin E binds to CDK2, playing a central role in cell cycle progression by promoting the G1/S cell cycle transition [31–33]. From the EdU proliferation assay results, the EdU-positive cells were significantly increased by AVAP I treatment. Therefore,
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
359
Fig. 4. The effects of AVAP I on the proliferation of HepG2 cells by the EdU assay. HepG2 cells were incubated with different concentration of AVAP I (100 and 200 g/mL) for 48 h. (A) Proliferating HepG2 cells were labelled with EdU. The Click-it reaction revealed EdU staining (red); cell nuclei were stained with Hoechst 33342 (blue). The images are representative of the results obtained. (B) The percentage of EdU-positive HepG2 cells was quantified. *P < 0.05, **P < 0.01, compared to the control group. (For interpretation of the references to color in text, the reader is referred to the web version of this article.)
we assumed that AVAP I could regulate the cell cycle progression. To investigate the mechanism underlying the proliferation effect of AVAP I on HepG2 cells, we checked the genes that are closely related with the cell cycle. Compared with the control group, AVAP I could down-regulate the mRNA levels of CDK6 and Cyclin E1 and upregulate Cyclin B1, CDK1 and Cyclin F. The results clearly showed that AVAP I could accelerate the cell cycle and promote HepG2 cell proliferation, which underlines the importance of AVAP I in these processes. Recently, mammalian cell cultures have been applied to many fields. Various cell types, including skin and lymphocytes, are cultured ex vivo for regenerative medicine and cell therapy [7]. A variety of mammalian cells are industrially cultured to produce biomaterials such as proteins and gene therapy vectors [34]. Most mammalian cells require serum or its replacement in the culture
medium during. The sera used most frequently are foetal bovine serum (FBS) and calf serum, and they are frequently contaminated with viruses; even the risk of contamination with prions or bovine spongiform encephalopathy (BSE) cannot be erased [8]. Therefore, reducing the amount of serum in the media or other alternatives for supplementing the culture media is highly desired. We found that on reduction of the serum concentration in the culture media, the cell proliferation was negatively affected. Surprisingly, we found that the addition of AVAP I could partially restore proliferation. A concentration of 10 g/mL AVAP I significantly enhanced cell proliferation; cell viability was also similar to that of the control group, indicating that a portion of the serum could be substituted by AVAP I. These results suggested that AVAP I could be a potent and effective supplement for cell culture. However, more in-depth studies are required to conclude whether it can be applied to other
360
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
Fig. 5. The effects of AVAP I on HepG2 cell proliferation in different conditions. (A) In a gradient of descending serum (8%, 6% and 4%) concentrations, HepG2 cells were pre-treated with different concentrations of AVAP I (50 and 200 g/mL) for 48 h. # P < 0.05, compared to the control group, *P < 0.05, **P < 0.01, compared to the same serum content without AVAP I group. (B) In the absence of serum (serum content only 2%), HepG2 cells were treated with different concentrations of AVAP I (10, 20 and 50 g/mL) for 24 h and 48 h. The cell viability was measured by the MTT assay. # P < 0.05, compared to the control group, *P < 0.05, compared to 2% serum content without AVAP I group. The data from three independent examinations are presented.
mammalian cells and whether it can completely replace the serum in culture media. In conclusion, the present study indicates that AVAP I isolated from abalone could promote HepG2 cell proliferation by accelerating the cell cycle. The oligomer of AVAP I (2Rha–2GlcA–2SO3 ) retained this proliferative effect, but Rha, the main monosaccharide component of AVAP I and Oli-AVAP I, could not promote proliferation. This finding also suggests that AVAP I could be a preferable culture medium supplement for stimulating the proliferation of mammalian cells.
Acknowledgments This study was supported by the National Marine Public Welfare Scientific Research Project of China (No. 201105029) and the Programme for Changjiang Scholars and Innovative Research Team in University (IRT1188). Fig. 6. The effect of AVAP I on the proliferation of HepG2 cells according to cell cycle pathway genes. The mRNA expression of Cyclin B1, CDK1, Cyclin F, Cyclin D1, CDK4, CDK6, Cyclin E1 and -actin were measured by quantitative RT-PCR. Data normalisation was accomplished using the endogenous reference -actin. Values are the mean ± S.D. *P < 0.05, **P < 0.01, versus control group.
References [1] B.W. Zhu, D.M. Li, D.Y. Zhou, S. Han, J.F. Yang, W.X. Ye, G.H. Greeley, Food Chemistry 125 (2011) 1273–1278.
