The American Journal of Chinese Medicine, Vol. 42, No. 1, 173–187 © 2014 World Scientific Publishing Company Institute for Advanced Research in Asian Science and Medicine DOI: 10.1142/S0192415X14500128
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Efficacy Comparison of Korean Ginseng and American Ginseng on Body Temperature and Metabolic Parameters Eun-Young Park,*,† Mi-Hwi Kim,*,† Eung-Hwi Kim,*,† Eun-Kyu Lee,*,† , , In-Sun Park,§ Duck-Choon Yang¶ and Hee-Sook Jun* † ‡ *College
of Pharmacy and Gachon Institute of Pharmaceutical Science †Lee Gil Ya Cancer and Diabetes Institute Gachon University, Incheon, Korea ‡
Gachon Medical Research Institute Gil Hospital, Incheon, Korea
§Department of Pathology, Inha University Hospital Inha University School of Medicine, Incheon, Korea ¶
Korea Ginseng Center for Most Valuable Products and Ginseng Genetic Resource Bank Kyung Hee University, Korea
Abstract: Ginseng has beneficial effects in cancer, diabetes and aging. There are two main varieties of ginseng: Panax ginseng (Korean ginseng) and Panax quinquefolius (American ginseng). There are anecdotal reports that American ginseng helps reduce body temperature, whereas Korean ginseng improves blood circulation and increases body temperature; however, their respective effects on body temperature and metabolic parameters have not been studied. We investigated body temperature and metabolic parameters in mice using a metabolic cage. After administering ginseng extracts acutely (single dose of 1000 mg/kg) or chronically (200 mg/kg/day for four weeks), core body temperature, food intake, oxygen consumption and activity were measured, as well as serum levels of pyrogen-related factors and mRNA expression of metabolic genes. Acute treatment with American ginseng reduced body temperature compared with PBS-treated mice during the night; however, there was no significant effect of ginseng treatment on body temperature after four weeks of treatment. VO2, VCO2, food intake, activity and energy expenditure were unchanged after both acute and chronic ginseng treatment compared with PBS treatment. In acutely treated mice, serum thyroxin levels were reduced by red and American ginseng, and the serum prostaglandin E2
Correspondence to: Dr. Hee Sook Jun, PhD, Lee Gil Ya Cancer and Diabetes Institute, Gachon University, 7-45 Sondo-dong, Yeonsu-ku, Incheon 406-840, Korea Tel: (þ82) 32-899-6056, Fax: (þ82) 32-899-6507, E-mail: [email protected]
173
174
E.-Y. PARK et al. level was reduced by American ginseng. In chronically treated mice, red and white ginseng reduced thyroxin levels. We conclude that Korean ginseng does not stimulate metabolism in mice, whereas a high dose of American ginseng may reduce night-time body temperature and pyrogen-related factors. Keywords: Panax ginseng; Korean Ginseng; Panax quinquefolius; American Ginseng; Body Temperature; Metabolic Parameters.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Introduction Ginseng is a popular plant in traditional Chinese medicine and is also one of the most extensively used medicinal plants in the world, which is evident from annual worldwide sales of over US$3 billion. Ginseng is known to have many pharmacological properties such as anti-cancer, anti-aging and anti-stress effects (Jeong et al., 2001; Choo et al., 2003; Cheng et al., 2005), as well as energy-boosting effects (Tamamoto et al., 2010). There are two main varieties of medicinal ginseng: Panax ginseng C.A. Meyer, which is produced in Korea and China and Panax quinquefolius L., which is mainly produced in North America, including in the United States and Canada (Azike et al., 2011). Yin and Yang is the foundation of the oriental philosophy. They represent the duality of positive (Yang; hot, fire, high and light) and negative (Yin: cold, water, low and dark) forces. Normally Yin and Yang have the same value because one cannot exist without the other. The state of equilibrium is established by balancing Yin and Yang. American ginseng is used to promote Yin energy and calm the body and to reduce the body temperature from a fever or hot weather. On the other hand, Korean ginseng is used to promote Yang energy, improve blood circulation, and revitalize or stabilize the natural “heat” in the body. The heat inside the body can come from many conditions such as menopause, high blood sugar, high cholesterol, and stress (Marazziti et al., 1992; Albertson et al., 2009). There are also anecdotal reports regarding the adverse effects of Korean ginseng, particularly the “hot” feeling (“seungyeol”) after taking ginseng extracts. According to a guide for the herbal health food user, American ginseng, a cooling ginseng, is best taken in the summer and Korean ginseng, a warming ginseng, is best taken in the winter. However, there is no scientific evidence on the effect of Korean or American ginseng on body temperature. In this study, we investigated the effects of Korean ginseng and American ginseng on body temperature, metabolic parameters and thermogenesis-related serum factors and gene expression levels. Materials and Methods Preparation of Ginseng Extracts Five kg of red ginseng (RG, Panax ginseng radix that has been heated and dried), white ginseng (WG, Panax ginseng radix that has been dried without heating) or American ginseng (AG, dried Panax quinquefolium radix) were extracted with 10 times volume of
KOREAN AND AMERICAN GINSENG ON METABOLISM
175
10% ethanol at 85 C for 3 h in a shaking incubator, and this was repeated five times. After filtration using filter paper (ADVANTEC, Dublin, CA, USA), the solvent was removed using an evaporator (EYELA N-N, Tokyo, Japan) at 60 C, and the residue was dissolved in 2.0 L of distilled water. For the administration to mice, extracts were dissolved in phosphate-buffered saline (PBS).
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
HPLC Analysis HPLC-grade acetonitrile and water were purchased from SK Chemicals (Ulsan, Korea). An aliquot of each sample was extracted in n-butanol saturated with H2O and evaporated in vacuum. The residue was dissolved in CH3OH and injected for HPLC analysis. This experiment employed a C18 (250 4:6 mm, ID 5 m) column using acetonitrile (solvent A) and distilled water (solvent B) mobile phases at A/B ratios of 15:85, 21:79, 58:42, 90:10, 90:10, 15:85, and 15:85, with run times of 0–5, 5–25, 25–70, 70–72, 72–82, 82–84, and 84–100 min, respectively. The flow rate was 1.6 ml/min and the sample was detected at UV 203 nm. Animals ICR mice were obtained from Orient Bio (Gyeonggi-do, Korea). Mice were maintained under specific pathogen-free conditions in a temperature-controlled room (23 1 C) in a 12-h light/dark cycle with ad libitum access to food and water at the Animal Care Center, Lee Gil Ya Cancer and Diabetes Institute, Gachon University, South Korea. All animal experiments were approved by the Institutional Animal Care and Use Committee of the Lee Gil Ya Cancer and Diabetes Institute. Treatment with Ginseng Extract Six-week-old male ICR mice were randomly divided into four groups: RG-treated (n ¼ 8), WG-treated (n ¼ 8), AG-treated (n ¼ 8) and PBS-treated (n ¼ 7). For acute treatment, 1000 mg/kg of RG, WG or AG extract in PBS was administered by oral intubation. For chronic treatment, 200 mg/kg of RG, WG or AG was given by oral intubation daily for four weeks. The PBS-treated group was given the same volume of PBS by oral intubation. At the end of the treatment, animals were killed and tissue samples including thyroid gland, hypothalamus and brown adipose tissue were collected for mRNA analysis. Assessment of Core Body Temperature and Metabolic Parameters For core body temperature measurements, emitters were inserted into the peritoneal cavity of mice under ketamine/xylazine anesthesia. Following surgery, mice were allowed one week for recovery. Mice were individually housed in metabolic chambers maintained on a 12-hour light/12-hour dark cycle. Core body temperature and metabolic parameters (oxygen consumption, carbon dioxide production, food intake and activity) were recorded
176
E.-Y. PARK et al.
