Cell Biochem Biophys (2015) 71:803–811 DOI 10.1007/s12013-014-0266-0
ORIGINAL PAPER
Effects of Triterpenoid From Schisandra chinensis on Oxidative Stress in Alcohol-Induced Liver Injury in Rats Bin Li • Lijie Zhu • Ting Wu • Jiachen Zhang Xinyao Jiao • Xiuying Liu • Yanqun Wang • Xianjun Meng
•
Published online: 28 September 2014 Ó Springer Science+Business Media New York 2014
Abstract Alcohol-induced oxidative stress plays a crucial role in the pathological development of alcoholic liver disease. The aim of this study was to investigate the effects of triterpenoid from Schisandra chinensis on oxidative stress in alcohol-induced liver injury in rats. We found that the administration of triterpenoid attenuated alcoholinduced oxidative stress in multiple organs including liver. Moreover, the impaired liver function and histological changes resulted from alcohol consumption was improved by triterpenoid treatment. Finally, we found that pretreatment with triterpenoid from Schisandra chinensis to alcohol-fed rats increased the expression level of haem oxygenase-1 (HO-1) while inhibited the induction of cytochrome P-450 2E1 (CYP2E1) in liver microsomes. Further assays revealed that the microsomal activity of HO-1 was accordingly induced whereas CYP2E1 was suppressed in rats received triterpenoid intervention. Our findings suggest that triterpenoid from Schisandra chinensis may protect against alcohol-induced liver injury through ameliorating oxidative stress in rats. Keywords Triterpenoid Schisandra chinensis Oxidative stress Alcohol Microsome
Bin Li and Lijie Zhu have contributed equally to this study.
Electronic supplementary material The online version of this article (doi:10.1007/s12013-014-0266-0) contains supplementary material, which is available to authorized users. B. Li L. Zhu T. Wu J. Zhang X. Jiao X. Liu Y. Wang X. Meng (&) College of Food Science, Shenyang Agricultural University, 120 Dongling Road, Shenyang 110866, People’s Republic of China e-mail: [email protected]
Introduction It has been shown that chronic and excessive consumption of alcohol beverages results in alcoholic liver disease (ALD) [1, 2]. This disease is one of the leading causes of alcohol-related death in developed countries [3]. The incidence of ALD in China increases from 2.7 % at 2000 to 4.4 % at 2004 among hospitalized patients with liver diseases [4]. ALD is characterized by the progressive liver damage which leads to inflammation, steatosis, steatohepatitis, necrosis, and finally fibrosis and cirrhosis [5–7]. Although the pathological mechanisms underlying alcoholinduced liver injury still remain largely unknown, oxidative stress has been considered to play a crucial role in the pathogenesis of alcoholic liver damage [8–10]. Oxidative stress usually results from the imbalance between the excessive formation of reactive oxygen species (ROS) and the limited antioxidant capacity [11, 12]. It has been known that the excessive intake of alcohol administration significantly enhances the production of ROS and reduces the level or activity of antioxidants, such as superoxide dismutase (SOD) and haem oxygenase-1 (HO-1) [10, 13]. Liver is the main organ responsible for the metabolizing of alcohol and the hepatic microsomes are considered to be the main source of ROS generation [13, 14]. Chronic alcohol exposure has been demonstrated to stimulate the production of microsomal ROS as a result of the induction of cytochrome P-450 2E1 (CYP2E1) [15]. Excessive ROS generated during the process of alcohol metabolism causes cell membranes damage, inflammation as well as cell death [10, 16–18]. Schisandra chinensis is a traditional Chinese herb which has been broadly used in the Asian-Pacific region [19, 20]. The extracts of Schisandra chinensis have been revealed to possess multi-pharmaceutical activities, including
123
804
anti-inflammatory, anti-tumor, and antioxidant effects [21– 24]. Schisandra chinensis has been shown to prevent lipid peroxidation and oxidative stress in rats subjected to heat environmental stress [25]. The pollen extracts of Schisandra chinensis exhibit antioxidant effect on CCl4-induced acute liver damage in mice [26]. In addition, Schisandra chinensis has been reported to exert protective effects on liver diseases. Park and colleagues showed that Schisandra chinensis prevents alcohol-induced fatty liver disease in rats [27]. Another report found that gomisin A isolated from Schisandra chinensis protects against CCl4-induced hepatic injury [28]. Moreover, the fruit extracts of Schisandra chinensis has been shown to improve the liver function in humans [29]. In the present study, we investigated the effects of triterpene compounds extracted from Schisandra chinensis on alcohol-induced liver injury in rats. The content of reduced glutathione (GSH) and malondialdehyde (MDA), and the activity of SOD were evaluated to determine the effects of triterpenoid on the oxidative stress in rats exposed to alcohol. The expression level and activity of microsomal CYP2E1 and HO-1 were measured to reveal the molecular mechanisms of triterpenoid from Schisandra chinensis on alcohol-induced oxidative stress in rats. Materials and Methods Animals and Treatments Animals used in this study were male Sprague-Dawley (SD) rats, 8-week-old. All rats were allowed free access to water and food and kept at 25 °C with 12 h dark/light cycle. The procedure of the animal study was approved by the Ethics Committee of Shenyang Agricultural University. SD rats (n = 70) were allocated into the following seven groups by a random method. Group 1 (n = 10), rats were given normal saline at the volume of 1 mL/100 g body weight (b.w.) twice a day with 1 h interval. Animals in Group 2 (n = 10) were treated with saline (1 mL/100 g b.w.) by oral gavage and then administrated with alcohol (10 %, v/v) at the dose of 0.8 g/kg b.w. 1 h later. For Group 3 (n = 10), rats received saline (1 mL/100 g b.w.) 1 h before an exposure to 1.6 g/kg b.w. alcohol (20 %, v/v). Group 4 (n = 10), rats were treated with saline and then administrated with alcohol (30 %, v/v; 2.4 g/kg b.w.). Rats in Group 5 (n = 10) received 48 mg/kg b.w. triterpene compounds isolated from Schisandra chinensis 1 h prior to the exposure of alcohol (30 %, v/v; 2.4 g/kg b.w.). Group 6 (n = 10) was treated as described for Group 5 except the dose of triterpene compounds was increased (96 mg/kg b.w.). Rats treated with triterpene compounds
123
Cell Biochem Biophys (2015) 71:803–811
(96 mg/kg b.w.) alone were assigned as Group 7 (n = 10). All animals were subjected to the described treatment for 90 days. Blood was gained from the eyeballs of rats at 30 and 60 days. All rats were sacrificed at the end of the experiment. Blood samples were collected from the inferior vena cava at 90 days. Liver, heart, and kidney were obtained from various groups and immediately freezed in liquid nitrogen. The liver tissue was fixed in 4 % paraformaldehyde. Measurements of the Level of Reduced Glutathione and Malondialdehyde and, the Activity of Superoxide Dismutase in Serum and Multiple Organs To measure the level of GSH and MDA and the activity of SOD in serum, the blood samples were collected either from the eyeballs of rats at 30 and 60 days or from the inferior vena cava at 90 days. The content of reduced GSH and MDA and the activity of SOD in serum were determined by commercially purchased kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China) following the recommended protocols. Liver, heart, and kidney organs were separated from rats and homogenized with 9 volumes of ice-cold phosphate buffer saline (PBS). After centrifugation at 12,000 rpm, 4 °C for 10 min, the supernatants were obtained and subjected to evaluate the level of reduced GSH and MDA, and SOD activity in these organs with kits bought from Nanjing Jiancheng Bioengineering Research Institute. Liver Function Test Liver function was evaluated by determining the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum. ALT/GPT assay kit (Nanjing Jiancheng Bioengineering Research Institute) and AST/GOT assay kit (Nanjing Jiancheng Bioengineering Research Institute) were used to measure the activity of ALT and AST in serum, respectively. Hematoxylin and Eosin (H&E) Staining Liver samples were harvested and fixed in 4 % paraformaldehyde. H&E staining was performed using the routine histological protocol. Five-micrometer sections were prepared after the liver tissues were embedded in paraffin. All sections were stained with H&E solution to evaluate fatty or inflammatory cell infiltrations in the harvested liver samples. H&E staining was observed under an OLYMPUS DP71 microscope with a 200 9 magnification.
Cell Biochem Biophys (2015) 71:803–811
805
Preparation of Liver Microsomes
Measurement of the Enzymatic Activity in Microsomes
Microsome preparation was conducted as previously described [13]. Liver samples were homogenized in icecold buffer (0.01 M Tris–HCl, pH 7.4, 0.1 M EDTA, 0.01 M Sucrose, and 0.05 mM PMSF) and subsequently centrifuged at 12,000 rpm, 4 °C for 10 min. The supernatant was then centrifuged at 30,000 rpm, 4 °C for 60 min. The obtained pellet was dissolved in buffer (0.01 M Tris–HCl, pH 7.4, 0.1 M EDTA, 0.01 M Sucrose, and 0.05 mM PMSF) and then centrifuged at 30,000 rpm, 4 °C for 20 min. The pellet was subjected to the same centrifugation twice. The resultant microsomal pellet was washed twice and resuspended in PBS containing 1 % PMSF.