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361 [2] C. Yoneda, M.N. Ahsana, M. Nakaya, Y. Matsubara, T. Ebihara, S. Irie, Y. Uno, K. Hatae, S. Watabe, Comparative Biochemistry and Physiology Part B 126 (2000) 59–68. [3] D.Y. Zhou, L. Tong, B.W. Zhu, H.T. Wu, L. Qin, H. Tan, Y. Murata, Journal of Food Processing and Preservation 36 (2012) 126–132. [4] B.W. Zhu, L.S. Wang, D.Y. Zhou, D.M. Li, L.M. Sun, J.F. Yang, H.T. Wu, X.Q. Zhou, M. Tada, European Food Research and Technology 227 (2008) 1663– 1668. [5] B.W. Zhu, D.Y. Zhou, T. Li, S. Yan, J.F. Yang, D.M. Li, Food Chemistry 121 (2010) 3712–3718. [6] B.W. Zhu, D.Y. Zhou, J.F. Yang, D.M. Li, H.L. Yin, M. Tada, European Food Research and Technology 228 (2009) 591–595. [7] T. Toyosawa, M. Sasaki, Y. Kato, H. Yamada, S. Terada, Cell Technology for Cell Products 3 (2007) 225–231. [8] S. Terada, T. Nishimura, M. Sasaki, H. Yamada, M. Miki Sercin, Cytotechnology 40 (2002) 3–12. [9] A. Ogawa, S. Terada, T. Kanayama, M. Miki, M. Morikawa, T. Kimura, A. Yamaguchi, M. Sasaki, H. Yamada, Journal of Bioscience and Bioengineering 98 (2004) 217–219. [10] S. Terada, T. Kumagai, A. Ogawa, J. Ishimura, M. Miki, K. Ozaki, M. Sasaki, H. Yamada, Low Temperature Medicine 29 (2003) 1–5. [11] M. Sasaki, Y. Kato, H. Yamada, S. Terada, Biotechnology and Applied Biochemistry 42 (2005) 183–188. [12] H. Go, H.J. Hwang, T.J. Nam, Marine Biotechnology 13 (2011) 433–440. [13] M. Loog, D.O. Morgan, Nature 434 (2005) 104–108. [14] D. Resnitzky, S.I. Reed, Molecular and Cellular Biology 15 (1995) 3463–3469. [15] X.H. Sheng, N.N. Zhang, S.L. Song, M. Li, H. Liang, Y.J. Zhang, Y.S. Wang, A. Ji, Neuroscience Letters 503 (2011) 37–42. [16] S.W. Shen, H.Y. Song, Acta Physiologica Sinica 61 (2009) 431–438.
361
[17] G.Y. Li, S.G. Chen, Y.M. Wang, Y. Xue, Y.G. Chang, Z.J. Li, J.F. Wang, C.H. Xue, International Journal of Biological Macromolecules 49 (2011) 1160–1166. [18] M. Dubois, K.A. Gilles, J.K. Hamilton, P.A. Rebers, F. Smith, Analytical Chemistry 28 (1956) 350–356. [19] O.H. Lowry, N.J. Roseerbrough, A.L. Farr, R.J. Randall, Journal of Biological Chemistry 1953 (1951) 265–275. [20] S.I. Ohira, K. Toda, Journal of Chromatography A 1121 (2006) 280–284. [21] D.J. Strydom, Journal of Chromatography A 678 (1994) 17–23. [22] L. Du, Z.J. Li, J. Xu, J.F. Wang, Y. Xue, C.H. Xue, K. Takahashi, Y.M. Wang, Journal of Oleo Science 61 (2012) 321–330. [23] Z.Q. Huang, X.L. Chen, B. Yu, J. He, D.W. Chen, Biochemical and Biophysical Research Communications 423 (2012) 265–269. [24] Y.W. Wu, Z.G. She, G.P. Hu, Y.C. Lin, Acta Scientiarum Naturalium Universitatis Sunyatseni 41 (2002) 119–120. [25] N. Volpi, F. Maccari, Biomacromolecules 6 (2005) 3174–3180. [26] Y.J. Zhang, S.L. Song, D. Song, H. Liang, W.L. Wang, A.G. Ji, Journal of Bioscience and Bioengineering 109 (2010) 67–72. [27] M. Kunou, K. Hatanaka, Carbohydrate Polymers 28 (1995) 107–112. [28] V. Ravelojaona, A.M. Robert, L. Robert, G. Renard, Pathologie Biologie 56 (2008) 66–69. [29] G. Faury, E. Ruszova, J. Molinari, B. Mariko, S. Raveaud, V. Velebny, L. Robert, Biochimica et Biophysica Acta 1780 (2008) 1388–1394. [30] E. Andres, J. Molinari, G. Peterszegi, B. Mariko, E. Ruszova, V. Velebny, G. Faury, L. Robert, Pathologie Biologie 54 (2006) 420–425. [31] Y. Xiong, H. Zhang, D. Beach, Cell 71 (1992) 505–514. [32] V. Dulic, E. Lees, S.I. Reed, Science 257 (1992) 1958–1961. [33] J.M. Trimarchi, J.A. Lees, Nature Reviews Molecular Cell Biology 3 (2002) 11–20. [34] S. Terada, N. Takada, K. Itoh, T. Saitoh, M. Sasaki, H. Yamada, Cell Technology for Cell Products 3 (2007) 397–401.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Effects of polysaccharides from abalone (Haliotis discus hannai Ino) on HepG2 cell proliferation Yu-Ming Wang a,1 , Feng-Juan Wu a,1 , Lei Du b , Guo-Yun Li a , Koretaro Takahashi b , Yong Xue a , Chang-Hu Xue a,∗ a b
College of Food Science and Engineering, Ocean University of China, No. 5 Yushan Road, Qingdao, Shandong Province 266003, PR China Division of Marine Life Science, Faculty of Fisheries Sciences, Hokkaido University, Hakodate 041-8611, Japan
a r t i c l e
i n f o
Article history: Received 2 December 2013 Received in revised form 7 January 2014 Accepted 17 January 2014 Available online 15 February 2014 Keywords: Abalone Polysaccharide Proliferation Cell cycle Serum supplement
a b s t r a c t Three polysaccharides, AAP, AVAP I, and AVAP II, were isolated from abalone Haliotis discus hannai Ino. The polysaccharides’ compositions were analysed, and their effects on HepG2 cell proliferation were assessed. AVAP I had a greater growth-stimulatory effect than AAP or AVAP II. The oligosaccharide of AVAP I (Oli-AVAP I) exhibited the same growth effects, but rhamnose, the primary monosaccharide of AVAP I and Oli-AVAP I, did not exhibit this activity. Moreover, AVAP I dramatically reduced the mRNA levels of CDK6 and Cyclin E1 but significantly increased Cyclin B1, CDK1 and Cyclin F. Interestingly, AVAP I remained able to induce cell proliferation in a low serum concentration medium. AVAP I could therefore promote HepG2 cell proliferation by regulating gene expression and accelerating the cell cycle process. AVAP I may be useful as a serum supplement for stimulating the proliferation of mammalian cells. Our results offer a comprehensive method for utilising the abalone viscera, which is usually discarded as waste. © 2014 Published by Elsevier B.V.
