G Model PRP-51147; No. of Pages 5
ARTICLE IN PRESS Pathology – Research and Practice xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original Article
EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix Arno Dimmler 1 , Helene Geddert 1 , Gerhard Faller ∗ Institute of Pathology, St. Vincent’s Hospital, Karlsruhe, Germany
a r t i c l e
i n f o
Article history: Received 23 August 2013 Received in revised form 20 November 2013 Accepted 13 January 2014 Keywords: Goblet cell carcinoid EGFR KRAS BRAF MSI Pyrosequencing
a b s t r a c t Goblet cell carcinoid (GCC) is a rare type of mixed endocrine–exocrine tumor of the appendix often showing a clinically aggressive behavior. On a molecular basis, this tumor is only poorly understood. To analyze possible molecular similarities between GCC and colorectal cancer, we examined 14 cases of GCC for mutations in exons 18, 19 and 21 of the EGFR-gene, exon 2 in the KRAS gene and for V600E mutations of the BRAF gene. Although the sensitive pyrosequencing method was used, no EGFR, KRAS or BRAF mutations could be found. Furthermore, using immunohistochemistry, no evidence for microsatellite instabillity (MSI) could be found. Despite the partial intestinal differentiation of GCC, our study indicates that the molecular pathogenesis of GCC significantly differs from conventional colorectal adenocarcinoma. This finding might also have implications in adjuvant chemotherapeutic treatment of advanced GCC. © 2014 Elsevier GmbH. All rights reserved.
Introduction Goblet cell carcinoid (GCC) of the appendix is a rare type of tumor [1,2]. The incidence of GCC is estimated to be one tenth of that for conventional appendiceal carcinoids [3]. GCCs show a mixed phenotype, with partial neuroendocrine and intestinal goblet cell differentiation [4,5]. Neuroendocrine characteristics can be demonstrated by expression of neuroendocrine markers such as Chromogranin A and Synaptophysin, whereas intestinal differentiation is proved by goblet cell morphology as well as expression of MUC2 and CDX2 [6]. Some of the GCCs might behave little aggressively. However, in a subset of cases, progression to adenocarcinoma ex GCC was described [7]. In general, prognosis of GCC is much poorer than that of conventional appendiceal carcinoid tumors. Up to 80% of GCC show peritoneal dissemination particularly to the ovaries. Some patients with GCC might be cured by simple appendectomy. However, in many cases, right hemicolectomy is the surgical treatment of choice. Additional chemotherapy might be necessary [3]. Genetic alterations of members of the EGF signaling cascade, such as KRAS and BRAF, play a pivotal role in the pathogenesis,
prognosis and treatment of colorectal adenocarcinoma [8]. In contrast to conventional adenocarcinoma of the colorectum, the molecular pathogenesis of GCC is only poorly investigated. Allelic loss of 11q, 16q and 18q has been suggested to play a role in the pathogenesis of these tumors in one study [9]. Three studies investigated the mutations status of the KRAS gene in GCC and found KRAS mutations at codon 12 of the exon 2 in only one single case [6,9,10]. EGFR gene mutations can be found in 0.3–12% of colorectal cancers [11,12]. In addition, EGFR mutations are prevalent in about 10% of non-small cell lung cancers, including large cell neuroendocrine lung cancer and predict responsiveness to antiEGFR-directed therapy [12,13]. In our study, we aimed to analyze whether the molecular alterations which are clinically relevant in common colorectal adenocarcinomas can also be found in GCC. For this, we investigated EGFR, KRAS and BRAF mutation status in a series of GCC by pyrosequencing, a relatively new sequencing approach. This method has been shown to be more sensitive than conventional Sanger sequencing [14,15]. Additionally, we screened all cases for microsatellite instability (MSI) by immunohistochemistry [16]. Materials and methods
∗ Corresponding author at: Institute of Pathology, St. Vincent’s Hospital, Suedendstrasse 37, 76137 Karlsruhe, Germany. Tel.: +49 721 81083013; fax: +49 721 81083700. E-mail address: [email protected] (G. Faller). 1 Both authors contributed equally to this work.
Tissue and antibodies In the archive our institute, 14 cases with GCC of the appendix were identified.
0344-0338/$ – see front matter © 2014 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2014.01.002
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
2
All formalin-fixed and paraffin-embedded GCC specimens were histologically re-evaluated in H&E and PAS-stained sections according to routine protocols. Additional immunohistochemistry was performed using antibodies against synaptophysin and CDX2 (diluted 1:150, DCS, Germany) to prove the neuroendocrine and intestinal differentiation. To screen for MSI, tissue was immunostained with murine antibodies against mismatch repair proteins MLH1 (diluted 1:100, Novocastra, UK), MSH2 (diluted 1:50, Novocastra, UK), PMS2 (diluted 1:100, Zytomed, Germany) and MSH6 (diluted 1:50, Zytomed, Germany). For antigen retrieval, sections were incubated for 30 min in a heat steamer with citrate buffer pH 6.0 (MLH1 and MSH2) or with EDTA pH 9.0 (PMS2 and MSH6). After applying primary antibodies, biotinylated secondary goat antibodies (Polylink DetectionLine, DCS, Hamburg, Germany) were added. Color was developed using DAB (DCS, Hamburg, Germany). Immunostaining was carried out by an OptiMax 2.0 Immunostainer (Biogenex, CA). Non-tumor tissue on the slide was used as internal control. Tumor classification was performed according to the 7th edition of the TNM classification of Malignant Tumors of the UICC [17]. Pyrosequencing Tumor areas marked by a pathologist on hematoxylin-eosinstained slides were microdissected on corresponding deparaffinized and hydrated slide samples and tumor tissue was collected in a microtube. After adding 180 l Higuchi buffer and 20 l proteinase K samples were incubated overnight at 56 ◦ C and finally denatured at 94 ◦ C for 10 min. Mutation analysis for KRAS exon 2 codons 12, 13 and 61 was performed using Pyromark Q24 kras V2.0 (Qiagen, Hilden, Germany) according to manufacturer’s protocol. For EGFR exon 18, 19 and 21 and BRAF exon 15, 5 l of tissue lysate was added to PCR mixture containing dNTPs (each 200 M), 1.5 mM MgCl2 , 50 mM KCl, 30 mM Tris–HCl, 0.2% Igepal® -CA630, Taq polymerase (1.25units; 5Prime, Hamburg, Germany), forward and reverse primers (400 nM each, see Tables 1 and 2) and water to a final volume of 50 l. PCR was conducted using following temperatures: 4 min at 95 ◦ C, 35 cycles 30 s at 95 ◦ C, 30 s at 60 ◦ C and 30 s at 72 ◦ C followed by 7 min at 72 ◦ C. For EGFR, nested PCR was performed using 5 l of PCR product in a second round PCR with corresponding primer (500 nM, see Table 1). Amplicon size was as follows: EGFR exon 18 234 bp, exon 19 158 bp, exon 21 264 bp and BRAF 92 bp. 6–20 l of PCR products was purified and denatured in vaccum preparation procedure using streptavidin-coupled sepharose beads as described in the manufacturer’s protocol for Pyromark Q24 (Qiagen, Hilden, Germany). Pyrosequencing was performed using corresponding sequencing primers (500 nM, see Table 1) and dispensation orders (see Tables 1 and 2). Pyrograms were analyzed using t-test statistics. For verification of our sequence studies, five consecutively investigated sessile serrated adenomas of the right-sided colon and 10 distal colorectal carcinomas served as controls for BRAF and KRAS mutations, respectively. For mutations of EGFR, non small cell lung cancers harboring mutations in hotspot regions of exon 18, 19 and 21 were used as controls. Moreover, the accuracy of the applied pyrosequencing method was externally validated and proved by repeated and successful participation in the respective round robin test performed by the German Society of Pathology.