continuously using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments, Columbus, OH). Following an acclimatization of 12 h, mice were given PBS or ginseng extract at 9:00 A.M. and monitored for 24 h.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Plasma Analysis Blood samples were collected from the orbital sinus under anesthesia 8 h after RG, WG or AG treatment. Blood samples were centrifuged at 3000 g for 20 min, and serum was collected. The concentrations of albumin, Ca 2þ , and Mg 2þ were measured using Beckman Coulter AU 480. Serum cytokine levels were measured using mouse tumor necrosis factor (TNF) and interferon (IFN) ELISA kits (Biolegend). Serum thyroxin (T4), thyroid stimulating hormone (TSH) and 3,5,3 0 -triiodo-L-thyroxine (T3) levels were measured using an ELISA kit (Endocrine Technologies Incorporated). Prostaglandin E2 (PGE2) levels were measured using an EIA kit (Cayman Chemical Company). Analysis of mRNA Expression by Quantitative Real-Time PCR Total RNA was isolated from the brown adipose tissue, and cDNA was synthesized using a PrimeScript TM 1st strand cDNA synthesis kit (Takara). Quantitative real-time PCR was performed using the Power SYBR green Master-mix (Applied-Biosystems) and Applied Biosystem Prism 7900HT sequence detection system. PCR was carried out and stopped at 40 cycles (2 min at 50 C, 10 min at 95 C, and 40 cycles of 10 s at 95 C and 1 min at 60 C). The primer sequences used are shown in Table 1. Relative copy number was calculated using the threshold crossing point (Ct ) as calculated by the Ct calculations. Cold Exposure ICR mice were orally administered RG (1000 mg/kg) in PBS or PBS only. After 2 h, mice were exposed to 4 C for 3 h and sacrificed; brown adipose tissue was then collected.
Table 1. Primer Sequences for qRT-PCR Target C/EBPβ PPAR PPAR UCP1 TSHR TPO mPGES1 mPGES2 COX2 PGC1
Forward Primer
Reverse Primer
CACCAGTGTGAATTACAGCAAATC GCGCAAGAGCCGAGATAAAG GGAGCCATGGATTGCACATT GCTGCGGAAACTTCAGGAAAT GGGTCCCATCTACCAGGAAT GCTCTCTTTGGCAACCTGTC CTCAAGCCCTGCTACCACA AGACATGTCCCTTCTGCA GGGTGTCCCTTCACTTCTTTCA CACTGACAGATGGAGCCGTGA
ACAGGAGAATCTCCCAGAGTTTC CGGTCATTGTCACTGGTCAACT GGCCCGGGAAGTCACTGT AGAGACGTGTCACTCCTGGACTT CACACCATGTCCTCGTTGTC GCCAGCATCTAGGTGGAGAG GGCCTCAGACAAGAGACCAT TCATGGCCTTCATGGGTGGG TGGGAGGCACTTGCATTGA TGTTGGCTGGTGCCAGTAAGAG
KOREAN AND AMERICAN GINSENG ON METABOLISM
177
Table 2. Ginsenoside Content of Korean Ginseng and American Ginseng Extracts as Determined by HPLC Ginsenoside
Rb1
Rb2
Rc
Rd
Re
Rg1
Rf
Korean Ginseng American Ginseng
3.57 18.99
1.6 0.45
2.96 3.21
1.27 3.44
1.18 13.42
0.72 0.48
0.63
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Statistical Analysis Data are presented as means S.E. The significance of differences was analyzed by oneway ANOVA and the Bonferroni procedure using SPSS ver. 10.0 (SPSS Inc.) The value of statistical significance was set at p < 0:05. Results Ginsenoside Contents in Korean Ginseng and American Ginseng Extracts Total ginsenoside content was determined by HPLC analysis (Table 2). Ginsenoside Rb2 and Rg1 content in Korean ginseng was higher than that in American ginseng, while Rb1, Rd and Rc contents in American ginseng were much higher than those in Korean ginseng. Ginsenoside Rf was found only in Korean ginseng. Core Body Temperature in Ginseng Extract-Treated Mice To examine whether ginseng affects body temperature in mice, we measured the core body temperature using a metabolic monitoring system after acute (Fig. 1A) or chronic (Fig. 1C) treatment with RG, WG or AG extracts. In all mice, the average body temperature was slightly increased during the night when the activity was high. We found that there was a slight, but significant, decrease of body temperature in the AG-treated group after acute treatment (Fig. 1B). However, no significant differences in body temperature were seen in RG, WG or AG extract-treated mice after four weeks of treatment (Fig. 1D). Metabolic Parameters in Ginseng Extract-Treated Mice To investigate whether treatment with ginseng extracts affects energy metabolism, we monitored the amount of food intake, oxygen consumption, and activity for 24 h. As expected, food intake was higher during the dark cycle and, in parallel, oxygen consumption and activity were also increased. For mice treated either acutely (Fig. 2) or chronically (Fig. 3), there were no significant differences in oxygen consumption, carbon dioxide production, respiratory exchange ratio, food intake, activity or energy expenditure in RG, WG or AG extract-treated mice.
178
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
(A)
(B)
(C)
(D)
Figure 1. Effect of RG, WG and AG extracts on core body temperature. ICR mice were orally administered RG, WG or AG extract either (A) as a single dose (1000 mg/kg body weight) or (C) daily for 4 weeks (200 mg/kg body weight/day). Core body temperature was measured for (B, D) 24 h [upper panel: hourly temperature over 24 h; lower panel, average of the light cycle (12 h) or dark cycle (12 h) and overall (24 h)]. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow (B, D) indicates time of extract administration. *p < 0:05 compared with the PBS-treated group.
Serum Thyroxine and PGE2 Levels To investigate whether ginseng changes the thermogenesis-related cytokine and hormone secretion, we analyzed the serum levels of TNF, IFN and T4 after acute or chronic treatment with RG, WG or AG extracts. Serum TNF and IFN levels were not detectable
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
(A)
(D)
(B)
(E)
179
(C)
(F)
Figure 2. Effect of acute administration of RG, WG and AG extracts on metabolism. ICR mice were given a single dose of RG, WG or AG extract (1000 mg/kg body weight) or PBS, and (A) oxygen consumption (VO2), (B) carbon dioxide production (VCO2), (C) respiratory exchange ratio (RER), (D) food intake, (E) activity and (F) energy expenditure were measured in a metabolic cage. Upper panel, hourly values; lower panel, averaged values over 24 h. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow indicates time of extract administration.
after treatment with RG, WG or AG extracts (data not shown). After acute treatment, serum T4 was significantly decreased in RG and AG extract-treated mice compared with PBStreated mice, but unchanged in WG-treated mice at 8 h after extract treatment (Fig. 4A upper). As serum T4 levels were changed in RG and AG extract-treated mice, we analyzed the expression of mRNA for thyroid-stimulating hormone receptor (TSHR) and thyroid peroxidase (TPO), which are related to thyroid hormone production, in the thyroid gland after ginseng extract treatment. TSHR mRNA levels were not changed by ginseng treatment, whereas TPO mRNA levels were significantly decreased in RG- and AG-treated
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
180
E.-Y. PARK et al.
(A)
(D)
(B)
(E)
(C)
(F)
Figure 3. Effect of chronic administration of RG, WG and AG extracts on metabolism. ICR mice were given RG, WG or AG extracts (200 mg/kg body weight/day) or PBS daily for four weeks, and (A) oxygen consumption (VO2 Þ, (B) carbon dioxide production (VCO2), (C) respiratory exchange ratio (RER), (D) food intake, (E) activity and (F) energy expenditure were measured in a metabolic cage. Upper panel, hourly values; lower panel, averaged values over 24 h. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow indicates time of last extract administration.
mice (Fig. 4A lower). Serum PGE2 was decreased in AG extract-treated mice compared with the PBS-treated mice (Fig. 4B upper). As microsomal prostaglandin E synthase-1 (mPGES1), mPGES2 and cyclooxygenase-2 (COX2) are known to be involved in PGE2 production, we assessed whether ginseng treatment could decrease mPGES1, mPGES2 and COX-2 mRNA levels in the hypothalamus. Only mPGES1 mRNA levels were significantly decreased in AG-treated mice (Fig. 4B lower). In mice treated for four weeks, serum T4 levels were significantly decreased in RG and WG extract-treated mice, (Fig. 4C). mRNA expression of TSHR and TPO was decreased in RG-, WG- and AG-treated mice. PGE2 levels were not different in any of the groups treated for four weeks (Fig. 4D).