1. Introduction Abalone, Haliotis discus hannai Ino, is a large, single-shelled marine mollusc of the genus Haliotis. Abalone is widely cultured in East Asia as an economically important food resource [1]. Owing to its nutritive and pharmaceutical value, abalone has received extensive attention [1–5]. Abalone viscera accounts for 15–25% of the total body weight of the abalone, and this visceral matter is normally discarded as industrial waste [3]. The visceral waste contains many proteins, polysaccharides and fatty acids [4]. A substantial number of studies have been published regarding the activities of abalone polysaccharides, including antitumour [4], immunoregulatory [5] and antioxidative [6] activities. However, there are few reports concerning the cytoproliferative activity of the polysaccharides from pleopods and from the viscera of H. discus hannai Ino. There has been a rapid development in the fields of cell therapy and regenerative medicine and in the production of bio-medicine using mammalian cell culture [7]. Accelerating cell proliferation is fundamental for these applications. It has been reported that sericin, a protein derived from silkworms, is a good supplement
∗ Corresponding author. Tel.: +86 0532 82032468; fax: +86 0532 82032597. E-mail address: [email protected] (C.-H. Xue). 1 These authors have the same attribute to the article. 0141-8130/$ – see front matter © 2014 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.ijbiomac.2014.01.032
for cell culture media to accelerate the proliferation of mammalian cells [8,9]. Sericin was added to freezing media as an alternative to foetal bovine serum (FBS) and successfully improved the survival of various cell lines during cryopreservation [10,11]. Cell proliferation depends on intracellular signal transduction mediated by receptors, such as enzyme-linked receptors and protein degradation-dependent receptors [12]. Cyclins are positive regulators of cell cycle progression that are produced at specific periods during the cell cycle, and their expression levels and locations are tightly controlled [13]. Cyclins are the positive regulatory subunits of a class of protein kinases termed cyclin-dependent kinases (CDKs) [14]. Earlier studies have reported that sulphated polysaccharides from the sea cucumber Stichopus iaponicus could induce the proliferation of rat astrocytes by causing the accumulation of Cyclin D1, which integrates with the extracellular signals to activate CDK4 and/or CDK6 [15]. Progesterone was also able to promote the viability of mouse embryonic stem cells through the up-regulation of cyclins and cyclin-dependent kinases [16]. In the present study, three types of polysaccharides, AAP, AVAP I, and AVAP II, were isolated from the abalone H. discus hannai Ino and purified. The polysaccharides’ compositions were subsequently identified. We investigated the cell proliferation activity of these polysaccharides, and further studies examined AVAP I and the relationship between its composition and its effects on cell proliferation. We also examined whether the cell cycle-regulating genes were involved in inducing proliferation. Our results indicated
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
that AVAP I had a significant effect on HepG2 cell proliferation and could be used as a supplement for stimulating the proliferation of mammalian cells.
2. Materials and methods 2.1. Materials Fresh abalones, cultivated in Jiaonan, Shandong Province, China, were collected in the Nanshan aquatic market of Qingdao, shelled, eviscerated, vacuum freeze-dried and crushed. DEAEcellulose anion-exchange resin was from Whatman (Brentford, England), and SephacrylTM S-300 HR was from Pharmacia Co. (Uppsala, Sweden). A TSK G4000 PWXL column was from TOSOH Biosep (Tokyo, Japan). The human hepatoma cell line HepG2 was purchased from the Institute of Basic Medicine, Shandong Academy of Medical Sciences, China; 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyl (MTT) was purchased from Sigma (St. Louis, MO, USA). RPMI 1640 Medium and newborn calf serum (NCS) were purchased from GIBCO (Grand Island, NY). The EdU cell proliferation detection kit was purchased from RIBOBIO (China); Moloney murine leukaemia virus (MMLV) reverse transcriptase was obtained from Promega (Madison, WI). TRIzol reagent was obtained from Invitrogen (Carlsbad, CA, USA). Maxima SYBR Green qPCR master mix was purchased from Fermentas (Glen Burnie, MD). Rhamnose monosaccharide standard was purchased from Sigma (St. Louis, MO, USA). Other reagents are analytic reagents (ARs).