Table 1 Primer sequences for EGFR-mutation analysis. EGFR First round nested PCR exon18F1 exon18R1 exon19F1 exon19R1 exon21F1 exon21R1
GCATGGTGAGGGCTGAGGTGA CCCCACCAGACCATGAGAGGC TGCCAGTTAACGTCTTCCTTC CCACACAGCAAAGCAGAAAC AGCTTCTTCCCATGATGATCTGTCC GGCAGCCTGGTCCCTGGTGTC
Second round nested PCR exon18F2 exon18R2 exon19F2.1 exon19R2.1 exon19F2.2 exon19R2.2 exon21F2 exon21R2
biotin-ACCCTTGTCTCTGTGTTCTTGTCCC GCCCAGCCCAGAGGCCTGTG AACGTCTTCCTTCTCTCTCTG biotin-CCACACAGCAAAGCAGAAAC biotin-AACGTCTTCCTTCTCTCTCTG CCACACAGCAAAGCAGAAAC TCCCATGATGATCTGTCCCTCACA biotin-CAGGAAAATGCTGGCTGACCTAAAG
Sequencing primers exon18S exon19S exon19Scomplementary exon21S
GCCGAACGCACCGGA AATTCCCGTCGCTAT AGAAACTCACATCGAGG AAGATCACAGATTTTGG
Sequence to analyze exon18 exon19 exon19complementary
GCCCAGCACTTTGAT CAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTC ATTTCCTTGTTGGCTTTCGGAGATGTTGCTTC-
exon21
TCTTAATTCCTT GCTGGCCAAACTGCT
Dispensation order exon18 exon19 exon19complementary exon21
ATCGCTACAGCACTC GATCAGATAGAGAGCACATCTCGAGCACAGATCTCATC GCTATCTGTGCTCGAGATGTGCTCTCTATCTA TGCAGTGTAGCAGCATGCT
Table 2 Primer sequences for BRAF-mutation analysis. BRAF PCR brafF brafR Sequencing primer brafS Sequence to analyze braf Dispensation order braf
TGAAGACCTCACAGTAAAAATAGG biotin-ATCCAGACAACTGTTCAAACTGAT GGTGATTTTGGTCTAGCT ACAGTGAAATCTCGATGGAG GACGTAGATGATGCTCGCT
of the appendix. Tumors of all patients showed typical morphology of GCC, including neuroendocrine differentiation with expression of synaptophysin and/or chromogranin, mucin production and nuclear expression of CDX2 (Fig. 1). According to the 7th edition of the UICC TNM-System [17], 4 patients had pT2 tumors, 7 patients had pT3 tumors and 3 patients had pT4 tumors. Eight of the patients were treated with right hemicolectomy. Four of these patients (50%) showed regional lymph node metastasis and two of them (25%) disseminated peritoneal disease. Six patients were treated with appendectomy. Patients’ characteristics are summarized in Table 3.
Results Expression of mismatch repair proteins Patients’ characteristics Between 1997 and 2010, 14 patients (mean age 60.3 years, range 44–83 years, 9 males, 5 females) were diagnosed with GCC
All 14 GCC testes showed nuclear expression of MLH1, MSH2, MSH6 and PMS2 in both, the intestinal and neuroendocrine parts of GCC. Representative immunostainings are shown in Fig. 2.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model
ARTICLE IN PRESS
PRP-51147; No. of Pages 5
A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
3
Fig. 1. Histology and immunohistochemistry of goblet cell carcinoid of the appendix. Representative sections of a case stained with H&E (a) and PAS (b) as well as immunohistochemistry with antibodies against synaptophysin (c) and CDX2 (d). Magnification ×200.
Table 3 Clinical and pathological data of 14 GCCs included in this study. Case
Age
Sex
pT
pN
pM
1 2 3 4 5 6 7 8 9 10 11 12 13 14
44 72 71 65 58 63 44 60 65 40 83 57 65 57
m m m m f f m m f m m m f f
3 3 4 2 2 4 3 3 2 3 3 4 2 3
0/19 n.a. 4/16 0/15 n.a. 4/8 0/12 n.a. 0/25 n.a. n.a. 5/13 n.a. 1/12
M0 n.a. pM0 pM0 n.a. pM1(PER) pM0 n.a. pM0 n.a. n.a. pM1(PER) n.a. pM0
EGFR, KRAS, BRAF mutation status As expected, all five sessile serrated adenomas of the right colon showed V600E mutations in the BRAF gene. Six out of ten distal colorectal carcinomas had mutated KRAS (4 in codon 12, one in codon 13 and codon 61). Four of these carcinomas had wild-type KRAS. None of the 14 cases with GCC showed mutations in the analyzed hot spot regions of the EGFR, KRAS and BRAF genes (Fig. 3). Discussion Appendiceal GCC represents a unique entity. Compared with other neuroendocrine tumors of the appendix, this uniqueness
is highlighted by low frequency, different epidemiology, special morphology, mixed differentiation and poor clinical outcome [18]. Intestinal location and differentiation, as well as tumor morphology and aggressive nature, suggest that GCC might be related to conventional colorectal adenocarcinoma also on a molecular basis. This could then also justify a similar therapeutic approach. Colorectal adenocarcinomas are known to harbor genetic alterations in KRAS and BRAF genes. Left sided sporadic colorectal cancers typically result from the adenoma-carcinoma-sequence and show exon 2 mutations at codons 12, 13 and 61 in about 40% of cases [19]. In contrast, about 10% of colon cancers show V600E mutations in the BRAF gene. These cancers are typically right sided and result from the serrated pathway [20]. The detection of KRAS mutations in colon cancer is predictive for responsiveness to antiEGFR therapy. The presence of BRAF mutations in colorectal cancer is a indicator for poor prognosis, particularly when tumors are microsatellite-stable [21,22]. MSI is also a molecular feature of colorectal carcinoma and can be found in about 15% of cases. MSI, which is mainly found in right sided carcinomas, serves a marker of good prognosis even in cases with high-grade cytologic morphology such as medullary carcimoma [23]. KRAS and BRAF mutations and MSI are not only features of colorectal carcinoma but also occur frequently in appendiceal tumors of common intestinal differentiation [24–26]. However, although appendiceal GCC display intestinal features, we could not detect any KRAS mutations. This is in agreement with previous findings [9,10] which also were unable to detect these mutations in 38 cases. Only van Eeden was able to detect a single KRAS mutated case out of 16 GCCs [6]. To our knowledge, this is the first study to investigate BRAF mutations status in GCC. Although we used the sensitive pyrosequencing method, we did not find any
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5 4
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
Fig. 2. Immunohistochemical analysis of microsatellite stability. Nuclear expression of MLH1 (a) and MSH2 (b) in goblet cell carcinoid. MSH6 and PMS2 were also expressed in all cases (data not shown). Magnification ×200.