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
(A)
181
(B)
(C)
(D)
Figure 4. Effect of RG, WG and AG extracts on serum T4 and PGE2 levels. ICR mice were orally administered RG, WG or AG extracts or PBS either (A, B) as a single dose (1000 mg/kg body weight) or (C, D) daily for four weeks (200 mg/kg body weight/day). Thyroxin (T4) and prostaglandin E2 (PGE2) were measured in serum. Thyroid-stimulating hormone receptor (TSHR) and thyroid peroxidase (TPO) mRNA levels were measured in thyroid gland by quantitative real-time PCR. The mRNA levels of mPGES1, mPGES2 and COX-2 were investigated in the hypothalamus. Values are mean S.E. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. *p < 0:05 compared with the PBS group; **p < 0:01 compared with the PBS group.
Mineral supplements may help to optimize metabolism and adaptogenic effects (Kumar et al., 1996). Ca 2þ is reported to be involved in thermogenesis regulation (Perez-Gallardo et al., 2009; Leao et al., 2012). Mg 2þ at high concentration increases the incidence of mild hypothermia and reduces the shivering response in healthy persons (Badjatia et al., 2009). Thus, we investigated whether ginseng treatment can affect plasma mineral levels and
182
E.-Y. PARK et al. Table 3. Serum Mineral Levels after Acute treatment with Ginseng Extracts Albumin Units
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
PBS RG WG AG
2.00 2.05 2.08 2.25
0.16 0.08 0.11 0.11
Ca 2þ Units 9.42 9.48 9.40 9.76
0.23 0.26 0.19 0.32
Mg 2þ Units 1.60 1.58 1.55 1.70
0.04 0.11 0.03 0.06
Note: PBS, control PBS-treated mice, n ¼ 7; RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8. Table 4. Serum Mineral Levels after Chronic Treatment with Ginseng Extracts Ca 2þ Units
Albumin Units PBS RG WG AG
3.03 3.24 3.08 3.17
0.10 0.07 0.05 0.06
10.21 10.16 10.31 10.15
0.18 0.32 0.16 0.20
Mg 2þ Units 2.35 2.24 2.33 2.21
0.14 0.14 0.16 0.09
Note: PBS, control PBS-treated mice, n ¼ 7; RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8.
(A) Figure 5. Effect of RG, WG and AG extracts on gene expression. ICR mice were orally administered RG, WG and AG extract or PBS either (A) as a single dose (1000 mg/kg body weight) or (B) daily for four weeks (200 mg/kg body weight/day). C/EBPβ, PPAR, PPAR and UCP1 mRNA levels were measured in brown adipose tissue by qRT-PCR. (C) ICR mice were orally administered RG extract or PBS as a single dose (1000 mg/kg body weight). Two hours later mice were exposed to 4 C for three hours and PGC-1 and UCP1 mRNA expression in brown adipose tissue was analyzed by qRT-PCR. Values are expressed as fold change compared with the PBS group. Values are mean S.E. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. *p < 0:05 compared with the PBS group. **p < 0:01 compared with the PBS group.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
183
(B)
(C) Figure 5. (Continued )
albumin. Serum albumin, Ca 2þ and Mg 2þ levels were not different from the control in the RG, WG and AG extract-treated mice after acute or chronic ginseng treatment (Tables 3 and 4). mRNA Expression of Thermogenesis-Related Genes in Brown Adipose Tissue of Ginseng Extract-Treated Mice To investigate whether ginseng treatment changes thermogenesis-related gene expression, we analyzed the mRNA expression of CCAAT-enhancer-binding protein (C/EBP) β, peroxisome proliferator-activated receptor (PPAR), PPAR and uncoupling protein (UCP)1 in brown adipose tissues after acute or chronic treatment with RG, WG or AG extracts. After acute treatment or four weeks of treatment, mRNA expression levels of C/ EBPβ, PPAR, and UCP1 were not changed in the treated groups compared with PBStreated mice (Figs. 5A and 5B). We then examined the mRNA expression of PGC-1 and UCP1 genes after cold exposure. As expected, mRNA levels of PGC1 and UCP1 were significantly increased in mice exposed to cold stress. However, RG treatment had no additive effect on the mRNA expression of PGC1 and UCP1 (Fig. 5C).
184
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Discussion Ginseng is known to have many beneficial effects on body health and thus is used as a general tonic. Korean ginseng (Panax ginseng), both red and white preparations, and American ginseng (Panax quinquefolius) are most commonly used (Hwang et al., 2012; Wang et al., 2012), but there are some differences among them such as the content of ginsenosides and pharmacological effects (Brown, 2011; Sun et al., 2011). According to traditional Chinese medicine, Korean ginseng promotes the natural “heat” in the body whereas American ginseng is cooling; however, there is no scientific evidence on the effect of Korean or American ginseng on body temperature and metabolism. In this study we compared extracts of red, white and American ginseng for their respective effects on body temperature, energy metabolism, thermogenesis-related serum factors and gene expression levels. We found that a single high-dose WG or RG treatment did not change core temperature, but AG treatment slightly decreased core temperature by 0.6 C during the night compared with PBS-treated mice. However, core temperatures were unchanged in mice treated with ginseng extracts for four weeks. These results suggest that only a single high-dose AG treatment may affect core temperature in a mouse model. We then checked the energy metabolism using a metabolic monitoring system that measures changes in core temperature after administration of extracts in real time. Food intake and energy expenditure in the ginseng extract-treated groups were not different from those of the PBS-treated group, and there were no differences among WG, AG, and RG extract-treated groups. Oxygen consumption and carbon dioxide production, which are needed for energy generation, were also not different from the control or among groups, suggesting that neither Korean nor American ginseng extracts significantly affect heat or energy generation. Ginseng has adaptogenic activity in terms of recovery of body temperature from a hypothermic state. In a cold-hypoxia-restrained animal model, a single dose (0.5 to 2.0 g/g body weight) of Panax ginseng increased the time to attain a colonic temperature of 23 C and decreased the recovery time to attain 37 C (Kumar et al., 1996). In contrast, the infusion of ginsenoside Rg1 into the rat maintained the rectal temperature and attenuated the anorexia induced by elevated temperature (Yoshimatsu et al., 1993). Rg1 maintained constant histamine levels, which were increased in response to elevated temperature. These results suggest that Rg1 may block the relay of ambient temperature-related information into the hypothalamic histamine neurons in the rat (Yoshimatsu et al., 1993). Administration of ginsenoside Rg1 also reversed the suppressed ingestive behavior and elevated rectal temperature induced by interleukin-1 beta, an endogenous pyrogen (Kang et al., 1995). Ginseng saponin obtained from the roots of Panax quinquefolius improved cold tolerance under severe cold conditions (10 C under helium-oxygen) (Wang et al., 2000); both young and old rats in cold temperature benefited from this treatment for enhanced cold tolerance. Therefore, ginseng extract may help in the regulation of insufficient or excessive responses, rather than the enhancement of thermogenesis or energy metabolism. Thyroid hormones are major regulators of thermogenesis and energy metabolism and stimulate some processes that may generate heat in warm-blooded species (Silvestri et al.,
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
185
2005). T3 plays a role in facultative thermogenesis and is thought to regulate the uncoupling protein expression under cold conditions (Silvestri et al., 2005). The secretion of thyroid hormone is regulated by a classic negative feedback loop. Thyroid-releasing hormone (TRH), produced by the hypothalamus in medial neurons of the paraventricular nucleus, stimulates the secretion of thyroid-stimulating hormone (TSH) from the pituitary, and TSH stimulates thyroid hormone production and release. An increase in blood thyroid hormone concentration inhibits the production of TRH and TSH (Silvestri et al., 2005). In our study, there were no significant differences in serum TSH and T3 level among the groups; however, serum T4 concentration was decreased in RG and AG extract-treated mice compared with PBS-treated mice after a single injection (1000 mg/kg) and in RG and AG extract-treated mice after four weeks of treatment. The concentration of T3 is not controlled by the thyroid but by the action of the deiodinase enzyme present in various tissues. Further research is required to determine whether ginseng treatment affects the deiodinase enzyme expression and activity. PGE2 is a peripheral fever trigger and rises in blood very quickly after exposure to exogenous or endogenous pyrogens (Skarnes et al., 1981; Shainkin-Kestenbaum et al., 1991; Li et al., 2006). We found that serum PGE2 levels were decreased only in AG extract-treated mice after a single injection. Reduction of pyrogen-related factors, such as T4 and PGE2, is one cause of decreased body temperature and may explain the night-time decrease in body temperature seen in AG extract-treated mice. These results suggest that acute or chronic ginseng extract treatments do not increase heat production-related factors. Brown adipose tissue is the site of heat production linked to energy loss. In this tissue, the expression of the UCP1 gene is increased in response to decreased environmental temperature. UCP1 causes the conversion of driving force of ATP synthesis into heat (Krauss et al., 2005). The expression levels of thermogenesis-related genes, PGC1, UCP-1, and C/EBPs, were increased in the brown adipose tissue of mice exposed to a cold environment (Wang et al., 2013). C/EBPs and PPARs play an important role in the expression of the UCP1 gene (Watanabe et al., 2008). In our study, the mRNA expression of C/EBPβ, PPAR, and UCP1 was not changed by either acute or chronic treatment with RG, WG or AG, whereas cold exposure increased PGC1 and UCP1 mRNA expression. In conclusion, our results do not support the traditional use of Korean ginseng (either the white or red preparations) as an enhancer of metabolism. However, a high dose of American ginseng may have some effect on reducing night-time body temperature, thyroxin and PGE2.
