crossmark

Electron Acceptors Induce Secretion of Enterotoxigenic Escherichia coli Heat-Labile Enterotoxin under Anaerobic Conditions through Promotion of GspD Assembly Xi Lu, Enqing Fu, Yonghong Xie, Faguang Jin Department of Respiration, Tangdu Hospital, The Fourth Military Medical University, Xi’an, China

Heat-labile enterotoxin (LT), the major virulence factor of enterotoxigenic Escherichia coli (ETEC), can lead to severe diarrhea and promotes ETEC adherence to intestinal epithelial cells. Most previous in vitro studies focused on ETEC pathogenesis were conducted under aerobic conditions, which do not reflect the real situation of ETEC infection because the intestine is anoxic. In this study, the expression and secretion of LT under anaerobic or microaerobic conditions were determined; LT was not efficiently secreted into the supernatant under anaerobic or microaerobic conditions unless terminal electron acceptors (trimethylamine N-oxide dihydrate [TMAO] or nitrate) were available. Furthermore, we found that the restoration effects of TMAO and nitrate on LT secretion could be inhibited by amytal or ⌬torCAD and ⌬narG E. coli strains, indicating that LT secretion under anaerobic conditions was dependent on the integrity of the respiratory chain. At the same time, electron acceptors increase the ATP level of ETEC, but this increase was not the main reason for LT secretion. Subsequently, the relationship between the integrity of the respiratory chain and the function of the type II secretion system was determined. The GspD protein, the secretin of ETEC, was assembled under anaerobic conditions and was accompanied by LT secretion when TMAO or nitrate was added. Our data also demonstrated that TMAO and nitrate could not induce the GspD assembly and LT secretion in ⌬torCAD and ⌬narG strains, respectively. Moreover, GspD assembly under anaerobic conditions was assisted by the pilot protein YghG.

E

nterotoxigenic Escherichia coli (ETEC) is an important enteric pathogen that causes cholera-like diarrhea in humans and porcines (1). ETEC is a leading cause of mortality in children in less developed countries (2) and is the most common cause of travelers’ diarrhea worldwide (3), accounting for more than 200 million cases of diarrhea and approximately 400,000 deaths of children annually (4, 5). A complete understanding of the virulence factors of secretion under the complex intestinal environment is a key event in diarrheal pathogenesis. Heat-labile enterotoxin (LT) is one of the critical ETEC enterotoxins, and the pathogenesis is well established. After release into the host small intestine, a pentamer of the B subunit of LT binds to epithelial cell surface receptor gangliosides (e.g., GM1). After the holotoxin is internalized by the Golgi apparatus, the A subunit exerts NAD-glycohydrolase and ADP-ribosyltransferase activities, which irreversibly activate adenylate cyclase and induce an increase in intracellular cyclic AMP (cAMP) (6). Subsequently, the chloride ion channel of the cystic fibrosis transmembrane regulator is opened, causing chloride ions and water to enter the intestinal lumen (7). LT also plays multiple roles in modulating host cell function and bacterial adherence (8–11). For example, LT activates both the NF-␬B and mitogen-activated protein kinase pathways, which promote ETEC adherence to intestinal epithelial cells (12, 13). The type II secretion (T2S) system is a large complex composed of 12 to 16 proteins (14) that spans both the inner and outer membranes of Gram-negative bacteria. It is well documented that the T2S system is encoded by the gspCDEFGHIJKLM gene cluster and accounts for LT secretion in ETEC H10407 (15). A functional T2S system, like other secretion systems (T3S, type IV pili, etc.), depends on the localization and assembly of the secretin in the outer membrane (16, 17). In ETEC, the secretin form of GspD is a