mutations at the hotspot region at codon 600 of the gene. Additionally, in immunohistochemical analysis, no evidence of MSI could be found. This result is in agreement with a study of Taggart et al., who also were unable to find MSI in 9 cases of GCC using molecular techniques [26]. Taken together, these results strongly indicate
that the molecular pathogenesis of GCC is different from colorectal adenocarcinoma. Non-small cell lung cancer harbors mutations in exons 18, 19 and 21 of the EGFR gene in about 10–15% of cases. These mutations are predictive for responsiveness to anti-EGFR therapy [27]. It seems obvious that also large cell neurondocrine carcinomas of the lung show these mutations in a similar frequency [13,28]. In our study, comprising 14 cases, we did not find any EGFR mutations. Due to the limited number of cases investigated, this does not rule out that GCC share some molecular similarities with large cell neuroendocrine cancers of the lung. However, further evidence for such a hypothesis could not be found in this study. Poorly differentiated neuroendocrine carcinomas of the colorectum have been shown to harbor KRAS or BRAF mutations in 60% of cases [29]. This figure corresponds with colorectal adenocarcinoma and is clearly different from the data of our study. Therefore we conclude that the molecular pathogenesis of appendiceal GCC and of poorly differentiated neuroendocrine colorectal carcimomas is dissimilar. In well-differentiated gastrointestinal neuroendocrine tumors (NET) KRAS and BRAF mutations and of MSI are very infrequent. In three studies comprising 58 cases of primary gastrointestinal and pancreatic well-differentiated NET, no activating KRAS mutations could be found [30–32]. Furthermore, only 2 out of 113 (2%) well differentiated pancreatic or gastrointestinal NET showed BRAF mutations [30,33,34]. Finally, all 118 cases of well differentiated NET of the gastrointestinal tract investigated by Arnold et al. were microsatellite stable [35]. This is the first study analyzing possible EGFR, KRAS and BRAF mutations and MSI within the same collection of GCC. We found no evidence for molecular similarities between GCC and colorectal adenocarcinoma, poorly differentiated neuroendorcine carcinoma of the colorectum and large cell neuroendocrine carcinoma of the lung. From the results of our study we conclude that with regard to the markers tested, GCC are comparable to well differentiated NET of the gastrointestinal tract. We therefore conclude that in contrast to colorectal adenocarcinomas, GCCs cannot be prognostically estimated according to their KRAS, BRAF or MSI status. Despite the aggressive nature of GCCs, our observations indicate that antiEGFR treatment,which is established for a subset of colorectal and pulmonary adenocarcinomas, might not be an option for GCC.
Fig. 3. Representative examples of pyrograms for sequence analysis of KRAS codon 12/13 in goblet cell carcinoid (a) and colorectal carcinoma (b), of BRAF codon600 in goblet cell carcinoid (c) and sessile serrated adenoma (d) and of EGFR exon21 in goblet cell carcinoid (e) and non-small cell lung carcinoma (f). Mutations are indicated by arrows.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
Conflict of interest The authors declare that they have no conflict of interest. Acknowledgement The authors wish to thank Ines Kreuscher and Stefanie Lechner for expert technical assistance. References [1] M.L. McGory, M.A. Maggard, H. Kang, J.B. O’Connell, C.Y. Ko, Malignancies of the appendix: beyond case series reports, Dis Colon Rectum 48 (2005) 2264–2271. [2] P. Roy, R. Chetty, Goblet cell carcinoid tumors of the appendix: an overview, World J Gastrointest Oncol 2 (2010) 251–258. [3] U. Plockinger, A. Couvelard, M. Falconi, A. Sundin, R. Salazar, E. Christ, W.W. de Herder, D. Gross, W.H. Knapp, U.P. Knigge, M.H. Kulke, U.F. Pape, Frascati Consensus Conference, Consensus guidelines for the management of patients with digestive neuroendocrine tumours: well-differentiated tumour/carcinoma of the appendix and goblet cell carcinoma, Neuroendocrinology 87 (2008) 20–30. [4] L.H. Tang, Epithelial neoplasms of the appendix, Arch Pathol Lab Med 134 (2010) 1612–1620. [5] L. Deschamps, A. Couvelard, Endocrine tumors of the appendix: a pathologic review, Arch Pathol Lab Med 134 (2010) 871–875. [6] S. van Eeden, G.J. Offerhaus, A.A. Hart, L. Boerrigter, P.M. Nederlof, E. Porter, M.L. van Velthuysen, Goblet cell carcinoid of the appendix: a specific type of carcinoma, Histopathology 51 (2007) 763–773. [7] L.H. Tang, J. Shia, R.A. Soslow, D. Dhall, W.D. Wong, E. O’Reilly, J. Qin, P. Paty, M.R. Weiser, J. Guillem, L. Temple, L.H. Sobin, D.S. Klimstra, Pathologic classification and clinical behavior of the spectrum of goblet cell carcinoid tumors of the appendix, Am J Surg Pathol 32 (2008) 1429–1443. [8] V. Heinemann, S. Stintzing, T. Kirchner, S. Boeck, A. Jung, Clinical relevance of EGFR- and KRAS-status in colorectal cancer patients treated with monoclonal antibodies directed against the EGFR, Cancer Treat Rev 35 (2009) 262–271. [9] M. Stancu, T.T. Wu, C. Wallace, P.S. Houlihan, S.R. Hamilton, A. Rashid, Genetic alterations in goblet cell carcinoids of the vermiform appendix and comparison with gastrointestinal carcinoid tumors, Mod Pathol 16 (2003) 1189–1198. [10] D.M. Ramnani, I.I. Wistuba, C. Behrens, A.F. Gazdar, L.H. Sobin, J. AlboresSaavedra, K-ras and p53 mutations in the pathogenesis of classical and goblet cell carcinoids of the appendix, Cancer 86 (1999) 14–21. [11] T.D. Barber, B. Vogelstein, K.W. Kinzler, V.E. Velculescu, Somatic mutations of EGFR in colorectal cancers and glioblastomas, N Engl J Med 351 (2004) 2883. [12] H. Nagahara, K. Mimori, M. Ohta, T. Utsunomiya, H. Inoue, G.F. Barnard, M. Ohira, K. Hirakawa, M. Mori, Somatic mutations of epidermal growth factor receptor in colorectal carcinoma, Clin Cancer Res 11 (2005) 1368–1371. [13] A. Iyoda, W.D. Travis, I.S. Sarkaria, S.X. Jiang, H. Amano, Y. Sato, M. Saegusa, V.W. Rusch, Y. Satoh, Expression profiling and identification of potential molecular targets for therapy in pulmonary large-cell neuroendocrine carcinoma, Exp Ther Med 2 (2011) 1041–1045. [14] A.C. Tsiatis, A. Norris-Kirby, R.G. Rich, M.J. Hafez, C.D. Gocke, J.R. Eshleman, K.M. Murphy, Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications, J Mol Diagn 12 (2010) 425–432. [15] J. Gao, Y.Y. Li, P.N. Sun, L. Shen, Comparative analysis of dideoxy sequencing, the KRAS StripAssay and pyrosequencing for detection of KRAS mutation, World J Gastroenterol 16 (2010) 4858–4864. [16] J. Shia, Immunohistochemistry versus microsatellite instability testing for screening colorectal cancer patients at risk for hereditary nonpolyposis colorectal cancer syndrome. Part I. The utility of immunohistochemistry, J Mol Diagn 10 (2008) 293–300. [17] M.K. Gospodarowicz, L.H. Sobin, Ch. Wittekind, TNM classification of malignant tumours, John Wiley & Sons, Chichester, West Sussex, 2010.