Liver samples were collected and the liver microsomes were prepared as described. The enzymatic activity of microsomal HO-1 and CYP2E1 was determined by commercial available ELISA kits according to the recommended protocols.
Real-Time qPCR Total RNA was purified from rat liver tissues with RNAprep pure Tissue Kit (TIANGEN BIOTECH CO., LTD., Beijing, China) following the manufacturer’s protocol. One-micogram purified RNA was used to synthesize the complementary DNA (cDNA). PCR reaction was carried out in a 20 lL reaction mixture on ExicyclerTM 96 RealTime Quantitative Thermal Block (Bioneer, Daejeon, Korea). The following sequences are primers used in this study. HO-1, CTGGAATGGAAGGAGATGCC and TCA GAACAGCCGCCTCTACCG; CYP2E1, CGTGGTCCTG CATGGCTACA and CCCAGTCTCGGAGAATGCT TAG; b-actin, GAGATTACTGCCCTGGCTCCTAGC and GGCCGGACTCATCGTACTCCTGCTT. The obtained data were analyzed using the comparative threshold cycle (CT) method. Western Blotting Assay Proteins were separated by 10 % SDS-PAGE and then transferred electronically to polyvinylidene fluoride (PVDF; Millipore, Bedford, MA, US) membranes. Primary anti-HO-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; dilution at 1:150) and anti-CYP2E1 (Wanlei Life Science, Shenyang, China; dilution at 1:150) antibodies were incubated with the membranes after blocking in 5 % non-fat dried milk. Then, horseradish peroxidase (HRP)conjugated goat-anti-rabbit IgG (Beyotime Institute of Biotechnology, Haimen, China; dilution at 1:5,000) was added and the membranes were developed with an ECL plus chemiluminescence kit (Qihaifutai Technology Co., Ltd., Shanghai, China). Membrane incubated with a mouse anti-b-actin-HRP antibody (KangChen Biotech, Shanghai, China; dilution at 1:10,000) was used as an internal control.
Statistical Analysis The statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA). All results were expressed as mean ± SD. Data were analyzed by one-way ANOVA followed by Bonferroni test. A p value of less than 0.05 was considered statistically significant.
Results Triterpene Compounds Isolated From Schisandra chinensis Attenuates Oxidative Stress of Rats Treated with Alcohol Rats were exposed to different concentration of alcohol as described in the Methods. Low and high dose of triterpene compounds isolated from Schisandra chinensis were administrated by oral gavage to alcohol-treated rats. To investigate the effects of the extracted triterpenoid on alcohol-induced oxidative stress, the content of reduced GSH and MDA, and the activity of SOD in serum samples collected at 30, 60, and 90 days after exposure to alcohol were determined. We found that both the level of reduced GSH and the activity of the antioxidant enzyme SOD in serum were significantly reduced in alcohol-treated rats in a dose-dependent manner (Supplemental Fig. 1). The extent of MDA formation, which is a marker of lipid peroxidation, was increased remarkably in serum of rats treated with alcohol (Supplemental Fig. 1). However, these alternations were restored by the administration of low or high dose of triterpene compounds isolated from Schisandra chinensis (Supplemental Fig. 1). To further explore the effects of triterpenoid on oxidative stress in different organs, heart, liver, and kidney samples were harvested when rats were sacrificed after 90 days exposure to alcohol. As shown in Fig. 1, the level of reduced GSH (Fig. 1a–c) and the activity of SOD (Fig. 1g–i) in the above mentioned organs were dramatically dropped in alcohol-treated rats. In contrast, triterpenoid administration greatly increased the content of reduced GSH (Fig. 1a–c) and improved the activity of SOD (Fig. 1g–i). Moreover, the alcohol-induced MDA formation was significantly inhibited by triterpenoid (Fig. 1d–f). The content of GSH and MDA and the activity of SOD in serum samples
123
806
Cell Biochem Biophys (2015) 71:803–811
Fig. 1 Effects of triterpene compounds isolated from Schisandra chinensis on lipid peroxidation and antioxidant enzyme activity in multiple organs of rats exposed to alcohol. Heart, kidney, and liver were obtained after rats were administrated with different doses of alcohol for 90 days. The levels of reduced GSH (a–c), MDA (d–f), and the activity of SOD (g–i) in these organs were measured by
commercial kits, respectively. Rats were randomly divided into the following groups: 1, normal control; 2, alcohol (10 %, 0.8 g/kg b.w.); 3, alcohol (20 %, 1.6 g/kg b.w.); 4, alcohol (30 %, 2.4 g/kg b.w.); 5, alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (48 g/kg b.w.); 6, alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (96 g/kg b.w.); 7, triterpene compounds (96 g/kg b.w.)
from rats received only triterpenoid were similar to that from normal control rats (Fig. 1). These findings show that the triterpene compounds obtained from Schisandra chinensis alleviates alcohol-induced oxidative stress in rats.
(Fig. 2a and b, p \ 0.001). However, the treatment with triterpenoid significantly reduced the levels of ALT and AST, particularly in a high dose (Fig. 2a and b, p \ 0.05 and p \ 0.001). The administration of triterpenoid alone did not affect ALT and AST levels in serum, which served as control.
Effects of Triterpene Compounds Extract From Schisandra chinensis on Liver Function Since liver is the major organ which is responsible for the metabolism of alcohol intake, it is more susceptible to alcohol-induced injury than other organs [30]. Therefore, we asked whether the triterpene compounds isolated from Schisandra chinensis could exert positive effects on liver function. To address this, the liver function assay was performed through measuring the levels of ALT and AST in serum. In accordance with previous reports, the serum levels of both enzymes were extensively increased in rats exposed to alcohol, suggesting the liver function injury
123
Triterpene Compounds Isolated From Schisandra chinensis Ameliorate the Pathologic Changes of Liver Injury Induced by Alcohol Next, we evaluated the effects of the extracted triterpenoid on the histological alteration of alcohol-induced liver injury. H&E staining results showed that normal control rat exhibited regular lobular architecture which consisted of central veins and radiating hepatic cords in the liver tissue (Fig. 3a). However, liver samples separated from alcoholtreated rats displayed abnormal lobular architecture with
Cell Biochem Biophys (2015) 71:803–811
807
severe steatosis and abundant infiltrated inflammatory cells (Fig. 3b–d). While the introduction of low dose of the triterpene compounds isolated from Schisandra chinensis did not show an obvious effect on the morphology of alcohol-induced liver, the administration of high dose of the extracted triterpenoid restored most of these pathological changes (Fig. 3e–f). The treatment with high dose of triterpenoid alone was used as control (Fig. 3g). Effects of Triterpene Compounds Purified From Schisandra chinensis on the mRNA and Protein Expression Levels of HO-1 and CYP2E1 in Rat Liver Microsomes
Fig. 2 Effects of triterpene compounds isolated from Schisandra chinensis on liver function. The serum level of ALT (a) and AST (b) was determined. Groups were assigned as described in Fig. 1. Values are expressed as mean ± SD (n = 10). *p \ 0.05 and *** p \ 0.001
Fig. 3 Triterpene compounds extracted from Schisandra chinensis improve the pathologic changes of alcohol-induced liver injury. Livers collected from normal control (a), alcohol (10 %, 0.8 g/kg b.w.) (b), alcohol (20 %, 1.6 g/kg b.w.) (c), alcohol (30 %, 2.4 g/kg
To explore the molecular mechanism of the protective effect of triterpenoid against alcohol-induced oxidative stress, we investigated the expression levels of HO-1 and CYP2E1 in rat liver microsomes which are the main source of ROS and thus susceptible to ROS attack [13]. As revealed by real-time PCR and Western blot assay, the mRNA and protein expression levels of microsomal HO-1 were extensively reduced when rats exposed to alcohol as compared with control rats (Fig. 4a and c, p \ 0.001). Consistent with prior reports, microsomal CYP2E1 was significantly induced at both mRNA and protein level when rats treated with alcohol (Fig. 4b and d, p \ 0.001). The administration of triterpene compounds purified from Schisandra chinensis, however, remarkably restored the expression pattern of HO-1 and ameliorated the induction
b.w.) (d), alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (48 g/kg b.w.) (e), alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (96 g/kg b.w.) (f), and triterpene compounds (96 g/kg b.w.) (g) groups were subjected to H&E staining. Bars a–g were 100 lm
123
808
Cell Biochem Biophys (2015) 71:803–811
Fig. 4 Effects of triterpene compounds isolated from Schisandra chinensis on the expression levels of rat liver microsomal HO-1 and CYP2E1. The mRNA levels of HO-1 (a) and CYP2E1 (b) were evaluated by real-time qPCR. Western blotting and the subsequent
densitometric analysis were conducted to determine the protein levels of HO-1 (c) and CYP2E1 (d) in liver microsomes. Groups were the same as illustrated in Fig. 1. Values are mean ± SD (n = 10). ** p \ 0.01 and ***p \ 0.001
of CYP2E1 in microsomes, particularly for high dose of triterpenoid (Fig. 4, p \ 0.01 and p \ 0.001). Neither HO1 nor CYP2E1 expression were affected by treatment with triterpenoid alone (Fig. 4).
treated rats relative to normal rats (Fig. 5b, p \ 0.001). In contrast, the enzymatic activity of microsomal CYP2E1 was decreased by nearly 57 % when rats were presupplemented with high dose of triterpenoid following alcohol treatment (Fig. 5b, p \ 0.001). Notably, the activity of CYP2E1 in liver microsomes obtained from alcohol-treated was still higher than those from normal control.