2.2. Preparation of the polysaccharides and oligosaccharides from abalone pleopods and viscera and component analysis 2.2.1. Preparation of the polysaccharides from abalone pleopods and viscera and component analysis The preparation of crude abalone polysaccharides was based on the method reported previously [17]. The crude polysaccharides were fractionated by anion-exchange chromatography on a DEAE-cellulose column (2.6 cm × 40 cm). The carbohydrates were detected by the phenol–sulphuric acid method [18]. Then, the fractions were further purified by a Sephacryl S-300 HR column (2.0 cm × 100 cm) with ammonium acetate. The major fractions, named AAP, AVAP I, and AVAP II, were concentrated, desalted and freeze-dried for further experiments. Protein content was determined as described by the Lowry method [19]. Sulphate content
355
was determined according to the method of Ohira and Toda [20]. The monosaccharide composition was analysed by HPLC [21]. 2.2.2. Preparation of oligosaccharides of AVAP I The oligosaccharides of AVAP I were obtained by the partial depolymerisation of the polysaccharide with 0.05 M H2 SO4 at 100 ◦ C for 3 h. The oligosaccharide mixture was fractionated by gel filtration on a Bio-Gel P-4 column (2.6 cm × 120 cm) eluted with 0.3 M NH4 HCO3 at a flow rate of 0.3 mL/min and monitored by an RI detector from Agilent. The pooled oligosaccharide fractions were lyophilised. Negative-ion ES-MS was conducted on an LTQ-Orbitrap XL FT MS (Thermo Fisher Scientific, San-Jose, CA). The source parameters for FTMS detection were optimised using Arixtra to minimise the in-source fragmentation and sulphate loss and maximise the signal:noise ratio in the negative-ion mode. The optimised parameters included a spray voltage of 4.2 kV, a capillary voltage of −40 V, a tube lens voltage of −50 V, a capillary temperature of 275 ◦ C, a sheath flow rate of 30 L/min, and an auxiliary gas flow rate of 6 L/min. The external calibration of mass spectra routinely produced a mass accuracy of better than 3 ppm. All FT mass spectra were acquired at a resolution of 60,000 with a 150−2000 Da mass range. 2.3. Cell lines and culture conditions Human hepatoblastoma HepG2 cells were cultured in RPMI 1640 medium supplemented with 10% NCS, 100 U/mL penicillin, and 100 g/mL streptomycin in a water-saturated atmosphere of 5% CO2 at 37 ◦ C. The medium was changed every other day. Before treatment, cells were plated at an appropriate density on culture plates according to each experimental scale and cultured for 24 h. 2.4. MTT assay HepG2 cells were plated at a density of 2.0 × 104 cells/100 L in 96-well plates. After being treated with the indicated concentrations of AAP, AVAP I, or AVAP II for a set time, the medium was aspirated, the cells were washed twice with phosphate buffer saline (PBS), and MTT (0.5 g/L), dissolved in RPMI 1640 medium was added to each well. After an additional 4-h incubation at 37 ◦ C in the CO2 incubator, the medium was removed, and 200 L acidified dimethylcarbinol was added to each well. The absorbance at 570 nm of solubilised MTT formazan products was measured using
Fig. 1. The negative-ESI-MS of Oli-AVAP I. The m/z represents the mass-to-charge ratio.
356
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
a microplate reader (Bio-Rad, USA). Cell viability was expressed as a percentage of the value in the control. 2.5. EdU (5-ethynyl-2 -deoxyuridine) proliferation assay Proliferating HepG2 cells were measured by the EdU cell proliferation detection kit (RIBOBIO, China) according to the manufacturer’s protocol. Briefly, HepG2 cells were cultured in 96-well plates at 2.0 × 104 cells/100 L, pre-treated with AVAP I or medium for 24 h, and then exposed to 50 M EdU for an additional 2 h at 37 ◦ C. After washing with PBS three times, the cells in each well were reacted with 1*Apollo reaction cocktail for 30 min. Subsequently, cell nuclei were stained with 1*Hoechst 33342 for 30 min and visualised under a fluorescent microscope. The percentage of EdU-positive cells was calculated from five random fields. 2.6. RNA isolation and quantitative real-time PCR HepG2 cells were plated at a density of 1.0 × 105 cells/100 L in 6-well plates. After being treated with the indicated concentrations of AVAP I for 6 h, total cellular RNA was extracted from the adherent cultured HepG2 cells using TRIzol reagent according to the manufacturer’s recommendations. The concentration of total RNA was assessed with a Nanodrop 2000 (Thermo Scientific, USA). A first-strand complementary DNA was prepared from 1 g total RNA from each sample using MMLV reverse transcriptase and random primers. Quantitative real-time PCR was performed as described previously [22]. The primer sequences are listed in Table 1. The expression signal of the housekeeping gene -actin served as an internal control for normalisation. The gene expression level was analysed by relative quantification using the standard curve method.
Fig. 2. The effects of AAP, AVAP I and AVAP II on HepG2 cell viability. HepG2 cells were treated with 200 g/mL AAP, AVAP I and AVAP II for 48 h, and the cell viability was measured by the MTT assay. Data represent the mean ± S.D. of three independent experiments. *P < 0.05, **P < 0.01, compared to the control group.
determined by the Lowry method was approximately 1.11%, 4.44% and 4.12%, respectively. 3.2. Preparation and ESI-MS analysis of oligomers of AVAP I (Oli-AVAP I)
All results are presented as the means ± S.D. Comparison between means was assessed by unpaired Student’s t test using SPSS 10.0 software. P < 0.05 was considered statistically significant. Unless otherwise specified, all assays were performed in triplicate.