5
[18] N. Holt, H. Gronbaek, Goblet cell carcinoids of the appendix, Sci World J 2013 (2013) 543696. [19] J. Neumann, E. Zeindl-Eberhart, T. Kirchner, A. Jung, Frequency and type of KRAS mutations in routine diagnostic analysis of metastatic colorectal cancer, Pathol Res Pract 205 (2009) 858–862. [20] J.R. Jass, Classification of colorectal cancer based on correlation of clinical, morphological and molecular features, Histopathology 50 (2007) 113–130. [21] G. Safaee Ardekani, S.M. Jafarnejad, L. Tan, A. Saeedi, G. Li, The prognostic value of BRAF mutation in colorectal cancer and melanoma: a systematic review and meta-analysis, PLoS ONE 7 (2012) e47054. [22] R.K. Pai, P. Jayachandran, A.C. Koong, D.T. Chang, S. Kwok, L. Ma, D.A. Arber, R.R. Balise, R.R. Tubbs, B. Shadrach, R.K. Pai, BRAF-mutated, microsatellite-stable adenocarcinoma of the proximal colon: an aggressive adenocarcinoma with poor survival, mucinous differentiation, and adverse morphologic features, Am J Surg Pathol 36 (2012) 744–752. [23] E. Vilar, S.B. Gruber, Microsatellite instability in colorectal cancer-the stable evidence, Nat Rev Clin Oncol 7 (2010) 153–162. [24] R.K. Yantiss, A. Panczykowski, J. Misdraji, H.P. Hahn, R.D. Odze, H. Rennert, Y.T. Chen, A comprehensive study of nondysplastic and dysplastic serrated polyps of the vermiform appendix, Am J Surg Pathol 31 (2007) 1742–1753. [25] P. Zauber, E. Berman, S. Marotta, M. Sabbath-Solitare, T. Bishop, Ki-ras gene mutations are invariably present in low-grade mucinous tumors of the vermiform appendix, Scand J Gastroenterol 46 (2011) 869–874. [26] M.W. Taggart, J. Galbincea, P.F. Mansfield, K.F. Fournier, R.E. Royal, M.J. Overman, A. Rashid, S.C. Abraham, High-level microsatellite instability in appendiceal carcinomas, Am J Surg Pathol 37 (2013) 1192–1200. [27] R. Rosell, T. Moran, C. Queralt, R. Porta, F. Cardenal, C. Camps, M. Majem, G. Lopez-Vivanco, D. Isla, M. Provencio, A. Insa, B. Massuti, J.L. Gonzalez-Larriba, L. Paz-Ares, I. Bover, R. Garcia-Campelo, M.A. Moreno, S. Catot, C. Rolfo, N. Reguart, R. Palmero, J.M. Sanchez, R. Bastus, C. Mayo, J. Bertran-Alamillo, M.A. Molina, J.J. Sanchez, G. Taron, Spanish lung cancer, screening for epidermal growth factor receptor mutations in lung cancer, N Engl J Med 361 (2009) 958–967. [28] T.M. De Pas, M. Giovannini, M. Manzotti, G. Trifiro, F. Toffalorio, C. Catania, L. Spaggiari, R. Labianca, M. Barberis, Large-cell neuroendocrine carcinoma of the lung harboring EGFR mutation and responding to gefitinib, J Clin Oncol 29 (2011) e819–e822. [29] R. Karkouche, J.B. Bachet, J. Sandrini, E. Mitry, C. Penna, J.F. Cote, H. Blons, F. Penault-Llorca, P. Rougier, J.P. Saint Andre, J.F. Emile, Colorectal neuroendocrine carcinomas and adenocarcinomas share oncogenic pathways. A clinico-pathologic study of 12 cases, Eur J Gastroenterol Hepatol 24 (2012) 1430–1437. [30] A. Tannapfel, S. Vomschloss, D. Karhoff, A. Markwarth, U.R. Hengge, C. Wittekind, R. Arnold, D. Horsch, BRAF gene mutations are rare events in gastroenteropancreatic neuroendocrine tumors, Am J Clin Pathol 123 (2005) 256–260. [31] J.A. Gilbert, L.J. Adhikari, R.V. Lloyd, J. Rubin, P. Haluska, J.M. Carboni, M.M. Gottardis, M.M. Ames, Molecular markers for novel therapies in neuroendocrine (carcinoid) tumors, Endocr Relat Cancer 17 (2010) 623–636. [32] S. Yachida, E. Vakiani, C.M. White, Y. Zhong, T. Saunders, R. Morgan, R.F. de Wilde, A. Maitra, J. Hicks, A.M. Demarzo, C. Shi, R. Sharma, D. Laheru, B.H. Edil, C.L. Wolfgang, R.D. Schulick, R.H. Hruban, L.H. Tang, D.S. Klimstra, C.A. Iacobuzio-Donahue, Small cell and large cell neuroendocrine carcinomas of the pancreas are genetically similar and distinct from well-differentiated pancreatic neuroendocrine tumors, Am J Surg Pathol 36 (2012) 173–184. [33] A. Perren, S. Schmid, T. Locher, P. Saremaslani, C. Bonvin, P.U. Heitz, P. Komminoth, BRAF and endocrine tumors: mutations are frequent in papillary thyroid carcinomas, rare in endocrine tumors of the gastrointestinal tract and not detected in other endocrine tumors, Endocr Relat Cancer 11 (2004) 855–860. [34] G.G. Wang, J.C. Yao, S. Worah, J.A. White, R. Luna, T.T. Wu, S.R. Hamilton, A. Rashid, Comparison of genetic alterations in neuroendocrine tumors: frequent loss of chromosome 18 in ileal carcinoid tumors, Mod Pathol 18 (2005) 1079–1087. [35] C.N. Arnold, A. Sosnowski, A. Schmitt-Graff, R. Arnold, H.E. Blum, Analysis of molecular pathways in sporadic neuroendocrine tumors of the gastro-enteropancreatic system, Int J Cancer 120 (2007) 2157–2164.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
ARTICLE IN PRESS Pathology – Research and Practice xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original Article
EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix Arno Dimmler 1 , Helene Geddert 1 , Gerhard Faller ∗ Institute of Pathology, St. Vincent’s Hospital, Karlsruhe, Germany
a r t i c l e
i n f o
Article history: Received 23 August 2013 Received in revised form 20 November 2013 Accepted 13 January 2014 Keywords: Goblet cell carcinoid EGFR KRAS BRAF MSI Pyrosequencing
a b s t r a c t Goblet cell carcinoid (GCC) is a rare type of mixed endocrine–exocrine tumor of the appendix often showing a clinically aggressive behavior. On a molecular basis, this tumor is only poorly understood. To analyze possible molecular similarities between GCC and colorectal cancer, we examined 14 cases of GCC for mutations in exons 18, 19 and 21 of the EGFR-gene, exon 2 in the KRAS gene and for V600E mutations of the BRAF gene. Although the sensitive pyrosequencing method was used, no EGFR, KRAS or BRAF mutations could be found. Furthermore, using immunohistochemistry, no evidence for microsatellite instabillity (MSI) could be found. Despite the partial intestinal differentiation of GCC, our study indicates that the molecular pathogenesis of GCC significantly differs from conventional colorectal adenocarcinoma. This finding might also have implications in adjuvant chemotherapeutic treatment of advanced GCC. © 2014 Elsevier GmbH. All rights reserved.