Effects of Triterpene Compounds Purified From Schisandra chinensis on the Activity of Rat Liver Microsomal HO-1 and CYP2E1 The enzymatic activity of HO-1 and CYP2E1 in microsomes was further evaluated. We found that the activity of microsomal HO-1 was dramatically reduced when challenged with alcohol, with 65 % reduction in rats treated with high concentration of alcohol (Fig. 5a, p \ 0.001). This number was reduced to only 14 % when high dose of the purified triterpenoid was provided, indicating significant restoration of this antioxidant enzyme (Fig. 5a, p \ 0.001). Additionally, chronic alcohol consumption triggered the activation of CYP2E1 whose activity was increased by 5.88-fold in high concentration alcohol-
123
Discussion Alcohol-induced liver disease, which is characterized by a pathological process with progressive liver damage leading to fibrosis and cirrhosis, is a major cause of chronic liver disease worldwide [7, 31]. The enhanced oxidative stress induced by excessive alcohol consumption causes damage to cell membranes directly and eventually results in hepatic tissue injury [10, 16]. In the current study, we found that the triterpene compounds isolated from Schisandra chinensis reduced oxidative stress in multi-organs of rats
Cell Biochem Biophys (2015) 71:803–811
Fig. 5 Triterpene compounds extracted from Schisandra chinensis differently regulate the enzymatic activity of HO-1 and CYP2E1 in rat liver microsomes. ELISA kits were used to measure the enzymatic activity of HO-1 and CYP2E1 in liver microsomes obtained rats in different groups. Groups were assigned as stated in Fig. 1. Values are mean ± SD (n = 10). **p \ 0.01 and ***p \ 0.001
exposed to alcohol. The impaired liver function and morphologic changes caused by alcohol exposure was improved after triterpenoid treatment. Furthermore, the administration of triterpene compounds purified from Schisandra chinensis increased the expression level of HO1 and inhibited the induction of CYP2E1 in liver microsomes. In accordingly, we observed that the microsomal activity of HO-1 was induced whereas the activity of CYP2E1 was suppressed in rats treated with triterpenoid following alcohol administration. As a traditional Chinese medicine, Schisandra chinensis has been proved to exhibit various active effects, such as anti-inflammatory, detoxificant, and anti-carcinogenic effects [24, 32, 33]. Previous reports have demonstrated that the extracts of Schisandra chinensis are capable of ameliorating oxidative stress in CCl4-treated mice [26] or in rats subjected to heat stress [25]. More importantly, other groups have shown that Schisandra chinensis exerts protective effects on liver function either in rats or in humans [27–29]. Therefore, it is reasonable to hypothesize that extracts of Schisandra chinensis protect against alcohol-induced liver injury through its antioxidant activity. To test this hypothesis, we first determined whether the
809
administration of triterpene compounds isolated from Schisandra chinensis could attenuate alcohol-induced oxidative stress in rat organs. The evaluation of oxidative stress was conducted by measuring the content and level of oxidative stress markers, including the content of reduced GSH and MDA, and the activity of SOD [34]. Our data showed that oxidative stress was alleviated in heart, kidney, and liver collected from rats treated with triterpenoid following alcohol exposure. As liver is the main organ responsible for the metabolism of consumed alcohol and thus is more susceptible to alcohol-induced damage [30], the effects of triterpene compounds purified from Schisandra chinensis on liver function were analyzed. Liver function was evaluated by measuring the level of serum ALT and AST. The morphological changes were assessed by H&E staining. In line with a prior study [26], we observed that triterpenoid from Schisandra chinensis prevented the increase of ALT and AST levels in serum. Additionally, the pathological changes of liver tissue induced by alcohol exposure were ameliorated when triterpene compounds isolated from Schisandra chinensis were administrated, especially in a high dose. These data suggested that triterpenoid from Schisandra chinensis protected against alcohol-induced liver injury at least partially through its antioxidant activity. It should be noted that other pharmaceutical activities of Schisandra chinensis, such as anti-inflammatory and detoxificant activities, may also contribute to the hepatoprotective effect of Schisandra chinensis extracts [22, 26]. It has been suggested that the hepatic microsomes are the main source of ROS generation and thus they are susceptible to ROS-induced damage [13, 14]. Alcohol is metabolized by three pathways which utilize alcohol dehydrogenase, the microsomal ethanol oxidative system (MEOS) and catalase, respectively [35]. MEOS, characterized by CYP2E1, is viewed as the main site of ROS overproduction during alcohol metabolism. Previous studies have demonstrated that microsomal CYP2E1 is substantially induced by alcohol treatment [13, 30]. In the present study, we found that chronic alcohol administration to rats resulted in the induction of CYP2E1 at both expression and enzymatic activity levels. Such induction of CYP2E1 was attenuated when rats supplemented with triterpenoid from Schisandra chinensis following alcohol exposure. Interestingly, Su et al. (2013) reported that CYP2E1 enzyme activity was inhibited after treatment with multiple doses of vinegar-processed Schisandra chinensis [36]. Conversely, another group found that multiple dosing of the extracts from Schisandra chinensis significantly induces the activity of CYP2E1 [37]. However, it should be noted that these findings were obtained by using alcoholic extracts of Schisandra chinensis, and it is possible that the alcohol within the extracts of
123
810
Schisandra chinensis partially contributed to the induction of CYP2E1 [37]. HO-1 is a ubiquitous stress-responsive protein which is responsible for catalyzing the cleavage of prooxidative haem into bioactive products including biliverdin/bilirubin, carbon monoxide as well as free iron [38, 39]. It has been suggested that HO-1 plays crucial roles in tissue homeostasis by means of suppressing oxidative stress and keeping cellular integrity [40]. In the present study, chronic alcohol ingestion reduced the expression and activity of HO-1 in hepatic microsomes. However, these alternations were completely reversed after supplement with high dose of triterpenoid from Schisandra chinensis. Our findings were consistent with a previous report in which the authors claimed that a novel a-iso-cubebenol isolated from dried fruits of Schisandra chinensis up-regulated the expression of HO-1 at both mRNA and protein levels [41]. Therefore, the induction of HO-1 by triterpenoid administration may contribute to its beneficial effects on alcohol-induced liver injury. The involvement of other enzymes, for instance, glutathione peroxidase, catalase, and NADPH-P450 reductase, should be investigated in the future study. Acknowledgments This study was supported by Grants from the National Natural Science Foundation of China (No. 31201325), the Doctoral Startup Foundation of Science and Technology Department of Liaoning Province (No. 20121139), the Liaoning Excellent Talents in University (2014108) and the ‘‘Tian Zhu Shan’’ Excellent Talents of Shenyang Agricultural University (2014).
References 1. Singal, A. K., & Charlton, M. R. (2012). Nutrition in alcoholic liver disease. Clinics in Liver Disease, 16(4), 805–826. 2. Lelbach, W. K. (1966). Liver damage in chronic alcoholism. Results of a clinical, clinical-chemical and bioptic-histological study in 526 alcoholic patients during a low-calorie diet in an open drinking sanatorium. Acta Hepato-splenologica, 13(6), 321–349. 3. O’Shea, R. S., Dasarathy, S., & McCullough, A. J. (2010). Alcoholic Liver Disease. Hepatology, 51(1), 307–328. 4. Fan, J. G. (2013). Epidemiology of alcoholic and nonalcoholic fatty liver disease in China. Journal of Gastroenterology and Hepatology, 28(Suppl 1), 11–17. 5. Daniluk, J., Szuster-Ciesielska, A., Drabko, J., & KandeferSzerszen, M. (2001). Serum cytokine levels in alcohol-related liver cirrhosis. Alcohol, 23(1), 29–34. 6. Isayama, F., Froh, M., Bradford, B. U., McKim, S. E., Kadiiska, M. B., Connor, H. D., et al. (2003). The CYP inhibitor 1-aminobenzotriazole does not prevent oxidative stress associated with alcohol-induced liver injury in rats and mice. Free Radical Biology and Medicine, 35(35), 12–1581. 7. De Minicis, S., & Brenner, D. A. (2008). Oxidative stress in alcoholic liver disease: role of NADPH oxidase complex. Journal of Gastroenterology and Hepatology, 23(Suppl 1), S98–S103. 8. Lindros, K. O. (1995). Alcoholic liver disease: pathobiological aspects. Journal of Hepatology., 23(Suppl 1), 7–15.