The oligosaccharides of AVAP I were obtained by the partial depolymerisation of the polysaccharide with 0.05 M H2 SO4 at 100 ◦ C for 3 h. The oligosaccharide mixture was purified by gel chromatography on a Bio-Gel P-4 and detected by an RI detector. Nine major fractions of AVAP I oligosaccharide were collected. The main oligosaccharide (Oli-AVAP I) was analysed by negative-ion ESIMS, as shown in Fig. 1. This analysis demonstrated that Oli-AVAP I is a mixture of dp4–dp5 oligomers, mainly 2Rha–2GlcA–2SO3 accounting for approximately 80% of the Oli-AVAP I. The other components were similar, with minor differences in the number of sugar residues or sulphates.
3. Results
3.3. The effects of AAP, AVAP I and AVAP II on HepG2 cell viability
3.1. Isolation, purification and chemical analysis of the polysaccharides
To analyse the role of the abalone polysaccharides AAP, AVAP I and AVAP II on the growth of HepG2 cells, the cell viability were first evaluated by the MTT assay. As shown in Fig. 2, the three polysaccharides exhibited different effects on HepG2 cells. AAP inhibited growth, but AVAP I and AVAP II both increased the cell viability to 2.22-fold and 1.13-fold (P < 0.01, P < 0.05) of control, respectively. AVAP I had a greater effect than AVAP II; thus the subsequent experiments focused on AVAP I.
2.7. Statistical analysis
Three polysaccharides, AAP, AVAP I and AVAP II, were isolated and purified from the pleopods and viscera of H. discus hannai Ino. The extracted crude polysaccharide was firstly purified by ion-exchange chromatography on a DEAE-cellulose column and the main polysaccharide fraction from the pleopods was eluted with 0.42–0.60 mol/L NaCl and collected, two fractions from the viscera were respectively eluted with 0.28–0.40 mol/L NaCl and 0.44–0.56 mol/L NaCl and collected. The pooled polysaccharide fractions were desalted and then further fractionated on a Sephacryl S-300/HR column based on molecular mass. Information about their composition is shown in Table 2. For AAP, four monosaccharides, GlcA, GalN, Fuc and Gal, in a molar ratio of 2.14:2.37:2.94:1, were determined to be the main components. AAP is a glycosaminoglycan (GAG)-like polysaccharide. AVAP I and AVAP II, from the viscera of the abalone, had a similar monosaccharide composition, mainly composed of Rha, GlcA and Gal, which is distinct from AAP. The sulphate content of AAP, AVAP I and AVAP II was determined by ion chromatography and found to be 21.5%, 15.2% and 20.9%, respectively. The protein content
3.4. The proliferation effect of AVAP I, Oli-AVAP I and rhamnose (Rha) on HepG2 cells Oli-AVAP I was the main oligosaccharide of AVAP I, and Rha was the primary monosaccharide comprising AVAP I and Oli-AVAP I. To further investigate the effects of these components on HepG2 cell proliferation and the relationship between them, AVAP I, Oli-AVAP I and Rha were applied to cells. As shown in Fig. 3, both AVAP I and Oli-AVAP I could promote cell proliferation significantly compared to the control group in a dose-dependent manner. The effect of OliAVAP I was weaker than AVAP I in inducing cell proliferation (Fig. 3A and B). In contrast, Rha had no proliferative effect on HepG2 cells, and at certain concentrations, it inhibited cell growth (Fig. 3C).
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
357
Table 1 Sequences of the primers used in quantitative real-time PCR. Gene name
Accession no.
Forward primer
Reverse primer
CDK1 CDK4 CDK6 Cyclin B1 Cyclin D1 Cyclin E1 Cyclin F -Actin
NM NM NM NM NM NM NM NM
AAGTTCAAGTTTCGTAATGC GCATCCCAATGTTGTCCG CCCTGTCTCACCCATACT GAGTGAGTGCCACGAACA AACACGGCTCACGCTTAC GGATGTTGACTGCCTTGA AGGGTGGGAGCATAGCAT GTGGACATCCGCAAAGAC
ACTGTTCTTCCCTGTTGC AGGCAGCCCAATCAGGTC TCCAGATAGCAATCCTCC CTACACCCAGCAGAAACC CCAGACCCTCAGACTTGC CACCACTGATACCCTGAAA GAGACACGGAAGGGACAGA AAAGGGTGTAACGCAACTAA
001130829.1 000075.3 001145306.1 031966.3 053056.2 001238.2 001761.2 001101.3
Furthermore, the EdU proliferation assay was performed. EdU is a nucleoside analogue of thymidine that is only incorporated into DNA during active DNA synthesis by proliferating cells. After incorporation, a fluorescent molecule was added that reacted specifically with EdU, allowing the fluorescent visualisation of proliferating cells to directly reflect the cell proliferation [23]. In our study, the proportion of EdU-positive cells was increased in the AVAP I group compared to the control (Fig. 4A). Quantitative analysis demonstrated that this change was statistically significant (Fig. 4B). To the best of our knowledge, this was the first demonstration that the polysaccharides from the abalone viscera could regulate cell cycle progression. 