Acknowledgments This research was financially supported by a grant (No. 20100293) from Technology Development Program for Fisheries, Ministry for Food, Agriculture, Forestry and Fisheries. We thank Dr. Ann Kyle for editorial assistance and the Korea Mouse Metabolic Phenotyping Center (KMMPC) for metabolic cage analysis.
186
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
References Albertson, A.J. and D.C. Skinner. A novel animal model to study hot flashes: no effect of gonadotropin-releasing hormone. Menopause 16: 1030–1036, 2009. Azike, C.G., P.A. Charpentier, J. Hou, H. Pei and E.M. King Lui. The Yin and Yang actions of North American ginseng root in modulating the immune function of macrophages. Chin. Med. 6: 21, 2011. Badjatia, N., E. Strongilis, M. Prescutti, L. Fernandez, A. Fernandez, M. Buitrago, J.M. Schmidt and S.A. Mayer. Metabolic benefits of surface counter warming during therapeutic temperature modulation. Crit. Care Med. 37: 1893–1897, 2009. Brown, P.N. Determination of ginsenoside content in Asian and North American ginseng raw materials and finished products by high-performance liquid chromatography: single-laboratory validation. J. AOAC Int. 94: 1391–1399, 2011. Cheng, Y., L.H. Shen and J.T. Zhang. Anti-amnestic and anti-aging effects of ginsenoside Rg1 and Rb1 and its mechanism of action. Acta Pharmacol. Sin. 26: 143–149, 2005. Choo, M.K., E.K. Park, M.J. Han and D.H. Kim. Antiallergic activity of ginseng and its ginsenosides. Planta Med. 69: 518–522, 2003. Hwang, J.W., J.H. Oh, H.S. Yoo, Y.W. Lee, C.K. Cho, K.R. Kwon, J.H. Yoon, J. Park, S. Her, Z.W. Lee, I.S. Jang and J.S. Choi. Mountain ginseng extract exhibits anti-lung cancer activity by inhibiting the nuclear translocation of NF-B. Am. J. Chin. Med. 40: 187–202, 2012. Jeong, H.J., H.N. Koo, N.I. Myung, M.K. Shin, J.W. Kim, D.K. Kim, K.S. Kim, H.M. Kim and Y.M. Lee. Inhibitory effects of mast cell-mediated allergic reactions by cell cultured Siberian Ginseng. Immunopharmacol. Immunotoxicol. 23: 107–117, 2001. Kang, M., H. Yoshimatsu, A. Oohara, M. Kurokawa, R. Ogawa and T. Sakata. Ginsenoside Rg1 modulates ingestive behavior and thermal response induced by interleukin-1 beta in rats. Physiol. Behav. 57: 393–396, 1995. Krauss, S., C.Y. Zhang and B.B. Lowell. The mitochondrial uncoupling-protein homologues. Nat. Rev. Mol. Cell Biol. 6: 248–261, 2005. Kumar, R., S.K. Grover, H.M. Divekar, A.K. Gupta, R. Shyam and K.K. Srivastava. Enhanced thermogenesis in rats by Panax ginseng, multivitamins and minerals. Int. J. Biometeorol. 39: 187–191, 1996. Leao, A.L. and L.C. dos Santos. Micronutrient consumption and overweight: is there a relationship? Rev. Bras. Epidemiol. 15: 85–95, 2012. Li, Z., V. Perlik, C. Feleder, Y. Tang and C.M. Blatteis. Kupffer cell-generated PGE2 triggers the febrile response of guinea pigs to intravenously injected LPS. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290: R1262–1270, 2006. Marazziti, D., A. Di Muro and P. Castrogiovanni. Psychological stress and body temperature changes in humans. Physiol. Behav. 52: 393–395, 1992. Perez-Gallardo, L., M. Gomez, P. Parra, J. Sanchez, A. Palou and F. Serra. Effect of calcium-enriched high-fat diet on calcium, magnesium and zinc retention in mice. Br. J. Nutr. 101: 1463–1466, 2009. Shainkin-Kestenbaum, R., G. Berlyne, S. Zimlichman, H.R. Sorin, M. Nyska and A. Danon. Acute phase protein, serum amyloid A, inhibits IL-1- and TNF-induced fever and hypothalamic PGE2 in mice. Scand. J. Immunol. 34: 179–183, 1991. Silvestri, E., L. Schiavo, A. Lombardi and F. Goglia. Thyroid hormones as molecular determinants of thermogenesis. Acta Physiol. Scand. 184: 265–283, 2005. Skarnes, R.C., S.K. Brown, S.S. Hull and J.A. McCracken. Role of prostaglandin E in the biphasic fever response to endotoxin. J. Exp. Med. 154: 1212–1224, 1981.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
187
Sun, S., L.W. Qi, G.J. Du, S.R. Mehendale, C.Z. Wang and C.S. Yuan. Red notoginseng: higher ginsenoside content and stronger anticancer potential than Asian and American ginseng. Food Chem. 125: 1299–1305, 2011. Tamamoto, L.C., S.J. Schmidt and S.Y. Lee. Sensory profile of a model energy drink with varying levels of functional ingredients-caffeine, ginseng, and taurine. J. Food Sci. 75: S271–278, 2010. Wang, C., T. Xia, Y. Du, Q. Meng, H. Li, B. Liu, S. Chen and F. Guo. Effects of ATF4 on PGC1alpha expression in brown adipose tissue and metabolic responses to cold stress. Metabolism 62: 282–289, 2013. Wang, C.Z., T. Calway and C.S. Yuan. Herbal medicines as adjuvants for cancer therapeutics. Am. J. Chin. Med. 40: 657–669, 2012. Wang, L.C. and T.F. Lee. Effect of ginseng saponins on cold tolerance in young and elderly rats. Planta Med. 66: 144–147, 2000. Watanabe, M., T. Yamamoto, C. Mori, N. Okada, N. Yamazaki, K. Kajimoto, M. Kataoka and Y. Shinohara. Cold-induced changes in gene expression in brown adipose tissue: implications for the activation of thermogenesis. Biol. Pharm. Bull. 31: 775–784, 2008. Yoshimatsu, H., T. Sakata, H. Machidori, K. Fujimoto, A. Yamatodani and H. Wada. Ginsenoside Rg1 prevents histaminergic modulation of rat adaptive behavior from elevation of ambient temperature. Physiol. Behav. 53: 1–4, 1993.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Efficacy Comparison of Korean Ginseng and American Ginseng on Body Temperature and Metabolic Parameters Eun-Young Park,*,† Mi-Hwi Kim,*,† Eung-Hwi Kim,*,† Eun-Kyu Lee,*,† , , In-Sun Park,§ Duck-Choon Yang¶ and Hee-Sook Jun* † ‡ *College
of Pharmacy and Gachon Institute of Pharmaceutical Science †Lee Gil Ya Cancer and Diabetes Institute Gachon University, Incheon, Korea ‡
Gachon Medical Research Institute Gil Hospital, Incheon, Korea
§Department of Pathology, Inha University Hospital Inha University School of Medicine, Incheon, Korea ¶
Korea Ginseng Center for Most Valuable Products and Ginseng Genetic Resource Bank Kyung Hee University, Korea
Abstract: Ginseng has beneficial effects in cancer, diabetes and aging. There are two main varieties of ginseng: Panax ginseng (Korean ginseng) and Panax quinquefolius (American ginseng). There are anecdotal reports that American ginseng helps reduce body temperature, whereas Korean ginseng improves blood circulation and increases body temperature; however, their respective effects on body temperature and metabolic parameters have not been studied. We investigated body temperature and metabolic parameters in mice using a metabolic cage. After administering ginseng extracts acutely (single dose of 1000 mg/kg) or chronically (200 mg/kg/day for four weeks), core body temperature, food intake, oxygen consumption and activity were measured, as well as serum levels of pyrogen-related factors and mRNA expression of metabolic genes. Acute treatment with American ginseng reduced body temperature compared with PBS-treated mice during the night; however, there was no significant effect of ginseng treatment on body temperature after four weeks of treatment. VO2, VCO2, food intake, activity and energy expenditure were unchanged after both acute and chronic ginseng treatment compared with PBS treatment. In acutely treated mice, serum thyroxin levels were reduced by red and American ginseng, and the serum prostaglandin E2
Correspondence to: Dr. Hee Sook Jun, PhD, Lee Gil Ya Cancer and Diabetes Institute, Gachon University, 7-45 Sondo-dong, Yeonsu-ku, Incheon 406-840, Korea Tel: (þ82) 32-899-6056, Fax: (þ82) 32-899-6507, E-mail: [email protected]