Introduction Goblet cell carcinoid (GCC) of the appendix is a rare type of tumor [1,2]. The incidence of GCC is estimated to be one tenth of that for conventional appendiceal carcinoids [3]. GCCs show a mixed phenotype, with partial neuroendocrine and intestinal goblet cell differentiation [4,5]. Neuroendocrine characteristics can be demonstrated by expression of neuroendocrine markers such as Chromogranin A and Synaptophysin, whereas intestinal differentiation is proved by goblet cell morphology as well as expression of MUC2 and CDX2 [6]. Some of the GCCs might behave little aggressively. However, in a subset of cases, progression to adenocarcinoma ex GCC was described [7]. In general, prognosis of GCC is much poorer than that of conventional appendiceal carcinoid tumors. Up to 80% of GCC show peritoneal dissemination particularly to the ovaries. Some patients with GCC might be cured by simple appendectomy. However, in many cases, right hemicolectomy is the surgical treatment of choice. Additional chemotherapy might be necessary [3]. Genetic alterations of members of the EGF signaling cascade, such as KRAS and BRAF, play a pivotal role in the pathogenesis,
prognosis and treatment of colorectal adenocarcinoma [8]. In contrast to conventional adenocarcinoma of the colorectum, the molecular pathogenesis of GCC is only poorly investigated. Allelic loss of 11q, 16q and 18q has been suggested to play a role in the pathogenesis of these tumors in one study [9]. Three studies investigated the mutations status of the KRAS gene in GCC and found KRAS mutations at codon 12 of the exon 2 in only one single case [6,9,10]. EGFR gene mutations can be found in 0.3–12% of colorectal cancers [11,12]. In addition, EGFR mutations are prevalent in about 10% of non-small cell lung cancers, including large cell neuroendocrine lung cancer and predict responsiveness to antiEGFR-directed therapy [12,13]. In our study, we aimed to analyze whether the molecular alterations which are clinically relevant in common colorectal adenocarcinomas can also be found in GCC. For this, we investigated EGFR, KRAS and BRAF mutation status in a series of GCC by pyrosequencing, a relatively new sequencing approach. This method has been shown to be more sensitive than conventional Sanger sequencing [14,15]. Additionally, we screened all cases for microsatellite instability (MSI) by immunohistochemistry [16]. Materials and methods
∗ Corresponding author at: Institute of Pathology, St. Vincent’s Hospital, Suedendstrasse 37, 76137 Karlsruhe, Germany. Tel.: +49 721 81083013; fax: +49 721 81083700. E-mail address: [email protected] (G. Faller). 1 Both authors contributed equally to this work.
Tissue and antibodies In the archive our institute, 14 cases with GCC of the appendix were identified.
0344-0338/$ – see front matter © 2014 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.prp.2014.01.002
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
2
All formalin-fixed and paraffin-embedded GCC specimens were histologically re-evaluated in H&E and PAS-stained sections according to routine protocols. Additional immunohistochemistry was performed using antibodies against synaptophysin and CDX2 (diluted 1:150, DCS, Germany) to prove the neuroendocrine and intestinal differentiation. To screen for MSI, tissue was immunostained with murine antibodies against mismatch repair proteins MLH1 (diluted 1:100, Novocastra, UK), MSH2 (diluted 1:50, Novocastra, UK), PMS2 (diluted 1:100, Zytomed, Germany) and MSH6 (diluted 1:50, Zytomed, Germany). For antigen retrieval, sections were incubated for 30 min in a heat steamer with citrate buffer pH 6.0 (MLH1 and MSH2) or with EDTA pH 9.0 (PMS2 and MSH6). After applying primary antibodies, biotinylated secondary goat antibodies (Polylink DetectionLine, DCS, Hamburg, Germany) were added. Color was developed using DAB (DCS, Hamburg, Germany). Immunostaining was carried out by an OptiMax 2.0 Immunostainer (Biogenex, CA). Non-tumor tissue on the slide was used as internal control. Tumor classification was performed according to the 7th edition of the TNM classification of Malignant Tumors of the UICC [17]. Pyrosequencing Tumor areas marked by a pathologist on hematoxylin-eosinstained slides were microdissected on corresponding deparaffinized and hydrated slide samples and tumor tissue was collected in a microtube. After adding 180 l Higuchi buffer and 20 l proteinase K samples were incubated overnight at 56 ◦ C and finally denatured at 94 ◦ C for 10 min. Mutation analysis for KRAS exon 2 codons 12, 13 and 61 was performed using Pyromark Q24 kras V2.0 (Qiagen, Hilden, Germany) according to manufacturer’s protocol. For EGFR exon 18, 19 and 21 and BRAF exon 15, 5 l of tissue lysate was added to PCR mixture containing dNTPs (each 200 M), 1.5 mM MgCl2 , 50 mM KCl, 30 mM Tris–HCl, 0.2% Igepal® -CA630, Taq polymerase (1.25units; 5Prime, Hamburg, Germany), forward and reverse primers (400 nM each, see Tables 1 and 2) and water to a final volume of 50 l. PCR was conducted using following temperatures: 4 min at 95 ◦ C, 35 cycles 30 s at 95 ◦ C, 30 s at 60 ◦ C and 30 s at 72 ◦ C followed by 7 min at 72 ◦ C. For EGFR, nested PCR was performed using 5 l of PCR product in a second round PCR with corresponding primer (500 nM, see Table 1). Amplicon size was as follows: EGFR exon 18 234 bp, exon 19 158 bp, exon 21 264 bp and BRAF 92 bp. 6–20 l of PCR products was purified and denatured in vaccum preparation procedure using streptavidin-coupled sepharose beads as described in the manufacturer’s protocol for Pyromark Q24 (Qiagen, Hilden, Germany). Pyrosequencing was performed using corresponding sequencing primers (500 nM, see Table 1) and dispensation orders (see Tables 1 and 2). Pyrograms were analyzed using t-test statistics. For verification of our sequence studies, five consecutively investigated sessile serrated adenomas of the right-sided colon and 10 distal colorectal carcinomas served as controls for BRAF and KRAS mutations, respectively. For mutations of EGFR, non small cell lung cancers harboring mutations in hotspot regions of exon 18, 19 and 21 were used as controls. Moreover, the accuracy of the applied pyrosequencing method was externally validated and proved by repeated and successful participation in the respective round robin test performed by the German Society of Pathology.