123
Cell Biochem Biophys (2015) 71:803–811 9. Balkan, J., Dogru-Abbasoglu, S., Kanbagli, O., Cevikbas, U., Aykac-Toker, G., & Uysal, M. (2001). Taurine has a protective effect against thioacetamide-induced liver cirrhosis by decreasing oxidative stress. Human and Experimental Toxicology, 20(5), 251–254. 10. Cederbaum, A. I., Lu, Y., & Wu, D. (2009). Role of oxidative stress in alcohol-induced liver injury. Archives of Toxicology, 83(6), 519–548. 11. Sharma, R. K., Pasqualotto, F. F., Nelson, D. R., Thomas, A. J, Jr, & Agarwal, A. (1999). The reactive oxygen species-total antioxidant capacity score is a new measure of oxidative stress to predict male infertility. Human Reproduction, 14(11), 2801–2807. 12. Apel, K., & Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology, 55, 373–399. 13. Tang, Y., Gao, C., Xing, M., Li, Y., Zhu, L., Wang, D., et al. (2012). Quercetin prevents ethanol-induced dyslipidemia and mitochondrial oxidative damage. Food and Chemical Toxicology, 50(5), 1194–1200. 14. Wang, Y., Millonig, G., Nair, J., Patsenker, E., Stickel, F., Mueller, S., et al. (2009). Ethanol-induced cytochrome P4502E1 causes carcinogenic etheno-DNA lesions in alcoholic liver disease. Hepatology, 50, 453–461. 15. Lu, Y., & Cederbaum, A. I. (2008). CYP2E1 and oxidative liver injury by alcohol. Free Radical Biology and Medicine, 44, 723–738. 16. Bilzer, M., & Gerbes, A. L. (2000). Preservation injury of the liver: mechanisms and novel therapeutic strategies. Journal of Hepatology, 32, 508–515. 17. Jaeschke, H. (2011). Reactive oxygen and mechanisms of inflammatory liver injury: present concepts. Journal of Gastroenterology and Hepatology, 26(Suppl 1), 173–179. 18. Stenger, C., Naves, T., Verdier, M., & Ratinaud, M. H. (2011). The cell death response to the ROS inducer, cobalt chloride, in neuroblastoma cell lines according to p53 status. International Journal of Oncology, 39, 601–609. 19. Lu, Y., & Chen, D. F. (2009). Analysis of Schisandra chinensis and Schisandra sphenanthera. Journal of Chromatography A, 1216, 1980–1990. 20. Panossian, A., & Wikman, G. (2008). Pharmacology of Schisandra chinensis Bail.: an overview of Russian research and uses in medicine. Journal of Ethnopharmacology, 118, 183–212. 21. Dilshara, M. G., Jayasooriya, R. G., Kang, C. H., Lee, S., Park, S. R., Jeong, J. W., et al. (2013). Downregulation of pro-inflammatory mediators by a water extract of Schisandra chinensis (Turcz.) Baill fruit in lipopolysaccharide-stimulated RAW 264.7 macrophage cells. Environmental Toxicology and Pharmacology, 36, 256–264. 22. Liu, G. T. (1989). Pharmacological actions and clinical use of fructus schizandrae. Chinese Medical Journal, 102, 740–749. 23. Guo, L. Y., Hung, T. M., Bae, K. H., Shin, E. M., Zhou, H. Y., Hong, Y. N., et al. (2008). Anti-inflammatory effects of schisandrin isolated from the fruit of Schisandra chinensis Baill. European Journal of Pharmacology, 591, 293–299. 24. Szeto, Y. T., Wong, S. C., Wong, J. W., Kalle, W., & Pak, S. C. (2011). In vitro antioxidation activity and genoprotective effect of selected Chinese medicinal herbs. American Journal of Chinese Medicine, 39, 827–838. 25. Kim, K. J., Yoon, K. Y., Hong, H. D., & Lee, B. Y. (2012). Schisandra chinensis prevents hepatic lipid peroxidation and oxidative stress in rats subjected to heat environmental stress. Phytotherapy Research, 26, 1674–1680. 26. Cheng, N., Ren, N., Gao, H., Lei, X., Zheng, J., & Cao, W. (2013). Antioxidant and hepatoprotective effects of Schisandra
Cell Biochem Biophys (2015) 71:803–811
27.
28.
29.
30.
31.
32.
33.
34.
chinensis pollen extract on CCl4-induced acute liver damage in mice. Food and Chemical Toxicology, 55, 234–240. Park, H. J., Lee, S. J., Song, Y., Jang, S. H., Ko, Y. G., Kang, S. N., et al. (2014). Schisandra chinensis prevents alcohol-induced fatty liver disease in rats. Journal of Medicinal Food, 17, 103–110. Hwang, I. S., Kim, J. E., Lee, Y. J., Kwak, M. H., Choi, Y. H., Kang, B. C., et al. (2013). Protective effects of gomisin A isolated from Schisandra chinensis against CCl(4)-induced hepatic and renal injury. International Journal of Molecular Medicine, 31, 888–898. Chiu, H. F., Chen, T. Y., Tzeng, Y. T., & Wang, C. K. (2013). Improvement of liver function in humans using a mixture of schisandra fruit extract and sesamin. Phytotherapy Research, 27, 368–373. Reddy, V. D., Padmavathi, P., Hymavathi, R., Maturu, P., & Varadacharyulu, N. (2014). Alcohol-induced oxidative stress in rat liver microsomes: protective effect of Emblica officinalis. Pathophysiology, 21, 153–159. Gao, B., & Bataller, R. (2011). Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology, 141, 1572–1585. Liu, C., Zhang, S., & Wu, H. (2009). Non-thermal extraction of effective ingredients from Schisandra chinensis Baill and the antioxidant activity of its extract. Natural Product Research, 23, 1390–1401. Liu, C. J., Zhang, S. Q., Zhang, J. S., Liang, Q., & Li, D. S. (2012). Chemical composition and antioxidant activity of essential oil from berries of Schisandra chinensis (Turcz.) Baill. Natural Product Research, 26, 2199–2203. Ozcan, M. E., Gulec, M., Ozerol, E., Polat, R., & Akyol, O. (2004). Antioxidant enzyme activities and oxidative stress in
811
35.
36.
37.
38.
39.
40.
41.
affective disorders. International Clinical Psychopharmacology, 19, 89–95. Popovic, M., Janicijevic-Hudomal, S., Kaurinovic, B., Rasic, J., & Trivic, S. (2008). Effects of various drugs on alcohol-induced oxidative stress in the liver. Molecules, 13, 2249–2259. Su, T., Mao, C., Yin, F., Yu, Z., Lin, Y., Song, Y., et al. (2013). Effects of unprocessed versus vinegar-processed Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes in rats. Journal of Ethnopharmacology, 146, 734–743. Wang, B. L., Hu, J. P., Sheng, L., & Li, Y. (2011). Effects of Schisandra chinensis (Wuweizi) constituents on the activity of hepatic microsomal CYP450 isozymes in rats detected by using a cocktail probe substrates method. Yao Xue Xue Bao, 46, 922–927. Choi, A. M., & Alam, J. (1996). Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. American Journal of Respiratory Cell and Molecular Biology, 15, 9–19. Morse, D., & Choi, A. M. (2002). Heme oxygenase-1: the ‘‘emerging molecule’’ has arrived. American Journal of Respiratory Cell and Molecular Biology, 27, 8–16. Kim, H. P., Pae, H. O., Back, S. H., Chung, S. W., Woo, J. M., Son, Y., et al. (2011). Heme oxygenase-1 comes back to endoplasmic reticulum. Biochemical and Biophysical Research Communications, 404, 1–5. Park, S. Y., Park da, J., Kim, Y. H., Kim, Y., Kim, S. G., Shon, K. J., et al. (2011). Upregulation of heme oxygenase-1 via PI3 K/ Akt and Nrf-2 signaling pathways mediates the anti-inflammatory activity of Schisandrin in Porphyromonas gingivalis LPS-stimulated macrophages. Immunology Letters, 139, 93–101.