173
174
E.-Y. PARK et al. level was reduced by American ginseng. In chronically treated mice, red and white ginseng reduced thyroxin levels. We conclude that Korean ginseng does not stimulate metabolism in mice, whereas a high dose of American ginseng may reduce night-time body temperature and pyrogen-related factors. Keywords: Panax ginseng; Korean Ginseng; Panax quinquefolius; American Ginseng; Body Temperature; Metabolic Parameters.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Introduction Ginseng is a popular plant in traditional Chinese medicine and is also one of the most extensively used medicinal plants in the world, which is evident from annual worldwide sales of over US$3 billion. Ginseng is known to have many pharmacological properties such as anti-cancer, anti-aging and anti-stress effects (Jeong et al., 2001; Choo et al., 2003; Cheng et al., 2005), as well as energy-boosting effects (Tamamoto et al., 2010). There are two main varieties of medicinal ginseng: Panax ginseng C.A. Meyer, which is produced in Korea and China and Panax quinquefolius L., which is mainly produced in North America, including in the United States and Canada (Azike et al., 2011). Yin and Yang is the foundation of the oriental philosophy. They represent the duality of positive (Yang; hot, fire, high and light) and negative (Yin: cold, water, low and dark) forces. Normally Yin and Yang have the same value because one cannot exist without the other. The state of equilibrium is established by balancing Yin and Yang. American ginseng is used to promote Yin energy and calm the body and to reduce the body temperature from a fever or hot weather. On the other hand, Korean ginseng is used to promote Yang energy, improve blood circulation, and revitalize or stabilize the natural “heat” in the body. The heat inside the body can come from many conditions such as menopause, high blood sugar, high cholesterol, and stress (Marazziti et al., 1992; Albertson et al., 2009). There are also anecdotal reports regarding the adverse effects of Korean ginseng, particularly the “hot” feeling (“seungyeol”) after taking ginseng extracts. According to a guide for the herbal health food user, American ginseng, a cooling ginseng, is best taken in the summer and Korean ginseng, a warming ginseng, is best taken in the winter. However, there is no scientific evidence on the effect of Korean or American ginseng on body temperature. In this study, we investigated the effects of Korean ginseng and American ginseng on body temperature, metabolic parameters and thermogenesis-related serum factors and gene expression levels. Materials and Methods Preparation of Ginseng Extracts Five kg of red ginseng (RG, Panax ginseng radix that has been heated and dried), white ginseng (WG, Panax ginseng radix that has been dried without heating) or American ginseng (AG, dried Panax quinquefolium radix) were extracted with 10 times volume of
KOREAN AND AMERICAN GINSENG ON METABOLISM
175
10% ethanol at 85 C for 3 h in a shaking incubator, and this was repeated five times. After filtration using filter paper (ADVANTEC, Dublin, CA, USA), the solvent was removed using an evaporator (EYELA N-N, Tokyo, Japan) at 60 C, and the residue was dissolved in 2.0 L of distilled water. For the administration to mice, extracts were dissolved in phosphate-buffered saline (PBS).
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
HPLC Analysis HPLC-grade acetonitrile and water were purchased from SK Chemicals (Ulsan, Korea). An aliquot of each sample was extracted in n-butanol saturated with H2O and evaporated in vacuum. The residue was dissolved in CH3OH and injected for HPLC analysis. This experiment employed a C18 (250 4:6 mm, ID 5 m) column using acetonitrile (solvent A) and distilled water (solvent B) mobile phases at A/B ratios of 15:85, 21:79, 58:42, 90:10, 90:10, 15:85, and 15:85, with run times of 0–5, 5–25, 25–70, 70–72, 72–82, 82–84, and 84–100 min, respectively. The flow rate was 1.6 ml/min and the sample was detected at UV 203 nm. Animals ICR mice were obtained from Orient Bio (Gyeonggi-do, Korea). Mice were maintained under specific pathogen-free conditions in a temperature-controlled room (23 1 C) in a 12-h light/dark cycle with ad libitum access to food and water at the Animal Care Center, Lee Gil Ya Cancer and Diabetes Institute, Gachon University, South Korea. All animal experiments were approved by the Institutional Animal Care and Use Committee of the Lee Gil Ya Cancer and Diabetes Institute. Treatment with Ginseng Extract Six-week-old male ICR mice were randomly divided into four groups: RG-treated (n ¼ 8), WG-treated (n ¼ 8), AG-treated (n ¼ 8) and PBS-treated (n ¼ 7). For acute treatment, 1000 mg/kg of RG, WG or AG extract in PBS was administered by oral intubation. For chronic treatment, 200 mg/kg of RG, WG or AG was given by oral intubation daily for four weeks. The PBS-treated group was given the same volume of PBS by oral intubation. At the end of the treatment, animals were killed and tissue samples including thyroid gland, hypothalamus and brown adipose tissue were collected for mRNA analysis. Assessment of Core Body Temperature and Metabolic Parameters For core body temperature measurements, emitters were inserted into the peritoneal cavity of mice under ketamine/xylazine anesthesia. Following surgery, mice were allowed one week for recovery. Mice were individually housed in metabolic chambers maintained on a 12-hour light/12-hour dark cycle. Core body temperature and metabolic parameters (oxygen consumption, carbon dioxide production, food intake and activity) were recorded
176
E.-Y. PARK et al.
continuously using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments, Columbus, OH). Following an acclimatization of 12 h, mice were given PBS or ginseng extract at 9:00 A.M. and monitored for 24 h.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Plasma Analysis Blood samples were collected from the orbital sinus under anesthesia 8 h after RG, WG or AG treatment. Blood samples were centrifuged at 3000 g for 20 min, and serum was collected. The concentrations of albumin, Ca 2þ , and Mg 2þ were measured using Beckman Coulter AU 480. Serum cytokine levels were measured using mouse tumor necrosis factor (TNF) and interferon (IFN) ELISA kits (Biolegend). Serum thyroxin (T4), thyroid stimulating hormone (TSH) and 3,5,3 0 -triiodo-L-thyroxine (T3) levels were measured using an ELISA kit (Endocrine Technologies Incorporated). Prostaglandin E2 (PGE2) levels were measured using an EIA kit (Cayman Chemical Company). Analysis of mRNA Expression by Quantitative Real-Time PCR Total RNA was isolated from the brown adipose tissue, and cDNA was synthesized using a PrimeScript TM 1st strand cDNA synthesis kit (Takara). Quantitative real-time PCR was performed using the Power SYBR green Master-mix (Applied-Biosystems) and Applied Biosystem Prism 7900HT sequence detection system. PCR was carried out and stopped at 40 cycles (2 min at 50 C, 10 min at 95 C, and 40 cycles of 10 s at 95 C and 1 min at 60 C). The primer sequences used are shown in Table 1. Relative copy number was calculated using the threshold crossing point (Ct ) as calculated by the Ct calculations. Cold Exposure ICR mice were orally administered RG (1000 mg/kg) in PBS or PBS only. After 2 h, mice were exposed to 4 C for 3 h and sacrificed; brown adipose tissue was then collected.