Table 1 Primer sequences for EGFR-mutation analysis. EGFR First round nested PCR exon18F1 exon18R1 exon19F1 exon19R1 exon21F1 exon21R1
GCATGGTGAGGGCTGAGGTGA CCCCACCAGACCATGAGAGGC TGCCAGTTAACGTCTTCCTTC CCACACAGCAAAGCAGAAAC AGCTTCTTCCCATGATGATCTGTCC GGCAGCCTGGTCCCTGGTGTC
Second round nested PCR exon18F2 exon18R2 exon19F2.1 exon19R2.1 exon19F2.2 exon19R2.2 exon21F2 exon21R2
biotin-ACCCTTGTCTCTGTGTTCTTGTCCC GCCCAGCCCAGAGGCCTGTG AACGTCTTCCTTCTCTCTCTG biotin-CCACACAGCAAAGCAGAAAC biotin-AACGTCTTCCTTCTCTCTCTG CCACACAGCAAAGCAGAAAC TCCCATGATGATCTGTCCCTCACA biotin-CAGGAAAATGCTGGCTGACCTAAAG
Sequencing primers exon18S exon19S exon19Scomplementary exon21S
GCCGAACGCACCGGA AATTCCCGTCGCTAT AGAAACTCACATCGAGG AAGATCACAGATTTTGG
Sequence to analyze exon18 exon19 exon19complementary
GCCCAGCACTTTGAT CAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTC ATTTCCTTGTTGGCTTTCGGAGATGTTGCTTC-
exon21
TCTTAATTCCTT GCTGGCCAAACTGCT
Dispensation order exon18 exon19 exon19complementary exon21
ATCGCTACAGCACTC GATCAGATAGAGAGCACATCTCGAGCACAGATCTCATC GCTATCTGTGCTCGAGATGTGCTCTCTATCTA TGCAGTGTAGCAGCATGCT
Table 2 Primer sequences for BRAF-mutation analysis. BRAF PCR brafF brafR Sequencing primer brafS Sequence to analyze braf Dispensation order braf
TGAAGACCTCACAGTAAAAATAGG biotin-ATCCAGACAACTGTTCAAACTGAT GGTGATTTTGGTCTAGCT ACAGTGAAATCTCGATGGAG GACGTAGATGATGCTCGCT
of the appendix. Tumors of all patients showed typical morphology of GCC, including neuroendocrine differentiation with expression of synaptophysin and/or chromogranin, mucin production and nuclear expression of CDX2 (Fig. 1). According to the 7th edition of the UICC TNM-System [17], 4 patients had pT2 tumors, 7 patients had pT3 tumors and 3 patients had pT4 tumors. Eight of the patients were treated with right hemicolectomy. Four of these patients (50%) showed regional lymph node metastasis and two of them (25%) disseminated peritoneal disease. Six patients were treated with appendectomy. Patients’ characteristics are summarized in Table 3.
Results Expression of mismatch repair proteins Patients’ characteristics Between 1997 and 2010, 14 patients (mean age 60.3 years, range 44–83 years, 9 males, 5 females) were diagnosed with GCC
All 14 GCC testes showed nuclear expression of MLH1, MSH2, MSH6 and PMS2 in both, the intestinal and neuroendocrine parts of GCC. Representative immunostainings are shown in Fig. 2.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model
ARTICLE IN PRESS
PRP-51147; No. of Pages 5
A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
3
Fig. 1. Histology and immunohistochemistry of goblet cell carcinoid of the appendix. Representative sections of a case stained with H&E (a) and PAS (b) as well as immunohistochemistry with antibodies against synaptophysin (c) and CDX2 (d). Magnification ×200.
Table 3 Clinical and pathological data of 14 GCCs included in this study. Case
Age
Sex
pT
pN
pM
1 2 3 4 5 6 7 8 9 10 11 12 13 14
44 72 71 65 58 63 44 60 65 40 83 57 65 57
m m m m f f m m f m m m f f
3 3 4 2 2 4 3 3 2 3 3 4 2 3
0/19 n.a. 4/16 0/15 n.a. 4/8 0/12 n.a. 0/25 n.a. n.a. 5/13 n.a. 1/12
M0 n.a. pM0 pM0 n.a. pM1(PER) pM0 n.a. pM0 n.a. n.a. pM1(PER) n.a. pM0
EGFR, KRAS, BRAF mutation status As expected, all five sessile serrated adenomas of the right colon showed V600E mutations in the BRAF gene. Six out of ten distal colorectal carcinomas had mutated KRAS (4 in codon 12, one in codon 13 and codon 61). Four of these carcinomas had wild-type KRAS. None of the 14 cases with GCC showed mutations in the analyzed hot spot regions of the EGFR, KRAS and BRAF genes (Fig. 3). Discussion Appendiceal GCC represents a unique entity. Compared with other neuroendocrine tumors of the appendix, this uniqueness
is highlighted by low frequency, different epidemiology, special morphology, mixed differentiation and poor clinical outcome [18]. Intestinal location and differentiation, as well as tumor morphology and aggressive nature, suggest that GCC might be related to conventional colorectal adenocarcinoma also on a molecular basis. This could then also justify a similar therapeutic approach. Colorectal adenocarcinomas are known to harbor genetic alterations in KRAS and BRAF genes. Left sided sporadic colorectal cancers typically result from the adenoma-carcinoma-sequence and show exon 2 mutations at codons 12, 13 and 61 in about 40% of cases [19]. In contrast, about 10% of colon cancers show V600E mutations in the BRAF gene. These cancers are typically right sided and result from the serrated pathway [20]. The detection of KRAS mutations in colon cancer is predictive for responsiveness to antiEGFR therapy. The presence of BRAF mutations in colorectal cancer is a indicator for poor prognosis, particularly when tumors are microsatellite-stable [21,22]. MSI is also a molecular feature of colorectal carcinoma and can be found in about 15% of cases. MSI, which is mainly found in right sided carcinomas, serves a marker of good prognosis even in cases with high-grade cytologic morphology such as medullary carcimoma [23]. KRAS and BRAF mutations and MSI are not only features of colorectal carcinoma but also occur frequently in appendiceal tumors of common intestinal differentiation [24–26]. However, although appendiceal GCC display intestinal features, we could not detect any KRAS mutations. This is in agreement with previous findings [9,10] which also were unable to detect these mutations in 38 cases. Only van Eeden was able to detect a single KRAS mutated case out of 16 GCCs [6]. To our knowledge, this is the first study to investigate BRAF mutations status in GCC. Although we used the sensitive pyrosequencing method, we did not find any
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5 4
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
Fig. 2. Immunohistochemical analysis of microsatellite stability. Nuclear expression of MLH1 (a) and MSH2 (b) in goblet cell carcinoid. MSH6 and PMS2 were also expressed in all cases (data not shown). Magnification ×200.