123
ORIGINAL PAPER
Effects of Triterpenoid From Schisandra chinensis on Oxidative Stress in Alcohol-Induced Liver Injury in Rats Bin Li • Lijie Zhu • Ting Wu • Jiachen Zhang Xinyao Jiao • Xiuying Liu • Yanqun Wang • Xianjun Meng
•
Published online: 28 September 2014 Ó Springer Science+Business Media New York 2014
Abstract Alcohol-induced oxidative stress plays a crucial role in the pathological development of alcoholic liver disease. The aim of this study was to investigate the effects of triterpenoid from Schisandra chinensis on oxidative stress in alcohol-induced liver injury in rats. We found that the administration of triterpenoid attenuated alcoholinduced oxidative stress in multiple organs including liver. Moreover, the impaired liver function and histological changes resulted from alcohol consumption was improved by triterpenoid treatment. Finally, we found that pretreatment with triterpenoid from Schisandra chinensis to alcohol-fed rats increased the expression level of haem oxygenase-1 (HO-1) while inhibited the induction of cytochrome P-450 2E1 (CYP2E1) in liver microsomes. Further assays revealed that the microsomal activity of HO-1 was accordingly induced whereas CYP2E1 was suppressed in rats received triterpenoid intervention. Our findings suggest that triterpenoid from Schisandra chinensis may protect against alcohol-induced liver injury through ameliorating oxidative stress in rats. Keywords Triterpenoid Schisandra chinensis Oxidative stress Alcohol Microsome
Bin Li and Lijie Zhu have contributed equally to this study.
Electronic supplementary material The online version of this article (doi:10.1007/s12013-014-0266-0) contains supplementary material, which is available to authorized users. B. Li L. Zhu T. Wu J. Zhang X. Jiao X. Liu Y. Wang X. Meng (&) College of Food Science, Shenyang Agricultural University, 120 Dongling Road, Shenyang 110866, People’s Republic of China e-mail: [email protected]
Introduction It has been shown that chronic and excessive consumption of alcohol beverages results in alcoholic liver disease (ALD) [1, 2]. This disease is one of the leading causes of alcohol-related death in developed countries [3]. The incidence of ALD in China increases from 2.7 % at 2000 to 4.4 % at 2004 among hospitalized patients with liver diseases [4]. ALD is characterized by the progressive liver damage which leads to inflammation, steatosis, steatohepatitis, necrosis, and finally fibrosis and cirrhosis [5–7]. Although the pathological mechanisms underlying alcoholinduced liver injury still remain largely unknown, oxidative stress has been considered to play a crucial role in the pathogenesis of alcoholic liver damage [8–10]. Oxidative stress usually results from the imbalance between the excessive formation of reactive oxygen species (ROS) and the limited antioxidant capacity [11, 12]. It has been known that the excessive intake of alcohol administration significantly enhances the production of ROS and reduces the level or activity of antioxidants, such as superoxide dismutase (SOD) and haem oxygenase-1 (HO-1) [10, 13]. Liver is the main organ responsible for the metabolizing of alcohol and the hepatic microsomes are considered to be the main source of ROS generation [13, 14]. Chronic alcohol exposure has been demonstrated to stimulate the production of microsomal ROS as a result of the induction of cytochrome P-450 2E1 (CYP2E1) [15]. Excessive ROS generated during the process of alcohol metabolism causes cell membranes damage, inflammation as well as cell death [10, 16–18]. Schisandra chinensis is a traditional Chinese herb which has been broadly used in the Asian-Pacific region [19, 20]. The extracts of Schisandra chinensis have been revealed to possess multi-pharmaceutical activities, including
123
804
anti-inflammatory, anti-tumor, and antioxidant effects [21– 24]. Schisandra chinensis has been shown to prevent lipid peroxidation and oxidative stress in rats subjected to heat environmental stress [25]. The pollen extracts of Schisandra chinensis exhibit antioxidant effect on CCl4-induced acute liver damage in mice [26]. In addition, Schisandra chinensis has been reported to exert protective effects on liver diseases. Park and colleagues showed that Schisandra chinensis prevents alcohol-induced fatty liver disease in rats [27]. Another report found that gomisin A isolated from Schisandra chinensis protects against CCl4-induced hepatic injury [28]. Moreover, the fruit extracts of Schisandra chinensis has been shown to improve the liver function in humans [29]. In the present study, we investigated the effects of triterpene compounds extracted from Schisandra chinensis on alcohol-induced liver injury in rats. The content of reduced glutathione (GSH) and malondialdehyde (MDA), and the activity of SOD were evaluated to determine the effects of triterpenoid on the oxidative stress in rats exposed to alcohol. The expression level and activity of microsomal CYP2E1 and HO-1 were measured to reveal the molecular mechanisms of triterpenoid from Schisandra chinensis on alcohol-induced oxidative stress in rats. Materials and Methods Animals and Treatments Animals used in this study were male Sprague-Dawley (SD) rats, 8-week-old. All rats were allowed free access to water and food and kept at 25 °C with 12 h dark/light cycle. The procedure of the animal study was approved by the Ethics Committee of Shenyang Agricultural University. SD rats (n = 70) were allocated into the following seven groups by a random method. Group 1 (n = 10), rats were given normal saline at the volume of 1 mL/100 g body weight (b.w.) twice a day with 1 h interval. Animals in Group 2 (n = 10) were treated with saline (1 mL/100 g b.w.) by oral gavage and then administrated with alcohol (10 %, v/v) at the dose of 0.8 g/kg b.w. 1 h later. For Group 3 (n = 10), rats received saline (1 mL/100 g b.w.) 1 h before an exposure to 1.6 g/kg b.w. alcohol (20 %, v/v). Group 4 (n = 10), rats were treated with saline and then administrated with alcohol (30 %, v/v; 2.4 g/kg b.w.). Rats in Group 5 (n = 10) received 48 mg/kg b.w. triterpene compounds isolated from Schisandra chinensis 1 h prior to the exposure of alcohol (30 %, v/v; 2.4 g/kg b.w.). Group 6 (n = 10) was treated as described for Group 5 except the dose of triterpene compounds was increased (96 mg/kg b.w.). Rats treated with triterpene compounds
123
Cell Biochem Biophys (2015) 71:803–811
(96 mg/kg b.w.) alone were assigned as Group 7 (n = 10). All animals were subjected to the described treatment for 90 days. Blood was gained from the eyeballs of rats at 30 and 60 days. All rats were sacrificed at the end of the experiment. Blood samples were collected from the inferior vena cava at 90 days. Liver, heart, and kidney were obtained from various groups and immediately freezed in liquid nitrogen. The liver tissue was fixed in 4 % paraformaldehyde. Measurements of the Level of Reduced Glutathione and Malondialdehyde and, the Activity of Superoxide Dismutase in Serum and Multiple Organs To measure the level of GSH and MDA and the activity of SOD in serum, the blood samples were collected either from the eyeballs of rats at 30 and 60 days or from the inferior vena cava at 90 days. The content of reduced GSH and MDA and the activity of SOD in serum were determined by commercially purchased kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China) following the recommended protocols. Liver, heart, and kidney organs were separated from rats and homogenized with 9 volumes of ice-cold phosphate buffer saline (PBS). After centrifugation at 12,000 rpm, 4 °C for 10 min, the supernatants were obtained and subjected to evaluate the level of reduced GSH and MDA, and SOD activity in these organs with kits bought from Nanjing Jiancheng Bioengineering Research Institute. Liver Function Test Liver function was evaluated by determining the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum. ALT/GPT assay kit (Nanjing Jiancheng Bioengineering Research Institute) and AST/GOT assay kit (Nanjing Jiancheng Bioengineering Research Institute) were used to measure the activity of ALT and AST in serum, respectively. Hematoxylin and Eosin (H&E) Staining Liver samples were harvested and fixed in 4 % paraformaldehyde. H&E staining was performed using the routine histological protocol. Five-micrometer sections were prepared after the liver tissues were embedded in paraffin. All sections were stained with H&E solution to evaluate fatty or inflammatory cell infiltrations in the harvested liver samples. H&E staining was observed under an OLYMPUS DP71 microscope with a 200 9 magnification.
Cell Biochem Biophys (2015) 71:803–811
805
Preparation of Liver Microsomes
Measurement of the Enzymatic Activity in Microsomes
Microsome preparation was conducted as previously described [13]. Liver samples were homogenized in icecold buffer (0.01 M Tris–HCl, pH 7.4, 0.1 M EDTA, 0.01 M Sucrose, and 0.05 mM PMSF) and subsequently centrifuged at 12,000 rpm, 4 °C for 10 min. The supernatant was then centrifuged at 30,000 rpm, 4 °C for 60 min. The obtained pellet was dissolved in buffer (0.01 M Tris–HCl, pH 7.4, 0.1 M EDTA, 0.01 M Sucrose, and 0.05 mM PMSF) and then centrifuged at 30,000 rpm, 4 °C for 20 min. The pellet was subjected to the same centrifugation twice. The resultant microsomal pellet was washed twice and resuspended in PBS containing 1 % PMSF.