3.5. AVAP I accelerated the proliferation of HepG2 cells in different conditions The purity of serum is a serious concern in cell culture, as the serum is highly vulnerable to microbial contamination. In this study, we tried to reduce the amount of serum and investigated the effect of AVAP I on HepG2 cell culture. In a different experimental setup with cells grown in media containing 10% serum or a gradient serum concentration (8%, 6% and 4%), AVAP I significantly promoted proliferation compared to the control group in a dose-dependent manner (Fig. 5A). Similar results were obtained when cells were cultured in the absence of serum. When the serum concentration was only 2%, HepG2 cells grew slowly, but the cells partially recovered their proliferation in the presence of AVAP I (Fig. 5B). These results suggested that the addition of AVAP I to the medium enhanced the proliferation of HepG2 cells, indicating that AVAP I could be a potent and effective supplement of serum for HepG2 cell culture. 3.6. Effect of AVAP I on HepG2 cell cycle pathway genes To establish the mechanism of the proliferative acceleration induced by AVAP I in HepG2 cells, we investigated the status of the major genes of the G1 to S phase transition (Cyclin D1, Cyclin E1, CDK4 and CDK6) and the genes of the G2 to M phase transition (Cyclin B1, CDK1 and Cyclin F) in HepG2 cells treated with AVAP I (Fig. 6). Quantitative real-time PCR showed that after treatment with 200 g/mL AVAP I for 6 h, the mRNA levels of CDK6 and Cyclin E1 were significantly decreased to 68.33% and 72.41%, respectively (P < 0.01), when compared to the control group. Cyclin D1 and CDK4 mRNA levels did not show any major changes in comparison with the control group. These results showed that the cells transitioning from the G1 to S phase after treatment with AVAP I were fewer
than those in the control group. In contrast, AVAP I enhanced the mRNA levels of CDK1 and Cyclin F to 1.12 and 1.17-fold, respectively (P < 0.05). These results suggested that after the treatment with AVAP I, more cells were transitioning from G2 to M phase in comparison with the control group. Therefore, the results indicated that AVAP I accelerates the cell cycle by regulating the expression of the cell cycle relative genes.
4. Discussion In the present study, we isolated three polysaccharides (AAP, AVAP I and AVAP II) from the abalone H. discus hannai Ino. The composition analysis of the polysaccharides revealed that all three were sulphated, and their sulphate contents were 21.5%, 15.2% and 20.9% for AAP, AVAP I and AVAP II, respectively. The monosaccharide composition of AVAP I and AVAP II was similar and primarily composed of Rha, GlcA and Gal, but the composition of AAP was different, containing GlcA, GalN, Fuc and Gal. Wu et al. recently isolated a sulphated heterosaccharide Hal-B from Haliotis diversicolor Reeve, and discovered that it was primarily composed of Gal and Glc with minor amounts of Xyl, Fuc and GlcA [24]. The composition of these polysaccharides was also different from the glycosaminoglycans from other molluscs, such as Pinctada martensis [25]. Together, these results indicate that the composition of polysaccharides is significantly different in different molluscs and even among the different species of abalone. Very few studies have reported the cytoproliferative effects of marine sulphated polysaccharides. Go et al. found that polysaccharides from Capsosiphon fulvescens could stimulate the growth of IEC-6 cells [12]. Zhang et al. isolated and purified the sulphated polysaccharide from the sea cucumber Stichopus japonicus and found that it stimulated the proliferation of neural stem/progenitor cells [26]. Hatanaka et al. found that a synthetic sulphated polysaccharide could stimulate 3T3-L1 cell proliferation and that the degree of sulphation was an important factor in this process [27]. Our results showed that AVAP I exhibited the strongest proliferation enhancement, but the sulphate content was 15.2%, which was less than those of AAP and AVAP II and suggests that the sulphate content is not the major factor that affects the cell proliferation in this study. In our study, the prominent feature of the three polysaccharides from abalone was their monosaccharide composition. All three polysaccharides were rich in Rha. A recent review summarised that rhamnose-rich oligo- and polysaccharides could stimulate the proliferation of skin fibroblasts and corneal keratocytes and the biosynthesis of collagen [28,29]. Our results showed that AAP,
Table 2 The composition of the polysaccharides AAP, AVAP I and AVAP II isolated from the abalone. Samples
Rha
GlcN
GalN
GlcA
Gal
Man
Xyl
Fuc
Sulphate (%)
Protein (%)
AAP AVAP I AVAP II
0.31 6.40 3.69
0.28 – –
2.14 – –
2.37 3.69 2.04
1.0 1.0 1.0
– 0.37 0.41
0.09 0.39 0.22
2.94 0.23 0.4
21.5 15.2 20.9
1.11 4.44 4.12
358
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
Fig. 3. The effect of AVAP I, Oli-AVAP I and Rha on HepG2 cell viability. HepG2 cells were incubated with different concentrations of AVAP I, Oli-AVAP I and Rha (A–C) for 24 and 48 h, and the cell viability was measured by the MTT assay. Data represent the mean ± S.D. of three independent experiments. *P < 0.05, **P < 0.01, compared to the control group.