2748

iai.asm.org

membrane pore through which the toxin or folded proteins are secreted (15). A recent study focused on ETEC enterotoxin expression in response to environment and host. The results demonstrated that oral rehydration therapy with a salt and glucose solution is likely to impact ST and LT expression via CRP (cAMP receptor protein) and H-NS in ETEC (18). An earlier study of enterohemorrhagic Escherichia coli under anaerobic conditions demonstrated that secretion of the virulence factors EspB and Tir is regulated by the host environment (19). These results indicate that (i) pathogenicity is rigorously regulated by host environmental stimulation (19, 20) and (ii) the expression and secretion of virulence factors are two separate processes that affect the pathogenicity of microorganisms at different levels. Previously, most functional and pathology studies that were focused on ETEC were performed under aerobic conditions (21–23); however, in the intestine, the target position of ETEC infection is anoxic or anaerobic. In addition, the environment of the intestine (i.e., pH, nutrient availability, and osmolality) is distinctly different from in vitro conditions (24). Here, we found that LT was inefficiently secreted into the supernatant under anaerobic or

Received 26 April 2016 Returned for modification 25 May 2016 Accepted 5 July 2016 Accepted manuscript posted online 18 July 2016 Citation Lu X, Fu E, Xie Y, Jin F. 2016. Electron acceptors induce secretion of enterotoxigenic Escherichia coli heat-labile enterotoxin under anaerobic conditions through promotion of GspD assembly. Infect Immun 84:2748 –2757. doi:10.1128/IAI.00358-16. Editor: V. B. Young, University of Michigan Address correspondence to Faguang Jin, [email protected]. Y.X. and F.J. contributed equally to this article. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Infection and Immunity

October 2016 Volume 84 Number 10

E. coli LT Secretion under Anaerobic Conditions

TABLE 1 Strains and plasmids used in this study Strain or plasmid

Relevant phenotype/genotype and descriptiona

Source or reference

Strains H10407 H10407⌬gspD H10407⌬ubiE H10407⌬menA H10407⌬torCAD H10407⌬narG H10407⌬narVWYZ H10407⌬torSTR H10407⌬narP H10407⌬narQ H10407⌬narXL H10407⌬purK H10407⌬yghG BL21(DE3)

Wild-type ETEC serotype O78:H11, LT⫹ ST⫹ H10407 gspD mutant H10407 ubiE mutant H10407 menA mutant H10407 torCAD mutant H10407 narG mutant H10407 narVWYZ mutant H10407 torSTR mutant H10407 narP mutant H10407 narQ mutant H10407 narXL mutant H10407 purK mutant H10407 yghG mutant F⫺ ompT gal dcm lon hsdSB(rB⫺ mB⫺) ␭(DE3 [lacI lacUV5-T7 gene 1 ind-1 sam-7 nin-5])

This study This study This study This study This study This study This study This study This study This study This study This study Novagen

Plasmids pKD4 pKD46 pET19b pET19b-gspD/His pBAD/His pBAD-gspD/His pBAD-yghG/His

Template plasmid for the ␭-Red recombination system Red recombinase expression plasmid encodes ␭ gam, ␭ alpha, and ␭ beta genes Ampr, T7 promoter and terminator, lacI, 10⫻His, MSC Ampr; gspD cloned between and with an N-terminal His tag Ampr; araC; PBAD promoter 6⫻His, MSC Ampr; gspD cloned between XhoI and HindIII of pBAD-HIS Ampr; yghG cloned between XhoI and HindIII of pBAD-HIS

24 24 Novagen This study Invitrogen This study This study

a

Ampr, ampicillin resistance.