Liver samples were collected and the liver microsomes were prepared as described. The enzymatic activity of microsomal HO-1 and CYP2E1 was determined by commercial available ELISA kits according to the recommended protocols.
Real-Time qPCR Total RNA was purified from rat liver tissues with RNAprep pure Tissue Kit (TIANGEN BIOTECH CO., LTD., Beijing, China) following the manufacturer’s protocol. One-micogram purified RNA was used to synthesize the complementary DNA (cDNA). PCR reaction was carried out in a 20 lL reaction mixture on ExicyclerTM 96 RealTime Quantitative Thermal Block (Bioneer, Daejeon, Korea). The following sequences are primers used in this study. HO-1, CTGGAATGGAAGGAGATGCC and TCA GAACAGCCGCCTCTACCG; CYP2E1, CGTGGTCCTG CATGGCTACA and CCCAGTCTCGGAGAATGCT TAG; b-actin, GAGATTACTGCCCTGGCTCCTAGC and GGCCGGACTCATCGTACTCCTGCTT. The obtained data were analyzed using the comparative threshold cycle (CT) method. Western Blotting Assay Proteins were separated by 10 % SDS-PAGE and then transferred electronically to polyvinylidene fluoride (PVDF; Millipore, Bedford, MA, US) membranes. Primary anti-HO-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; dilution at 1:150) and anti-CYP2E1 (Wanlei Life Science, Shenyang, China; dilution at 1:150) antibodies were incubated with the membranes after blocking in 5 % non-fat dried milk. Then, horseradish peroxidase (HRP)conjugated goat-anti-rabbit IgG (Beyotime Institute of Biotechnology, Haimen, China; dilution at 1:5,000) was added and the membranes were developed with an ECL plus chemiluminescence kit (Qihaifutai Technology Co., Ltd., Shanghai, China). Membrane incubated with a mouse anti-b-actin-HRP antibody (KangChen Biotech, Shanghai, China; dilution at 1:10,000) was used as an internal control.
Statistical Analysis The statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA). All results were expressed as mean ± SD. Data were analyzed by one-way ANOVA followed by Bonferroni test. A p value of less than 0.05 was considered statistically significant.
Results Triterpene Compounds Isolated From Schisandra chinensis Attenuates Oxidative Stress of Rats Treated with Alcohol Rats were exposed to different concentration of alcohol as described in the Methods. Low and high dose of triterpene compounds isolated from Schisandra chinensis were administrated by oral gavage to alcohol-treated rats. To investigate the effects of the extracted triterpenoid on alcohol-induced oxidative stress, the content of reduced GSH and MDA, and the activity of SOD in serum samples collected at 30, 60, and 90 days after exposure to alcohol were determined. We found that both the level of reduced GSH and the activity of the antioxidant enzyme SOD in serum were significantly reduced in alcohol-treated rats in a dose-dependent manner (Supplemental Fig. 1). The extent of MDA formation, which is a marker of lipid peroxidation, was increased remarkably in serum of rats treated with alcohol (Supplemental Fig. 1). However, these alternations were restored by the administration of low or high dose of triterpene compounds isolated from Schisandra chinensis (Supplemental Fig. 1). To further explore the effects of triterpenoid on oxidative stress in different organs, heart, liver, and kidney samples were harvested when rats were sacrificed after 90 days exposure to alcohol. As shown in Fig. 1, the level of reduced GSH (Fig. 1a–c) and the activity of SOD (Fig. 1g–i) in the above mentioned organs were dramatically dropped in alcohol-treated rats. In contrast, triterpenoid administration greatly increased the content of reduced GSH (Fig. 1a–c) and improved the activity of SOD (Fig. 1g–i). Moreover, the alcohol-induced MDA formation was significantly inhibited by triterpenoid (Fig. 1d–f). The content of GSH and MDA and the activity of SOD in serum samples
123
806
Cell Biochem Biophys (2015) 71:803–811
Fig. 1 Effects of triterpene compounds isolated from Schisandra chinensis on lipid peroxidation and antioxidant enzyme activity in multiple organs of rats exposed to alcohol. Heart, kidney, and liver were obtained after rats were administrated with different doses of alcohol for 90 days. The levels of reduced GSH (a–c), MDA (d–f), and the activity of SOD (g–i) in these organs were measured by
commercial kits, respectively. Rats were randomly divided into the following groups: 1, normal control; 2, alcohol (10 %, 0.8 g/kg b.w.); 3, alcohol (20 %, 1.6 g/kg b.w.); 4, alcohol (30 %, 2.4 g/kg b.w.); 5, alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (48 g/kg b.w.); 6, alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (96 g/kg b.w.); 7, triterpene compounds (96 g/kg b.w.)
from rats received only triterpenoid were similar to that from normal control rats (Fig. 1). These findings show that the triterpene compounds obtained from Schisandra chinensis alleviates alcohol-induced oxidative stress in rats.
(Fig. 2a and b, p \ 0.001). However, the treatment with triterpenoid significantly reduced the levels of ALT and AST, particularly in a high dose (Fig. 2a and b, p \ 0.05 and p \ 0.001). The administration of triterpenoid alone did not affect ALT and AST levels in serum, which served as control.
Effects of Triterpene Compounds Extract From Schisandra chinensis on Liver Function Since liver is the major organ which is responsible for the metabolism of alcohol intake, it is more susceptible to alcohol-induced injury than other organs [30]. Therefore, we asked whether the triterpene compounds isolated from Schisandra chinensis could exert positive effects on liver function. To address this, the liver function assay was performed through measuring the levels of ALT and AST in serum. In accordance with previous reports, the serum levels of both enzymes were extensively increased in rats exposed to alcohol, suggesting the liver function injury
123
Triterpene Compounds Isolated From Schisandra chinensis Ameliorate the Pathologic Changes of Liver Injury Induced by Alcohol Next, we evaluated the effects of the extracted triterpenoid on the histological alteration of alcohol-induced liver injury. H&E staining results showed that normal control rat exhibited regular lobular architecture which consisted of central veins and radiating hepatic cords in the liver tissue (Fig. 3a). However, liver samples separated from alcoholtreated rats displayed abnormal lobular architecture with
Cell Biochem Biophys (2015) 71:803–811
807
severe steatosis and abundant infiltrated inflammatory cells (Fig. 3b–d). While the introduction of low dose of the triterpene compounds isolated from Schisandra chinensis did not show an obvious effect on the morphology of alcohol-induced liver, the administration of high dose of the extracted triterpenoid restored most of these pathological changes (Fig. 3e–f). The treatment with high dose of triterpenoid alone was used as control (Fig. 3g). Effects of Triterpene Compounds Purified From Schisandra chinensis on the mRNA and Protein Expression Levels of HO-1 and CYP2E1 in Rat Liver Microsomes
Fig. 2 Effects of triterpene compounds isolated from Schisandra chinensis on liver function. The serum level of ALT (a) and AST (b) was determined. Groups were assigned as described in Fig. 1. Values are expressed as mean ± SD (n = 10). *p \ 0.05 and *** p \ 0.001
Fig. 3 Triterpene compounds extracted from Schisandra chinensis improve the pathologic changes of alcohol-induced liver injury. Livers collected from normal control (a), alcohol (10 %, 0.8 g/kg b.w.) (b), alcohol (20 %, 1.6 g/kg b.w.) (c), alcohol (30 %, 2.4 g/kg
To explore the molecular mechanism of the protective effect of triterpenoid against alcohol-induced oxidative stress, we investigated the expression levels of HO-1 and CYP2E1 in rat liver microsomes which are the main source of ROS and thus susceptible to ROS attack [13]. As revealed by real-time PCR and Western blot assay, the mRNA and protein expression levels of microsomal HO-1 were extensively reduced when rats exposed to alcohol as compared with control rats (Fig. 4a and c, p \ 0.001). Consistent with prior reports, microsomal CYP2E1 was significantly induced at both mRNA and protein level when rats treated with alcohol (Fig. 4b and d, p \ 0.001). The administration of triterpene compounds purified from Schisandra chinensis, however, remarkably restored the expression pattern of HO-1 and ameliorated the induction
b.w.) (d), alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (48 g/kg b.w.) (e), alcohol (30 %, 2.4 g/kg b.w.) ? triterpene compounds (96 g/kg b.w.) (f), and triterpene compounds (96 g/kg b.w.) (g) groups were subjected to H&E staining. Bars a–g were 100 lm
123
808
Cell Biochem Biophys (2015) 71:803–811
Fig. 4 Effects of triterpene compounds isolated from Schisandra chinensis on the expression levels of rat liver microsomal HO-1 and CYP2E1. The mRNA levels of HO-1 (a) and CYP2E1 (b) were evaluated by real-time qPCR. Western blotting and the subsequent
densitometric analysis were conducted to determine the protein levels of HO-1 (c) and CYP2E1 (d) in liver microsomes. Groups were the same as illustrated in Fig. 1. Values are mean ± SD (n = 10). ** p \ 0.01 and ***p \ 0.001
of CYP2E1 in microsomes, particularly for high dose of triterpenoid (Fig. 4, p \ 0.01 and p \ 0.001). Neither HO1 nor CYP2E1 expression were affected by treatment with triterpenoid alone (Fig. 4).
treated rats relative to normal rats (Fig. 5b, p \ 0.001). In contrast, the enzymatic activity of microsomal CYP2E1 was decreased by nearly 57 % when rats were presupplemented with high dose of triterpenoid following alcohol treatment (Fig. 5b, p \ 0.001). Notably, the activity of CYP2E1 in liver microsomes obtained from alcohol-treated was still higher than those from normal control.