Table 1. Primer Sequences for qRT-PCR Target C/EBPβ PPAR PPAR UCP1 TSHR TPO mPGES1 mPGES2 COX2 PGC1
Forward Primer
Reverse Primer
CACCAGTGTGAATTACAGCAAATC GCGCAAGAGCCGAGATAAAG GGAGCCATGGATTGCACATT GCTGCGGAAACTTCAGGAAAT GGGTCCCATCTACCAGGAAT GCTCTCTTTGGCAACCTGTC CTCAAGCCCTGCTACCACA AGACATGTCCCTTCTGCA GGGTGTCCCTTCACTTCTTTCA CACTGACAGATGGAGCCGTGA
ACAGGAGAATCTCCCAGAGTTTC CGGTCATTGTCACTGGTCAACT GGCCCGGGAAGTCACTGT AGAGACGTGTCACTCCTGGACTT CACACCATGTCCTCGTTGTC GCCAGCATCTAGGTGGAGAG GGCCTCAGACAAGAGACCAT TCATGGCCTTCATGGGTGGG TGGGAGGCACTTGCATTGA TGTTGGCTGGTGCCAGTAAGAG
KOREAN AND AMERICAN GINSENG ON METABOLISM
177
Table 2. Ginsenoside Content of Korean Ginseng and American Ginseng Extracts as Determined by HPLC Ginsenoside
Rb1
Rb2
Rc
Rd
Re
Rg1
Rf
Korean Ginseng American Ginseng
3.57 18.99
1.6 0.45
2.96 3.21
1.27 3.44
1.18 13.42
0.72 0.48
0.63
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Statistical Analysis Data are presented as means S.E. The significance of differences was analyzed by oneway ANOVA and the Bonferroni procedure using SPSS ver. 10.0 (SPSS Inc.) The value of statistical significance was set at p < 0:05. Results Ginsenoside Contents in Korean Ginseng and American Ginseng Extracts Total ginsenoside content was determined by HPLC analysis (Table 2). Ginsenoside Rb2 and Rg1 content in Korean ginseng was higher than that in American ginseng, while Rb1, Rd and Rc contents in American ginseng were much higher than those in Korean ginseng. Ginsenoside Rf was found only in Korean ginseng. Core Body Temperature in Ginseng Extract-Treated Mice To examine whether ginseng affects body temperature in mice, we measured the core body temperature using a metabolic monitoring system after acute (Fig. 1A) or chronic (Fig. 1C) treatment with RG, WG or AG extracts. In all mice, the average body temperature was slightly increased during the night when the activity was high. We found that there was a slight, but significant, decrease of body temperature in the AG-treated group after acute treatment (Fig. 1B). However, no significant differences in body temperature were seen in RG, WG or AG extract-treated mice after four weeks of treatment (Fig. 1D). Metabolic Parameters in Ginseng Extract-Treated Mice To investigate whether treatment with ginseng extracts affects energy metabolism, we monitored the amount of food intake, oxygen consumption, and activity for 24 h. As expected, food intake was higher during the dark cycle and, in parallel, oxygen consumption and activity were also increased. For mice treated either acutely (Fig. 2) or chronically (Fig. 3), there were no significant differences in oxygen consumption, carbon dioxide production, respiratory exchange ratio, food intake, activity or energy expenditure in RG, WG or AG extract-treated mice.
178
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
(A)
(B)
(C)
(D)
Figure 1. Effect of RG, WG and AG extracts on core body temperature. ICR mice were orally administered RG, WG or AG extract either (A) as a single dose (1000 mg/kg body weight) or (C) daily for 4 weeks (200 mg/kg body weight/day). Core body temperature was measured for (B, D) 24 h [upper panel: hourly temperature over 24 h; lower panel, average of the light cycle (12 h) or dark cycle (12 h) and overall (24 h)]. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow (B, D) indicates time of extract administration. *p < 0:05 compared with the PBS-treated group.
Serum Thyroxine and PGE2 Levels To investigate whether ginseng changes the thermogenesis-related cytokine and hormone secretion, we analyzed the serum levels of TNF, IFN and T4 after acute or chronic treatment with RG, WG or AG extracts. Serum TNF and IFN levels were not detectable
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
(A)
(D)
(B)
(E)
179
(C)
(F)
Figure 2. Effect of acute administration of RG, WG and AG extracts on metabolism. ICR mice were given a single dose of RG, WG or AG extract (1000 mg/kg body weight) or PBS, and (A) oxygen consumption (VO2), (B) carbon dioxide production (VCO2), (C) respiratory exchange ratio (RER), (D) food intake, (E) activity and (F) energy expenditure were measured in a metabolic cage. Upper panel, hourly values; lower panel, averaged values over 24 h. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow indicates time of extract administration.
after treatment with RG, WG or AG extracts (data not shown). After acute treatment, serum T4 was significantly decreased in RG and AG extract-treated mice compared with PBStreated mice, but unchanged in WG-treated mice at 8 h after extract treatment (Fig. 4A upper). As serum T4 levels were changed in RG and AG extract-treated mice, we analyzed the expression of mRNA for thyroid-stimulating hormone receptor (TSHR) and thyroid peroxidase (TPO), which are related to thyroid hormone production, in the thyroid gland after ginseng extract treatment. TSHR mRNA levels were not changed by ginseng treatment, whereas TPO mRNA levels were significantly decreased in RG- and AG-treated
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
180
E.-Y. PARK et al.
(A)
(D)
(B)
(E)
(C)
(F)
Figure 3. Effect of chronic administration of RG, WG and AG extracts on metabolism. ICR mice were given RG, WG or AG extracts (200 mg/kg body weight/day) or PBS daily for four weeks, and (A) oxygen consumption (VO2 Þ, (B) carbon dioxide production (VCO2), (C) respiratory exchange ratio (RER), (D) food intake, (E) activity and (F) energy expenditure were measured in a metabolic cage. Upper panel, hourly values; lower panel, averaged values over 24 h. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. The arrow indicates time of last extract administration.
mice (Fig. 4A lower). Serum PGE2 was decreased in AG extract-treated mice compared with the PBS-treated mice (Fig. 4B upper). As microsomal prostaglandin E synthase-1 (mPGES1), mPGES2 and cyclooxygenase-2 (COX2) are known to be involved in PGE2 production, we assessed whether ginseng treatment could decrease mPGES1, mPGES2 and COX-2 mRNA levels in the hypothalamus. Only mPGES1 mRNA levels were significantly decreased in AG-treated mice (Fig. 4B lower). In mice treated for four weeks, serum T4 levels were significantly decreased in RG and WG extract-treated mice, (Fig. 4C). mRNA expression of TSHR and TPO was decreased in RG-, WG- and AG-treated mice. PGE2 levels were not different in any of the groups treated for four weeks (Fig. 4D).