mutations at the hotspot region at codon 600 of the gene. Additionally, in immunohistochemical analysis, no evidence of MSI could be found. This result is in agreement with a study of Taggart et al., who also were unable to find MSI in 9 cases of GCC using molecular techniques [26]. Taken together, these results strongly indicate
that the molecular pathogenesis of GCC is different from colorectal adenocarcinoma. Non-small cell lung cancer harbors mutations in exons 18, 19 and 21 of the EGFR gene in about 10–15% of cases. These mutations are predictive for responsiveness to anti-EGFR therapy [27]. It seems obvious that also large cell neurondocrine carcinomas of the lung show these mutations in a similar frequency [13,28]. In our study, comprising 14 cases, we did not find any EGFR mutations. Due to the limited number of cases investigated, this does not rule out that GCC share some molecular similarities with large cell neuroendocrine cancers of the lung. However, further evidence for such a hypothesis could not be found in this study. Poorly differentiated neuroendocrine carcinomas of the colorectum have been shown to harbor KRAS or BRAF mutations in 60% of cases [29]. This figure corresponds with colorectal adenocarcinoma and is clearly different from the data of our study. Therefore we conclude that the molecular pathogenesis of appendiceal GCC and of poorly differentiated neuroendocrine colorectal carcimomas is dissimilar. In well-differentiated gastrointestinal neuroendocrine tumors (NET) KRAS and BRAF mutations and of MSI are very infrequent. In three studies comprising 58 cases of primary gastrointestinal and pancreatic well-differentiated NET, no activating KRAS mutations could be found [30–32]. Furthermore, only 2 out of 113 (2%) well differentiated pancreatic or gastrointestinal NET showed BRAF mutations [30,33,34]. Finally, all 118 cases of well differentiated NET of the gastrointestinal tract investigated by Arnold et al. were microsatellite stable [35]. This is the first study analyzing possible EGFR, KRAS and BRAF mutations and MSI within the same collection of GCC. We found no evidence for molecular similarities between GCC and colorectal adenocarcinoma, poorly differentiated neuroendorcine carcinoma of the colorectum and large cell neuroendocrine carcinoma of the lung. From the results of our study we conclude that with regard to the markers tested, GCC are comparable to well differentiated NET of the gastrointestinal tract. We therefore conclude that in contrast to colorectal adenocarcinomas, GCCs cannot be prognostically estimated according to their KRAS, BRAF or MSI status. Despite the aggressive nature of GCCs, our observations indicate that antiEGFR treatment,which is established for a subset of colorectal and pulmonary adenocarcinomas, might not be an option for GCC.
Fig. 3. Representative examples of pyrograms for sequence analysis of KRAS codon 12/13 in goblet cell carcinoid (a) and colorectal carcinoma (b), of BRAF codon600 in goblet cell carcinoid (c) and sessile serrated adenoma (d) and of EGFR exon21 in goblet cell carcinoid (e) and non-small cell lung carcinoma (f). Mutations are indicated by arrows.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
G Model PRP-51147; No. of Pages 5
ARTICLE IN PRESS A. Dimmler et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
Conflict of interest The authors declare that they have no conflict of interest. Acknowledgement The authors wish to thank Ines Kreuscher and Stefanie Lechner for expert technical assistance. References [1] M.L. McGory, M.A. Maggard, H. Kang, J.B. O’Connell, C.Y. Ko, Malignancies of the appendix: beyond case series reports, Dis Colon Rectum 48 (2005) 2264–2271. [2] P. Roy, R. Chetty, Goblet cell carcinoid tumors of the appendix: an overview, World J Gastrointest Oncol 2 (2010) 251–258. [3] U. Plockinger, A. Couvelard, M. Falconi, A. Sundin, R. Salazar, E. Christ, W.W. de Herder, D. Gross, W.H. Knapp, U.P. Knigge, M.H. Kulke, U.F. Pape, Frascati Consensus Conference, Consensus guidelines for the management of patients with digestive neuroendocrine tumours: well-differentiated tumour/carcinoma of the appendix and goblet cell carcinoma, Neuroendocrinology 87 (2008) 20–30. [4] L.H. Tang, Epithelial neoplasms of the appendix, Arch Pathol Lab Med 134 (2010) 1612–1620. [5] L. Deschamps, A. Couvelard, Endocrine tumors of the appendix: a pathologic review, Arch Pathol Lab Med 134 (2010) 871–875. [6] S. van Eeden, G.J. Offerhaus, A.A. Hart, L. Boerrigter, P.M. Nederlof, E. Porter, M.L. van Velthuysen, Goblet cell carcinoid of the appendix: a specific type of carcinoma, Histopathology 51 (2007) 763–773. [7] L.H. Tang, J. Shia, R.A. Soslow, D. Dhall, W.D. Wong, E. O’Reilly, J. Qin, P. Paty, M.R. Weiser, J. Guillem, L. Temple, L.H. Sobin, D.S. Klimstra, Pathologic classification and clinical behavior of the spectrum of goblet cell carcinoid tumors of the appendix, Am J Surg Pathol 32 (2008) 1429–1443. [8] V. Heinemann, S. Stintzing, T. Kirchner, S. Boeck, A. Jung, Clinical relevance of EGFR- and KRAS-status in colorectal cancer patients treated with monoclonal antibodies directed against the EGFR, Cancer Treat Rev 35 (2009) 262–271. [9] M. Stancu, T.T. Wu, C. Wallace, P.S. Houlihan, S.R. Hamilton, A. Rashid, Genetic alterations in goblet cell carcinoids of the vermiform appendix and comparison with gastrointestinal carcinoid tumors, Mod Pathol 16 (2003) 1189–1198. [10] D.M. Ramnani, I.I. Wistuba, C. Behrens, A.F. Gazdar, L.H. Sobin, J. AlboresSaavedra, K-ras and p53 mutations in the pathogenesis of classical and goblet cell carcinoids of the appendix, Cancer 86 (1999) 14–21. [11] T.D. Barber, B. Vogelstein, K.W. Kinzler, V.E. Velculescu, Somatic mutations of EGFR in colorectal cancers and glioblastomas, N Engl J Med 351 (2004) 2883. [12] H. Nagahara, K. Mimori, M. Ohta, T. Utsunomiya, H. Inoue, G.F. Barnard, M. Ohira, K. Hirakawa, M. Mori, Somatic mutations of epidermal growth factor receptor in colorectal carcinoma, Clin Cancer Res 11 (2005) 1368–1371. [13] A. Iyoda, W.D. Travis, I.S. Sarkaria, S.X. Jiang, H. Amano, Y. Sato, M. Saegusa, V.W. Rusch, Y. Satoh, Expression profiling and identification of potential molecular targets for therapy in pulmonary large-cell neuroendocrine carcinoma, Exp Ther Med 2 (2011) 1041–1045. [14] A.C. Tsiatis, A. Norris-Kirby, R.G. Rich, M.J. Hafez, C.D. Gocke, J.R. Eshleman, K.M. Murphy, Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications, J Mol Diagn 12 (2010) 425–432. [15] J. Gao, Y.Y. Li, P.N. Sun, L. Shen, Comparative analysis of dideoxy sequencing, the KRAS StripAssay and pyrosequencing for detection of KRAS mutation, World J Gastroenterol 16 (2010) 4858–4864. [16] J. Shia, Immunohistochemistry versus microsatellite instability testing for screening colorectal cancer patients at risk for hereditary nonpolyposis colorectal cancer syndrome. Part I. The utility of immunohistochemistry, J Mol Diagn 10 (2008) 293–300. [17] M.K. Gospodarowicz, L.H. Sobin, Ch. Wittekind, TNM classification of malignant tumours, John Wiley & Sons, Chichester, West Sussex, 2010.