Effects of Triterpene Compounds Purified From Schisandra chinensis on the Activity of Rat Liver Microsomal HO-1 and CYP2E1 The enzymatic activity of HO-1 and CYP2E1 in microsomes was further evaluated. We found that the activity of microsomal HO-1 was dramatically reduced when challenged with alcohol, with 65 % reduction in rats treated with high concentration of alcohol (Fig. 5a, p \ 0.001). This number was reduced to only 14 % when high dose of the purified triterpenoid was provided, indicating significant restoration of this antioxidant enzyme (Fig. 5a, p \ 0.001). Additionally, chronic alcohol consumption triggered the activation of CYP2E1 whose activity was increased by 5.88-fold in high concentration alcohol-
123
Discussion Alcohol-induced liver disease, which is characterized by a pathological process with progressive liver damage leading to fibrosis and cirrhosis, is a major cause of chronic liver disease worldwide [7, 31]. The enhanced oxidative stress induced by excessive alcohol consumption causes damage to cell membranes directly and eventually results in hepatic tissue injury [10, 16]. In the current study, we found that the triterpene compounds isolated from Schisandra chinensis reduced oxidative stress in multi-organs of rats
Cell Biochem Biophys (2015) 71:803–811
Fig. 5 Triterpene compounds extracted from Schisandra chinensis differently regulate the enzymatic activity of HO-1 and CYP2E1 in rat liver microsomes. ELISA kits were used to measure the enzymatic activity of HO-1 and CYP2E1 in liver microsomes obtained rats in different groups. Groups were assigned as stated in Fig. 1. Values are mean ± SD (n = 10). **p \ 0.01 and ***p \ 0.001
exposed to alcohol. The impaired liver function and morphologic changes caused by alcohol exposure was improved after triterpenoid treatment. Furthermore, the administration of triterpene compounds purified from Schisandra chinensis increased the expression level of HO1 and inhibited the induction of CYP2E1 in liver microsomes. In accordingly, we observed that the microsomal activity of HO-1 was induced whereas the activity of CYP2E1 was suppressed in rats treated with triterpenoid following alcohol administration. As a traditional Chinese medicine, Schisandra chinensis has been proved to exhibit various active effects, such as anti-inflammatory, detoxificant, and anti-carcinogenic effects [24, 32, 33]. Previous reports have demonstrated that the extracts of Schisandra chinensis are capable of ameliorating oxidative stress in CCl4-treated mice [26] or in rats subjected to heat stress [25]. More importantly, other groups have shown that Schisandra chinensis exerts protective effects on liver function either in rats or in humans [27–29]. Therefore, it is reasonable to hypothesize that extracts of Schisandra chinensis protect against alcohol-induced liver injury through its antioxidant activity. To test this hypothesis, we first determined whether the
809
administration of triterpene compounds isolated from Schisandra chinensis could attenuate alcohol-induced oxidative stress in rat organs. The evaluation of oxidative stress was conducted by measuring the content and level of oxidative stress markers, including the content of reduced GSH and MDA, and the activity of SOD [34]. Our data showed that oxidative stress was alleviated in heart, kidney, and liver collected from rats treated with triterpenoid following alcohol exposure. As liver is the main organ responsible for the metabolism of consumed alcohol and thus is more susceptible to alcohol-induced damage [30], the effects of triterpene compounds purified from Schisandra chinensis on liver function were analyzed. Liver function was evaluated by measuring the level of serum ALT and AST. The morphological changes were assessed by H&E staining. In line with a prior study [26], we observed that triterpenoid from Schisandra chinensis prevented the increase of ALT and AST levels in serum. Additionally, the pathological changes of liver tissue induced by alcohol exposure were ameliorated when triterpene compounds isolated from Schisandra chinensis were administrated, especially in a high dose. These data suggested that triterpenoid from Schisandra chinensis protected against alcohol-induced liver injury at least partially through its antioxidant activity. It should be noted that other pharmaceutical activities of Schisandra chinensis, such as anti-inflammatory and detoxificant activities, may also contribute to the hepatoprotective effect of Schisandra chinensis extracts [22, 26]. It has been suggested that the hepatic microsomes are the main source of ROS generation and thus they are susceptible to ROS-induced damage [13, 14]. Alcohol is metabolized by three pathways which utilize alcohol dehydrogenase, the microsomal ethanol oxidative system (MEOS) and catalase, respectively [35]. MEOS, characterized by CYP2E1, is viewed as the main site of ROS overproduction during alcohol metabolism. Previous studies have demonstrated that microsomal CYP2E1 is substantially induced by alcohol treatment [13, 30]. In the present study, we found that chronic alcohol administration to rats resulted in the induction of CYP2E1 at both expression and enzymatic activity levels. Such induction of CYP2E1 was attenuated when rats supplemented with triterpenoid from Schisandra chinensis following alcohol exposure. Interestingly, Su et al. (2013) reported that CYP2E1 enzyme activity was inhibited after treatment with multiple doses of vinegar-processed Schisandra chinensis [36]. Conversely, another group found that multiple dosing of the extracts from Schisandra chinensis significantly induces the activity of CYP2E1 [37]. However, it should be noted that these findings were obtained by using alcoholic extracts of Schisandra chinensis, and it is possible that the alcohol within the extracts of
123
810
Schisandra chinensis partially contributed to the induction of CYP2E1 [37]. HO-1 is a ubiquitous stress-responsive protein which is responsible for catalyzing the cleavage of prooxidative haem into bioactive products including biliverdin/bilirubin, carbon monoxide as well as free iron [38, 39]. It has been suggested that HO-1 plays crucial roles in tissue homeostasis by means of suppressing oxidative stress and keeping cellular integrity [40]. In the present study, chronic alcohol ingestion reduced the expression and activity of HO-1 in hepatic microsomes. However, these alternations were completely reversed after supplement with high dose of triterpenoid from Schisandra chinensis. Our findings were consistent with a previous report in which the authors claimed that a novel a-iso-cubebenol isolated from dried fruits of Schisandra chinensis up-regulated the expression of HO-1 at both mRNA and protein levels [41]. Therefore, the induction of HO-1 by triterpenoid administration may contribute to its beneficial effects on alcohol-induced liver injury. The involvement of other enzymes, for instance, glutathione peroxidase, catalase, and NADPH-P450 reductase, should be investigated in the future study. Acknowledgments This study was supported by Grants from the National Natural Science Foundation of China (No. 31201325), the Doctoral Startup Foundation of Science and Technology Department of Liaoning Province (No. 20121139), the Liaoning Excellent Talents in University (2014108) and the ‘‘Tian Zhu Shan’’ Excellent Talents of Shenyang Agricultural University (2014).
References 1. Singal, A. K., & Charlton, M. R. (2012). Nutrition in alcoholic liver disease. Clinics in Liver Disease, 16(4), 805–826. 2. Lelbach, W. K. (1966). Liver damage in chronic alcoholism. Results of a clinical, clinical-chemical and bioptic-histological study in 526 alcoholic patients during a low-calorie diet in an open drinking sanatorium. Acta Hepato-splenologica, 13(6), 321–349. 3. O’Shea, R. S., Dasarathy, S., & McCullough, A. J. (2010). Alcoholic Liver Disease. Hepatology, 51(1), 307–328. 4. Fan, J. G. (2013). Epidemiology of alcoholic and nonalcoholic fatty liver disease in China. Journal of Gastroenterology and Hepatology, 28(Suppl 1), 11–17. 5. Daniluk, J., Szuster-Ciesielska, A., Drabko, J., & KandeferSzerszen, M. (2001). Serum cytokine levels in alcohol-related liver cirrhosis. Alcohol, 23(1), 29–34. 6. Isayama, F., Froh, M., Bradford, B. U., McKim, S. E., Kadiiska, M. B., Connor, H. D., et al. (2003). The CYP inhibitor 1-aminobenzotriazole does not prevent oxidative stress associated with alcohol-induced liver injury in rats and mice. Free Radical Biology and Medicine, 35(35), 12–1581. 7. De Minicis, S., & Brenner, D. A. (2008). Oxidative stress in alcoholic liver disease: role of NADPH oxidase complex. Journal of Gastroenterology and Hepatology, 23(Suppl 1), S98–S103. 8. Lindros, K. O. (1995). Alcoholic liver disease: pathobiological aspects. Journal of Hepatology., 23(Suppl 1), 7–15.