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
(A)
181
(B)
(C)
(D)
Figure 4. Effect of RG, WG and AG extracts on serum T4 and PGE2 levels. ICR mice were orally administered RG, WG or AG extracts or PBS either (A, B) as a single dose (1000 mg/kg body weight) or (C, D) daily for four weeks (200 mg/kg body weight/day). Thyroxin (T4) and prostaglandin E2 (PGE2) were measured in serum. Thyroid-stimulating hormone receptor (TSHR) and thyroid peroxidase (TPO) mRNA levels were measured in thyroid gland by quantitative real-time PCR. The mRNA levels of mPGES1, mPGES2 and COX-2 were investigated in the hypothalamus. Values are mean S.E. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. *p < 0:05 compared with the PBS group; **p < 0:01 compared with the PBS group.
Mineral supplements may help to optimize metabolism and adaptogenic effects (Kumar et al., 1996). Ca 2þ is reported to be involved in thermogenesis regulation (Perez-Gallardo et al., 2009; Leao et al., 2012). Mg 2þ at high concentration increases the incidence of mild hypothermia and reduces the shivering response in healthy persons (Badjatia et al., 2009). Thus, we investigated whether ginseng treatment can affect plasma mineral levels and
182
E.-Y. PARK et al. Table 3. Serum Mineral Levels after Acute treatment with Ginseng Extracts Albumin Units
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
PBS RG WG AG
2.00 2.05 2.08 2.25
0.16 0.08 0.11 0.11
Ca 2þ Units 9.42 9.48 9.40 9.76
0.23 0.26 0.19 0.32
Mg 2þ Units 1.60 1.58 1.55 1.70
0.04 0.11 0.03 0.06
Note: PBS, control PBS-treated mice, n ¼ 7; RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8. Table 4. Serum Mineral Levels after Chronic Treatment with Ginseng Extracts Ca 2þ Units
Albumin Units PBS RG WG AG
3.03 3.24 3.08 3.17
0.10 0.07 0.05 0.06
10.21 10.16 10.31 10.15
0.18 0.32 0.16 0.20
Mg 2þ Units 2.35 2.24 2.33 2.21
0.14 0.14 0.16 0.09
Note: PBS, control PBS-treated mice, n ¼ 7; RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8.
(A) Figure 5. Effect of RG, WG and AG extracts on gene expression. ICR mice were orally administered RG, WG and AG extract or PBS either (A) as a single dose (1000 mg/kg body weight) or (B) daily for four weeks (200 mg/kg body weight/day). C/EBPβ, PPAR, PPAR and UCP1 mRNA levels were measured in brown adipose tissue by qRT-PCR. (C) ICR mice were orally administered RG extract or PBS as a single dose (1000 mg/kg body weight). Two hours later mice were exposed to 4 C for three hours and PGC-1 and UCP1 mRNA expression in brown adipose tissue was analyzed by qRT-PCR. Values are expressed as fold change compared with the PBS group. Values are mean S.E. RG, red ginseng (Panax ginseng) extract-treated mice, n ¼ 8; WG, white ginseng (Panax ginseng) extract-treated mice, n ¼ 8; AG, American ginseng (Panax quinquefolius) extract-treated mice, n ¼ 8; PBS, control PBS-treated mice, n ¼ 7. *p < 0:05 compared with the PBS group. **p < 0:01 compared with the PBS group.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
183
(B)
(C) Figure 5. (Continued )
albumin. Serum albumin, Ca 2þ and Mg 2þ levels were not different from the control in the RG, WG and AG extract-treated mice after acute or chronic ginseng treatment (Tables 3 and 4). mRNA Expression of Thermogenesis-Related Genes in Brown Adipose Tissue of Ginseng Extract-Treated Mice To investigate whether ginseng treatment changes thermogenesis-related gene expression, we analyzed the mRNA expression of CCAAT-enhancer-binding protein (C/EBP) β, peroxisome proliferator-activated receptor (PPAR), PPAR and uncoupling protein (UCP)1 in brown adipose tissues after acute or chronic treatment with RG, WG or AG extracts. After acute treatment or four weeks of treatment, mRNA expression levels of C/ EBPβ, PPAR, and UCP1 were not changed in the treated groups compared with PBStreated mice (Figs. 5A and 5B). We then examined the mRNA expression of PGC-1 and UCP1 genes after cold exposure. As expected, mRNA levels of PGC1 and UCP1 were significantly increased in mice exposed to cold stress. However, RG treatment had no additive effect on the mRNA expression of PGC1 and UCP1 (Fig. 5C).
184
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
Discussion Ginseng is known to have many beneficial effects on body health and thus is used as a general tonic. Korean ginseng (Panax ginseng), both red and white preparations, and American ginseng (Panax quinquefolius) are most commonly used (Hwang et al., 2012; Wang et al., 2012), but there are some differences among them such as the content of ginsenosides and pharmacological effects (Brown, 2011; Sun et al., 2011). According to traditional Chinese medicine, Korean ginseng promotes the natural “heat” in the body whereas American ginseng is cooling; however, there is no scientific evidence on the effect of Korean or American ginseng on body temperature and metabolism. In this study we compared extracts of red, white and American ginseng for their respective effects on body temperature, energy metabolism, thermogenesis-related serum factors and gene expression levels. We found that a single high-dose WG or RG treatment did not change core temperature, but AG treatment slightly decreased core temperature by 0.6 C during the night compared with PBS-treated mice. However, core temperatures were unchanged in mice treated with ginseng extracts for four weeks. These results suggest that only a single high-dose AG treatment may affect core temperature in a mouse model. We then checked the energy metabolism using a metabolic monitoring system that measures changes in core temperature after administration of extracts in real time. Food intake and energy expenditure in the ginseng extract-treated groups were not different from those of the PBS-treated group, and there were no differences among WG, AG, and RG extract-treated groups. Oxygen consumption and carbon dioxide production, which are needed for energy generation, were also not different from the control or among groups, suggesting that neither Korean nor American ginseng extracts significantly affect heat or energy generation. Ginseng has adaptogenic activity in terms of recovery of body temperature from a hypothermic state. In a cold-hypoxia-restrained animal model, a single dose (0.5 to 2.0 g/g body weight) of Panax ginseng increased the time to attain a colonic temperature of 23 C and decreased the recovery time to attain 37 C (Kumar et al., 1996). In contrast, the infusion of ginsenoside Rg1 into the rat maintained the rectal temperature and attenuated the anorexia induced by elevated temperature (Yoshimatsu et al., 1993). Rg1 maintained constant histamine levels, which were increased in response to elevated temperature. These results suggest that Rg1 may block the relay of ambient temperature-related information into the hypothalamic histamine neurons in the rat (Yoshimatsu et al., 1993). Administration of ginsenoside Rg1 also reversed the suppressed ingestive behavior and elevated rectal temperature induced by interleukin-1 beta, an endogenous pyrogen (Kang et al., 1995). Ginseng saponin obtained from the roots of Panax quinquefolius improved cold tolerance under severe cold conditions (10 C under helium-oxygen) (Wang et al., 2000); both young and old rats in cold temperature benefited from this treatment for enhanced cold tolerance. Therefore, ginseng extract may help in the regulation of insufficient or excessive responses, rather than the enhancement of thermogenesis or energy metabolism. Thyroid hormones are major regulators of thermogenesis and energy metabolism and stimulate some processes that may generate heat in warm-blooded species (Silvestri et al.,
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
185
2005). T3 plays a role in facultative thermogenesis and is thought to regulate the uncoupling protein expression under cold conditions (Silvestri et al., 2005). The secretion of thyroid hormone is regulated by a classic negative feedback loop. Thyroid-releasing hormone (TRH), produced by the hypothalamus in medial neurons of the paraventricular nucleus, stimulates the secretion of thyroid-stimulating hormone (TSH) from the pituitary, and TSH stimulates thyroid hormone production and release. An increase in blood thyroid hormone concentration inhibits the production of TRH and TSH (Silvestri et al., 2005). In our study, there were no significant differences in serum TSH and T3 level among the groups; however, serum T4 concentration was decreased in RG and AG extract-treated mice compared with PBS-treated mice after a single injection (1000 mg/kg) and in RG and AG extract-treated mice after four weeks of treatment. The concentration of T3 is not controlled by the thyroid but by the action of the deiodinase enzyme present in various tissues. Further research is required to determine whether ginseng treatment affects the deiodinase enzyme expression and activity. PGE2 is a peripheral fever trigger and rises in blood very quickly after exposure to exogenous or endogenous pyrogens (Skarnes et al., 1981; Shainkin-Kestenbaum et al., 1991; Li et al., 2006). We found that serum PGE2 levels were decreased only in AG extract-treated mice after a single injection. Reduction of pyrogen-related factors, such as T4 and PGE2, is one cause of decreased body temperature and may explain the night-time decrease in body temperature seen in AG extract-treated mice. These results suggest that acute or chronic ginseng extract treatments do not increase heat production-related factors. Brown adipose tissue is the site of heat production linked to energy loss. In this tissue, the expression of the UCP1 gene is increased in response to decreased environmental temperature. UCP1 causes the conversion of driving force of ATP synthesis into heat (Krauss et al., 2005). The expression levels of thermogenesis-related genes, PGC1, UCP-1, and C/EBPs, were increased in the brown adipose tissue of mice exposed to a cold environment (Wang et al., 2013). C/EBPs and PPARs play an important role in the expression of the UCP1 gene (Watanabe et al., 2008). In our study, the mRNA expression of C/EBPβ, PPAR, and UCP1 was not changed by either acute or chronic treatment with RG, WG or AG, whereas cold exposure increased PGC1 and UCP1 mRNA expression. In conclusion, our results do not support the traditional use of Korean ginseng (either the white or red preparations) as an enhancer of metabolism. However, a high dose of American ginseng may have some effect on reducing night-time body temperature, thyroxin and PGE2.