5
[18] N. Holt, H. Gronbaek, Goblet cell carcinoids of the appendix, Sci World J 2013 (2013) 543696. [19] J. Neumann, E. Zeindl-Eberhart, T. Kirchner, A. Jung, Frequency and type of KRAS mutations in routine diagnostic analysis of metastatic colorectal cancer, Pathol Res Pract 205 (2009) 858–862. [20] J.R. Jass, Classification of colorectal cancer based on correlation of clinical, morphological and molecular features, Histopathology 50 (2007) 113–130. [21] G. Safaee Ardekani, S.M. Jafarnejad, L. Tan, A. Saeedi, G. Li, The prognostic value of BRAF mutation in colorectal cancer and melanoma: a systematic review and meta-analysis, PLoS ONE 7 (2012) e47054. [22] R.K. Pai, P. Jayachandran, A.C. Koong, D.T. Chang, S. Kwok, L. Ma, D.A. Arber, R.R. Balise, R.R. Tubbs, B. Shadrach, R.K. Pai, BRAF-mutated, microsatellite-stable adenocarcinoma of the proximal colon: an aggressive adenocarcinoma with poor survival, mucinous differentiation, and adverse morphologic features, Am J Surg Pathol 36 (2012) 744–752. [23] E. Vilar, S.B. Gruber, Microsatellite instability in colorectal cancer-the stable evidence, Nat Rev Clin Oncol 7 (2010) 153–162. [24] R.K. Yantiss, A. Panczykowski, J. Misdraji, H.P. Hahn, R.D. Odze, H. Rennert, Y.T. Chen, A comprehensive study of nondysplastic and dysplastic serrated polyps of the vermiform appendix, Am J Surg Pathol 31 (2007) 1742–1753. [25] P. Zauber, E. Berman, S. Marotta, M. Sabbath-Solitare, T. Bishop, Ki-ras gene mutations are invariably present in low-grade mucinous tumors of the vermiform appendix, Scand J Gastroenterol 46 (2011) 869–874. [26] M.W. Taggart, J. Galbincea, P.F. Mansfield, K.F. Fournier, R.E. Royal, M.J. Overman, A. Rashid, S.C. Abraham, High-level microsatellite instability in appendiceal carcinomas, Am J Surg Pathol 37 (2013) 1192–1200. [27] R. Rosell, T. Moran, C. Queralt, R. Porta, F. Cardenal, C. Camps, M. Majem, G. Lopez-Vivanco, D. Isla, M. Provencio, A. Insa, B. Massuti, J.L. Gonzalez-Larriba, L. Paz-Ares, I. Bover, R. Garcia-Campelo, M.A. Moreno, S. Catot, C. Rolfo, N. Reguart, R. Palmero, J.M. Sanchez, R. Bastus, C. Mayo, J. Bertran-Alamillo, M.A. Molina, J.J. Sanchez, G. Taron, Spanish lung cancer, screening for epidermal growth factor receptor mutations in lung cancer, N Engl J Med 361 (2009) 958–967. [28] T.M. De Pas, M. Giovannini, M. Manzotti, G. Trifiro, F. Toffalorio, C. Catania, L. Spaggiari, R. Labianca, M. Barberis, Large-cell neuroendocrine carcinoma of the lung harboring EGFR mutation and responding to gefitinib, J Clin Oncol 29 (2011) e819–e822. [29] R. Karkouche, J.B. Bachet, J. Sandrini, E. Mitry, C. Penna, J.F. Cote, H. Blons, F. Penault-Llorca, P. Rougier, J.P. Saint Andre, J.F. Emile, Colorectal neuroendocrine carcinomas and adenocarcinomas share oncogenic pathways. A clinico-pathologic study of 12 cases, Eur J Gastroenterol Hepatol 24 (2012) 1430–1437. [30] A. Tannapfel, S. Vomschloss, D. Karhoff, A. Markwarth, U.R. Hengge, C. Wittekind, R. Arnold, D. Horsch, BRAF gene mutations are rare events in gastroenteropancreatic neuroendocrine tumors, Am J Clin Pathol 123 (2005) 256–260. [31] J.A. Gilbert, L.J. Adhikari, R.V. Lloyd, J. Rubin, P. Haluska, J.M. Carboni, M.M. Gottardis, M.M. Ames, Molecular markers for novel therapies in neuroendocrine (carcinoid) tumors, Endocr Relat Cancer 17 (2010) 623–636. [32] S. Yachida, E. Vakiani, C.M. White, Y. Zhong, T. Saunders, R. Morgan, R.F. de Wilde, A. Maitra, J. Hicks, A.M. Demarzo, C. Shi, R. Sharma, D. Laheru, B.H. Edil, C.L. Wolfgang, R.D. Schulick, R.H. Hruban, L.H. Tang, D.S. Klimstra, C.A. Iacobuzio-Donahue, Small cell and large cell neuroendocrine carcinomas of the pancreas are genetically similar and distinct from well-differentiated pancreatic neuroendocrine tumors, Am J Surg Pathol 36 (2012) 173–184. [33] A. Perren, S. Schmid, T. Locher, P. Saremaslani, C. Bonvin, P.U. Heitz, P. Komminoth, BRAF and endocrine tumors: mutations are frequent in papillary thyroid carcinomas, rare in endocrine tumors of the gastrointestinal tract and not detected in other endocrine tumors, Endocr Relat Cancer 11 (2004) 855–860. [34] G.G. Wang, J.C. Yao, S. Worah, J.A. White, R. Luna, T.T. Wu, S.R. Hamilton, A. Rashid, Comparison of genetic alterations in neuroendocrine tumors: frequent loss of chromosome 18 in ileal carcinoid tumors, Mod Pathol 18 (2005) 1079–1087. [35] C.N. Arnold, A. Sosnowski, A. Schmitt-Graff, R. Arnold, H.E. Blum, Analysis of molecular pathways in sporadic neuroendocrine tumors of the gastro-enteropancreatic system, Int J Cancer 120 (2007) 2157–2164.
Please cite this article in press as: A. Dimmler, et al., EGFR, KRAS, BRAF-mutations and microsatellite instability are absent in goblet cell carcinoids of the appendix, Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.01.002