123
Cell Biochem Biophys (2015) 71:803–811 9. Balkan, J., Dogru-Abbasoglu, S., Kanbagli, O., Cevikbas, U., Aykac-Toker, G., & Uysal, M. (2001). Taurine has a protective effect against thioacetamide-induced liver cirrhosis by decreasing oxidative stress. Human and Experimental Toxicology, 20(5), 251–254. 10. Cederbaum, A. I., Lu, Y., & Wu, D. (2009). Role of oxidative stress in alcohol-induced liver injury. Archives of Toxicology, 83(6), 519–548. 11. Sharma, R. K., Pasqualotto, F. F., Nelson, D. R., Thomas, A. J, Jr, & Agarwal, A. (1999). The reactive oxygen species-total antioxidant capacity score is a new measure of oxidative stress to predict male infertility. Human Reproduction, 14(11), 2801–2807. 12. Apel, K., & Hirt, H. (2004). Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology, 55, 373–399. 13. Tang, Y., Gao, C., Xing, M., Li, Y., Zhu, L., Wang, D., et al. (2012). Quercetin prevents ethanol-induced dyslipidemia and mitochondrial oxidative damage. Food and Chemical Toxicology, 50(5), 1194–1200. 14. Wang, Y., Millonig, G., Nair, J., Patsenker, E., Stickel, F., Mueller, S., et al. (2009). Ethanol-induced cytochrome P4502E1 causes carcinogenic etheno-DNA lesions in alcoholic liver disease. Hepatology, 50, 453–461. 15. Lu, Y., & Cederbaum, A. I. (2008). CYP2E1 and oxidative liver injury by alcohol. Free Radical Biology and Medicine, 44, 723–738. 16. Bilzer, M., & Gerbes, A. L. (2000). Preservation injury of the liver: mechanisms and novel therapeutic strategies. Journal of Hepatology, 32, 508–515. 17. Jaeschke, H. (2011). Reactive oxygen and mechanisms of inflammatory liver injury: present concepts. Journal of Gastroenterology and Hepatology, 26(Suppl 1), 173–179. 18. Stenger, C., Naves, T., Verdier, M., & Ratinaud, M. H. (2011). The cell death response to the ROS inducer, cobalt chloride, in neuroblastoma cell lines according to p53 status. International Journal of Oncology, 39, 601–609. 19. Lu, Y., & Chen, D. F. (2009). Analysis of Schisandra chinensis and Schisandra sphenanthera. Journal of Chromatography A, 1216, 1980–1990. 20. Panossian, A., & Wikman, G. (2008). Pharmacology of Schisandra chinensis Bail.: an overview of Russian research and uses in medicine. Journal of Ethnopharmacology, 118, 183–212. 21. Dilshara, M. G., Jayasooriya, R. G., Kang, C. H., Lee, S., Park, S. R., Jeong, J. W., et al. (2013). Downregulation of pro-inflammatory mediators by a water extract of Schisandra chinensis (Turcz.) Baill fruit in lipopolysaccharide-stimulated RAW 264.7 macrophage cells. Environmental Toxicology and Pharmacology, 36, 256–264. 22. Liu, G. T. (1989). Pharmacological actions and clinical use of fructus schizandrae. Chinese Medical Journal, 102, 740–749. 23. Guo, L. Y., Hung, T. M., Bae, K. H., Shin, E. M., Zhou, H. Y., Hong, Y. N., et al. (2008). Anti-inflammatory effects of schisandrin isolated from the fruit of Schisandra chinensis Baill. European Journal of Pharmacology, 591, 293–299. 24. Szeto, Y. T., Wong, S. C., Wong, J. W., Kalle, W., & Pak, S. C. (2011). In vitro antioxidation activity and genoprotective effect of selected Chinese medicinal herbs. American Journal of Chinese Medicine, 39, 827–838. 25. Kim, K. J., Yoon, K. Y., Hong, H. D., & Lee, B. Y. (2012). Schisandra chinensis prevents hepatic lipid peroxidation and oxidative stress in rats subjected to heat environmental stress. Phytotherapy Research, 26, 1674–1680. 26. Cheng, N., Ren, N., Gao, H., Lei, X., Zheng, J., & Cao, W. (2013). Antioxidant and hepatoprotective effects of Schisandra
Cell Biochem Biophys (2015) 71:803–811
27.
28.
29.
30.
31.
32.
33.
34.
chinensis pollen extract on CCl4-induced acute liver damage in mice. Food and Chemical Toxicology, 55, 234–240. Park, H. J., Lee, S. J., Song, Y., Jang, S. H., Ko, Y. G., Kang, S. N., et al. (2014). Schisandra chinensis prevents alcohol-induced fatty liver disease in rats. Journal of Medicinal Food, 17, 103–110. Hwang, I. S., Kim, J. E., Lee, Y. J., Kwak, M. H., Choi, Y. H., Kang, B. C., et al. (2013). Protective effects of gomisin A isolated from Schisandra chinensis against CCl(4)-induced hepatic and renal injury. International Journal of Molecular Medicine, 31, 888–898. Chiu, H. F., Chen, T. Y., Tzeng, Y. T., & Wang, C. K. (2013). Improvement of liver function in humans using a mixture of schisandra fruit extract and sesamin. Phytotherapy Research, 27, 368–373. Reddy, V. D., Padmavathi, P., Hymavathi, R., Maturu, P., & Varadacharyulu, N. (2014). Alcohol-induced oxidative stress in rat liver microsomes: protective effect of Emblica officinalis. Pathophysiology, 21, 153–159. Gao, B., & Bataller, R. (2011). Alcoholic liver disease: pathogenesis and new therapeutic targets. Gastroenterology, 141, 1572–1585. Liu, C., Zhang, S., & Wu, H. (2009). Non-thermal extraction of effective ingredients from Schisandra chinensis Baill and the antioxidant activity of its extract. Natural Product Research, 23, 1390–1401. Liu, C. J., Zhang, S. Q., Zhang, J. S., Liang, Q., & Li, D. S. (2012). Chemical composition and antioxidant activity of essential oil from berries of Schisandra chinensis (Turcz.) Baill. Natural Product Research, 26, 2199–2203. Ozcan, M. E., Gulec, M., Ozerol, E., Polat, R., & Akyol, O. (2004). Antioxidant enzyme activities and oxidative stress in
811
35.
36.
37.
38.
39.
40.
41.
affective disorders. International Clinical Psychopharmacology, 19, 89–95. Popovic, M., Janicijevic-Hudomal, S., Kaurinovic, B., Rasic, J., & Trivic, S. (2008). Effects of various drugs on alcohol-induced oxidative stress in the liver. Molecules, 13, 2249–2259. Su, T., Mao, C., Yin, F., Yu, Z., Lin, Y., Song, Y., et al. (2013). Effects of unprocessed versus vinegar-processed Schisandra chinensis on the activity and mRNA expression of CYP1A2, CYP2E1 and CYP3A4 enzymes in rats. Journal of Ethnopharmacology, 146, 734–743. Wang, B. L., Hu, J. P., Sheng, L., & Li, Y. (2011). Effects of Schisandra chinensis (Wuweizi) constituents on the activity of hepatic microsomal CYP450 isozymes in rats detected by using a cocktail probe substrates method. Yao Xue Xue Bao, 46, 922–927. Choi, A. M., & Alam, J. (1996). Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. American Journal of Respiratory Cell and Molecular Biology, 15, 9–19. Morse, D., & Choi, A. M. (2002). Heme oxygenase-1: the ‘‘emerging molecule’’ has arrived. American Journal of Respiratory Cell and Molecular Biology, 27, 8–16. Kim, H. P., Pae, H. O., Back, S. H., Chung, S. W., Woo, J. M., Son, Y., et al. (2011). Heme oxygenase-1 comes back to endoplasmic reticulum. Biochemical and Biophysical Research Communications, 404, 1–5. Park, S. Y., Park da, J., Kim, Y. H., Kim, Y., Kim, S. G., Shon, K. J., et al. (2011). Upregulation of heme oxygenase-1 via PI3 K/ Akt and Nrf-2 signaling pathways mediates the anti-inflammatory activity of Schisandrin in Porphyromonas gingivalis LPS-stimulated macrophages. Immunology Letters, 139, 93–101.
123