Acknowledgments This research was financially supported by a grant (No. 20100293) from Technology Development Program for Fisheries, Ministry for Food, Agriculture, Forestry and Fisheries. We thank Dr. Ann Kyle for editorial assistance and the Korea Mouse Metabolic Phenotyping Center (KMMPC) for metabolic cage analysis.
186
E.-Y. PARK et al.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
References Albertson, A.J. and D.C. Skinner. A novel animal model to study hot flashes: no effect of gonadotropin-releasing hormone. Menopause 16: 1030–1036, 2009. Azike, C.G., P.A. Charpentier, J. Hou, H. Pei and E.M. King Lui. The Yin and Yang actions of North American ginseng root in modulating the immune function of macrophages. Chin. Med. 6: 21, 2011. Badjatia, N., E. Strongilis, M. Prescutti, L. Fernandez, A. Fernandez, M. Buitrago, J.M. Schmidt and S.A. Mayer. Metabolic benefits of surface counter warming during therapeutic temperature modulation. Crit. Care Med. 37: 1893–1897, 2009. Brown, P.N. Determination of ginsenoside content in Asian and North American ginseng raw materials and finished products by high-performance liquid chromatography: single-laboratory validation. J. AOAC Int. 94: 1391–1399, 2011. Cheng, Y., L.H. Shen and J.T. Zhang. Anti-amnestic and anti-aging effects of ginsenoside Rg1 and Rb1 and its mechanism of action. Acta Pharmacol. Sin. 26: 143–149, 2005. Choo, M.K., E.K. Park, M.J. Han and D.H. Kim. Antiallergic activity of ginseng and its ginsenosides. Planta Med. 69: 518–522, 2003. Hwang, J.W., J.H. Oh, H.S. Yoo, Y.W. Lee, C.K. Cho, K.R. Kwon, J.H. Yoon, J. Park, S. Her, Z.W. Lee, I.S. Jang and J.S. Choi. Mountain ginseng extract exhibits anti-lung cancer activity by inhibiting the nuclear translocation of NF-B. Am. J. Chin. Med. 40: 187–202, 2012. Jeong, H.J., H.N. Koo, N.I. Myung, M.K. Shin, J.W. Kim, D.K. Kim, K.S. Kim, H.M. Kim and Y.M. Lee. Inhibitory effects of mast cell-mediated allergic reactions by cell cultured Siberian Ginseng. Immunopharmacol. Immunotoxicol. 23: 107–117, 2001. Kang, M., H. Yoshimatsu, A. Oohara, M. Kurokawa, R. Ogawa and T. Sakata. Ginsenoside Rg1 modulates ingestive behavior and thermal response induced by interleukin-1 beta in rats. Physiol. Behav. 57: 393–396, 1995. Krauss, S., C.Y. Zhang and B.B. Lowell. The mitochondrial uncoupling-protein homologues. Nat. Rev. Mol. Cell Biol. 6: 248–261, 2005. Kumar, R., S.K. Grover, H.M. Divekar, A.K. Gupta, R. Shyam and K.K. Srivastava. Enhanced thermogenesis in rats by Panax ginseng, multivitamins and minerals. Int. J. Biometeorol. 39: 187–191, 1996. Leao, A.L. and L.C. dos Santos. Micronutrient consumption and overweight: is there a relationship? Rev. Bras. Epidemiol. 15: 85–95, 2012. Li, Z., V. Perlik, C. Feleder, Y. Tang and C.M. Blatteis. Kupffer cell-generated PGE2 triggers the febrile response of guinea pigs to intravenously injected LPS. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290: R1262–1270, 2006. Marazziti, D., A. Di Muro and P. Castrogiovanni. Psychological stress and body temperature changes in humans. Physiol. Behav. 52: 393–395, 1992. Perez-Gallardo, L., M. Gomez, P. Parra, J. Sanchez, A. Palou and F. Serra. Effect of calcium-enriched high-fat diet on calcium, magnesium and zinc retention in mice. Br. J. Nutr. 101: 1463–1466, 2009. Shainkin-Kestenbaum, R., G. Berlyne, S. Zimlichman, H.R. Sorin, M. Nyska and A. Danon. Acute phase protein, serum amyloid A, inhibits IL-1- and TNF-induced fever and hypothalamic PGE2 in mice. Scand. J. Immunol. 34: 179–183, 1991. Silvestri, E., L. Schiavo, A. Lombardi and F. Goglia. Thyroid hormones as molecular determinants of thermogenesis. Acta Physiol. Scand. 184: 265–283, 2005. Skarnes, R.C., S.K. Brown, S.S. Hull and J.A. McCracken. Role of prostaglandin E in the biphasic fever response to endotoxin. J. Exp. Med. 154: 1212–1224, 1981.
Am. J. Chin. Med. 2014.42:173-187. Downloaded from www.worldscientific.com by FLINDERS UNIVERSITY LIBRARY on 10/06/14. For personal use only.
KOREAN AND AMERICAN GINSENG ON METABOLISM
187
Sun, S., L.W. Qi, G.J. Du, S.R. Mehendale, C.Z. Wang and C.S. Yuan. Red notoginseng: higher ginsenoside content and stronger anticancer potential than Asian and American ginseng. Food Chem. 125: 1299–1305, 2011. Tamamoto, L.C., S.J. Schmidt and S.Y. Lee. Sensory profile of a model energy drink with varying levels of functional ingredients-caffeine, ginseng, and taurine. J. Food Sci. 75: S271–278, 2010. Wang, C., T. Xia, Y. Du, Q. Meng, H. Li, B. Liu, S. Chen and F. Guo. Effects of ATF4 on PGC1alpha expression in brown adipose tissue and metabolic responses to cold stress. Metabolism 62: 282–289, 2013. Wang, C.Z., T. Calway and C.S. Yuan. Herbal medicines as adjuvants for cancer therapeutics. Am. J. Chin. Med. 40: 657–669, 2012. Wang, L.C. and T.F. Lee. Effect of ginseng saponins on cold tolerance in young and elderly rats. Planta Med. 66: 144–147, 2000. Watanabe, M., T. Yamamoto, C. Mori, N. Okada, N. Yamazaki, K. Kajimoto, M. Kataoka and Y. Shinohara. Cold-induced changes in gene expression in brown adipose tissue: implications for the activation of thermogenesis. Biol. Pharm. Bull. 31: 775–784, 2008. Yoshimatsu, H., T. Sakata, H. Machidori, K. Fujimoto, A. Yamatodani and H. Wada. Ginsenoside Rg1 prevents histaminergic modulation of rat adaptive behavior from elevation of ambient temperature. Physiol. Behav. 53: 1–4, 1993.