which contained the least amount of Rha among the three abalone polysaccharides, did not stimulate proliferation. However, AVAP I contained the highest quantity of Rha and exhibited the strongest proliferation effect, which was 1.9-fold greater than AVAP II. However, when we surveyed the activity of Rha on HepG2 cells, we found that Rha had no effect on HepG2 cell proliferation. This result suggested that rhamnose-rich polysaccharides could stimulate cell proliferation, but the active unit was not the monosaccharide. Previous studies found that rhamnose-rich oligo- and polysaccharides could stimulate cell proliferation and collagen biosynthesis, which might be triggered by the mediation of a specific ␣-l-rhamnose recognizing lectin-site as a receptor, transmitting signals to the cellinterior [30], but more studies should be pursued to uncover this
enigma. Next, we degraded the AVAP I and obtained the oligosaccharide Oli-AVAP I, which was a mixture of dp4–dp5 oligomers. The main composition was 2Rha–2GlcA–2SO3 . We discovered that Oli-AVAP I also stimulated proliferation, but the effect was weaker than it was with AVAP I. Therefore, the active component was not yet clear, and further research was needed. The cell cycle is the series of events that take place in a cell to allow division and duplication. Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs) [13]. Cyclin D binds to CDK4/6, and Cyclin E binds to CDK2, playing a central role in cell cycle progression by promoting the G1/S cell cycle transition [31–33]. From the EdU proliferation assay results, the EdU-positive cells were significantly increased by AVAP I treatment. Therefore,
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
359
Fig. 4. The effects of AVAP I on the proliferation of HepG2 cells by the EdU assay. HepG2 cells were incubated with different concentration of AVAP I (100 and 200 g/mL) for 48 h. (A) Proliferating HepG2 cells were labelled with EdU. The Click-it reaction revealed EdU staining (red); cell nuclei were stained with Hoechst 33342 (blue). The images are representative of the results obtained. (B) The percentage of EdU-positive HepG2 cells was quantified. *P < 0.05, **P < 0.01, compared to the control group. (For interpretation of the references to color in text, the reader is referred to the web version of this article.)
we assumed that AVAP I could regulate the cell cycle progression. To investigate the mechanism underlying the proliferation effect of AVAP I on HepG2 cells, we checked the genes that are closely related with the cell cycle. Compared with the control group, AVAP I could down-regulate the mRNA levels of CDK6 and Cyclin E1 and upregulate Cyclin B1, CDK1 and Cyclin F. The results clearly showed that AVAP I could accelerate the cell cycle and promote HepG2 cell proliferation, which underlines the importance of AVAP I in these processes. Recently, mammalian cell cultures have been applied to many fields. Various cell types, including skin and lymphocytes, are cultured ex vivo for regenerative medicine and cell therapy [7]. A variety of mammalian cells are industrially cultured to produce biomaterials such as proteins and gene therapy vectors [34]. Most mammalian cells require serum or its replacement in the culture
medium during. The sera used most frequently are foetal bovine serum (FBS) and calf serum, and they are frequently contaminated with viruses; even the risk of contamination with prions or bovine spongiform encephalopathy (BSE) cannot be erased [8]. Therefore, reducing the amount of serum in the media or other alternatives for supplementing the culture media is highly desired. We found that on reduction of the serum concentration in the culture media, the cell proliferation was negatively affected. Surprisingly, we found that the addition of AVAP I could partially restore proliferation. A concentration of 10 g/mL AVAP I significantly enhanced cell proliferation; cell viability was also similar to that of the control group, indicating that a portion of the serum could be substituted by AVAP I. These results suggested that AVAP I could be a potent and effective supplement for cell culture. However, more in-depth studies are required to conclude whether it can be applied to other
360
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361
Fig. 5. The effects of AVAP I on HepG2 cell proliferation in different conditions. (A) In a gradient of descending serum (8%, 6% and 4%) concentrations, HepG2 cells were pre-treated with different concentrations of AVAP I (50 and 200 g/mL) for 48 h. # P < 0.05, compared to the control group, *P < 0.05, **P < 0.01, compared to the same serum content without AVAP I group. (B) In the absence of serum (serum content only 2%), HepG2 cells were treated with different concentrations of AVAP I (10, 20 and 50 g/mL) for 24 h and 48 h. The cell viability was measured by the MTT assay. # P < 0.05, compared to the control group, *P < 0.05, compared to 2% serum content without AVAP I group. The data from three independent examinations are presented.
mammalian cells and whether it can completely replace the serum in culture media. In conclusion, the present study indicates that AVAP I isolated from abalone could promote HepG2 cell proliferation by accelerating the cell cycle. The oligomer of AVAP I (2Rha–2GlcA–2SO3 ) retained this proliferative effect, but Rha, the main monosaccharide component of AVAP I and Oli-AVAP I, could not promote proliferation. This finding also suggests that AVAP I could be a preferable culture medium supplement for stimulating the proliferation of mammalian cells.
Acknowledgments This study was supported by the National Marine Public Welfare Scientific Research Project of China (No. 201105029) and the Programme for Changjiang Scholars and Innovative Research Team in University (IRT1188). Fig. 6. The effect of AVAP I on the proliferation of HepG2 cells according to cell cycle pathway genes. The mRNA expression of Cyclin B1, CDK1, Cyclin F, Cyclin D1, CDK4, CDK6, Cyclin E1 and -actin were measured by quantitative RT-PCR. Data normalisation was accomplished using the endogenous reference -actin. Values are the mean ± S.D. *P < 0.05, **P < 0.01, versus control group.
References [1] B.W. Zhu, D.M. Li, D.Y. Zhou, S. Han, J.F. Yang, W.X. Ye, G.H. Greeley, Food Chemistry 125 (2011) 1273–1278.
Y.-M. Wang et al. / International Journal of Biological Macromolecules 66 (2014) 354–361 [2] C. Yoneda, M.N. Ahsana, M. Nakaya, Y. Matsubara, T. Ebihara, S. Irie, Y. Uno, K. Hatae, S. Watabe, Comparative Biochemistry and Physiology Part B 126 (2000) 59–68. [3] D.Y. Zhou, L. Tong, B.W. Zhu, H.T. Wu, L. Qin, H. Tan, Y. Murata, Journal of Food Processing and Preservation 36 (2012) 126–132. [4] B.W. Zhu, L.S. Wang, D.Y. Zhou, D.M. Li, L.M. Sun, J.F. Yang, H.T. Wu, X.Q. Zhou, M. Tada, European Food Research and Technology 227 (2008) 1663– 1668. [5] B.W. Zhu, D.Y. Zhou, T. Li, S. Yan, J.F. Yang, D.M. Li, Food Chemistry 121 (2010) 3712–3718. [6] B.W. Zhu, D.Y. Zhou, J.F. Yang, D.M. Li, H.L. Yin, M. Tada, European Food Research and Technology 228 (2009) 591–595. [7] T. Toyosawa, M. Sasaki, Y. Kato, H. Yamada, S. Terada, Cell Technology for Cell Products 3 (2007) 225–231. [8] S. Terada, T. Nishimura, M. Sasaki, H. Yamada, M. Miki Sercin, Cytotechnology 40 (2002) 3–12. [9] A. Ogawa, S. Terada, T. Kanayama, M. Miki, M. Morikawa, T. Kimura, A. Yamaguchi, M. Sasaki, H. Yamada, Journal of Bioscience and Bioengineering 98 (2004) 217–219. [10] S. Terada, T. Kumagai, A. Ogawa, J. Ishimura, M. Miki, K. Ozaki, M. Sasaki, H. Yamada, Low Temperature Medicine 29 (2003) 1–5. [11] M. Sasaki, Y. Kato, H. Yamada, S. Terada, Biotechnology and Applied Biochemistry 42 (2005) 183–188. [12] H. Go, H.J. Hwang, T.J. Nam, Marine Biotechnology 13 (2011) 433–440. [13] M. Loog, D.O. Morgan, Nature 434 (2005) 104–108. [14] D. Resnitzky, S.I. Reed, Molecular and Cellular Biology 15 (1995) 3463–3469. [15] X.H. Sheng, N.N. Zhang, S.L. Song, M. Li, H. Liang, Y.J. Zhang, Y.S. Wang, A. Ji, Neuroscience Letters 503 (2011) 37–42. [16] S.W. Shen, H.Y. Song, Acta Physiologica Sinica 61 (2009) 431–438.
361
[17] G.Y. Li, S.G. Chen, Y.M. Wang, Y. Xue, Y.G. Chang, Z.J. Li, J.F. Wang, C.H. Xue, International Journal of Biological Macromolecules 49 (2011) 1160–1166. [18] M. Dubois, K.A. Gilles, J.K. Hamilton, P.A. Rebers, F. Smith, Analytical Chemistry 28 (1956) 350–356. [19] O.H. Lowry, N.J. Roseerbrough, A.L. Farr, R.J. Randall, Journal of Biological Chemistry 1953 (1951) 265–275. [20] S.I. Ohira, K. Toda, Journal of Chromatography A 1121 (2006) 280–284. [21] D.J. Strydom, Journal of Chromatography A 678 (1994) 17–23. [22] L. Du, Z.J. Li, J. Xu, J.F. Wang, Y. Xue, C.H. Xue, K. Takahashi, Y.M. Wang, Journal of Oleo Science 61 (2012) 321–330. [23] Z.Q. Huang, X.L. Chen, B. Yu, J. He, D.W. Chen, Biochemical and Biophysical Research Communications 423 (2012) 265–269. [24] Y.W. Wu, Z.G. She, G.P. Hu, Y.C. Lin, Acta Scientiarum Naturalium Universitatis Sunyatseni 41 (2002) 119–120. [25] N. Volpi, F. Maccari, Biomacromolecules 6 (2005) 3174–3180. [26] Y.J. Zhang, S.L. Song, D. Song, H. Liang, W.L. Wang, A.G. Ji, Journal of Bioscience and Bioengineering 109 (2010) 67–72. [27] M. Kunou, K. Hatanaka, Carbohydrate Polymers 28 (1995) 107–112. [28] V. Ravelojaona, A.M. Robert, L. Robert, G. Renard, Pathologie Biologie 56 (2008) 66–69. [29] G. Faury, E. Ruszova, J. Molinari, B. Mariko, S. Raveaud, V. Velebny, L. Robert, Biochimica et Biophysica Acta 1780 (2008) 1388–1394. [30] E. Andres, J. Molinari, G. Peterszegi, B. Mariko, E. Ruszova, V. Velebny, G. Faury, L. Robert, Pathologie Biologie 54 (2006) 420–425. [31] Y. Xiong, H. Zhang, D. Beach, Cell 71 (1992) 505–514. [32] V. Dulic, E. Lees, S.I. Reed, Science 257 (1992) 1958–1961. [33] J.M. Trimarchi, J.A. Lees, Nature Reviews Molecular Cell Biology 3 (2002) 11–20. [34] S. Terada, N. Takada, K. Itoh, T. Saitoh, M. Sasaki, H. Yamada, Cell Technology for Cell Products 3 (2007) 397–401.