microaerobic conditions unless terminal electron acceptors, i.e., lowmolecular-weight oxygen-containing molecules, some of which are abundant in the intestine, were available. A probable mechanism of this process is also provided. MATERIALS AND METHODS Bacterial strains, plasmids, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. Routinely, ETEC strains were precultured overnight at 37°C in CAYE broth (2% Casamino Acids, 0.15% yeast extract, 43 mM NaCl, 50 mM K2PO4, 0.25% glucose, and 0.1% trace salts [0.415 M MgSO4, 40 mM MnCl2, and 30 mM FeCl3]), and the cultures were then diluted 1:100 in fresh CAYE medium, with or without an electron acceptor (10 mM), in a 15-ml tube. The bacteria were further cultured for 3 h at 37°C in an anaerobic/microaerobic system (Gen-Science Scientific Instruments, Inc., USA) without shaking. Specifically, the bacteria were grown in CAYE with shaking as an aerobic condition. The bacteria were incubated in an anaerobic jar, and the air in the jar was replaced with 10% CO2, 10% H2, and 80% N2 three times to create anaerobic conditions. When the bacteria were incubated in the microaerobic jar, half of the air in the jar was replaced once with 10% CO2, 10% H2, and 80% N2 to create microaerobic conditions. To inhibit protein synthesis and respiration, excess amounts of amytal (5 mM) were added to the bacterial culture grown without any electron acceptor. After 30 min of incubation at 37°C, an electron acceptor was added, and the bacteria were incubated for an additional 3 h at 37°C. The electron acceptors used were trimethylamine N-oxide dihydrate (TMAO; catalog no. 92277; Sigma-Aldrich), dimethyl sulfoxide (DMSO; catalog no. D8418; Sigma-Aldrich), nitrate, fumarate (F1506; Sigma-Aldrich) and NaNO3. E. coli BL21(DE3) cells were cultured in Luria-Bertani (LB) medium. Construction of mutants in H10407. To construct the deletion mutants, a one-step inactivation method (25) was used. Briefly, wild-type H10407 cells were transformed with the temperature-sensitive plasmid pKD46 (the helper plasmid encoding the ␭-Red, Gam, and Bet proteins utilized to construct the various deletion mutants). The deletion mutations were created by removal of the open reading frame (ORF). The DNA

October 2016 Volume 84 Number 10

sequences of the primers are listed in Table 2. Specifically, the ETEC H10407 cells carrying pKD46 were first grown in 5 ml of SOB medium with 100 ␮g/ml ampicillin (Amp) at 32°C overnight. Next, a 1:100 dilution of the culture was inoculated into 100 ml of fresh SOB with 100 ␮g/ml Amp. When the optical density at 600 nm (OD600) reached 0.2, 30 mM L-arabinose was added, and the culture was incubated for an additional 1 h. As shown in Table 2, pKD4 was amplified using two primers for the FRT-kam-FRT fragment, with each primer consisting of 37- to 70-bp homology extensions of the target gene and 20-bp priming sequences for pKD4. The PCR products were gel purified and treated with DpnI, and electroporation was performed using a Bio-Rad GenePulser Xcell with 0.2-cm chambers at 2.5 kV, 25 ␮F, 200 ⍀, and 2 ms using 10 to 100 ng of product and 25 ␮l of cells. The shocked cells were added to 1 ml of SOC immediately, incubated for 1 h at 37°C and then spread onto agar to select the kanamycin-resistant transformants. A positive colony was confirmed by PCR and DNA sequencing. Analysis of the proteins in culture supernatants and whole-cell extracts. The bacteria were grown as described above and harvested from 1-ml cultures by centrifugation at 12,000 rpm for 2 min. The bacterial pellet was dissolved in radioimmunoprecipitation assay buffer (100 ␮l per OD600 unit of the original culture). The trichloroacetic acid (TCA) method for precipitation of the proteins from the culture supernatant was based on the Cold Spring Harbor protocol with slight modifications. In this study, 40 ml of the culture was centrifuged at 5,500 ⫻ g for 10 min, and the supernatant was then passed through a filter (0.22-␮m pore size; Millipore). The proteins in the filtrate were precipitated by adding 10% (final) TCA on ice and, after 20 min, the precipitate was harvested by centrifugation at 20,000 ⫻ g for 30 min and removal of the supernatant. Acetone with an equal volume of TCA was added to rinse the pellet, which was then collected by centrifugation at 20,000 ⫻ g for 10 min. Finally, the dry protein pellet was dissolved in sodium dodecyl sulfate (SDS) sample buffer for the next steps. Construction of the complementation plasmids and the expression plasmid. The gspD and yghG ORFs were amplified from the H10407 genome with the primers gspD-3/gspD-4 and yghG-1/yghG-2 (Table 2)

Infection and Immunity

iai.asm.org

2749

2750

iai.asm.org

Infection and Immunity

Boldface type at the end of a sequence indicates the binding position of the primer for gene knockout. Boldface type at the beginning of a sequence indicates the restriction site.

GACCTGAAATCGTTCATCGAAACCGTCGGCGCTAACCTTAATAAAACCATCATTGTGTAGGCTGGAGCTGCTTC AACTGTAGGGCAGACGCACGGTGTTGGCGGTGGTTTCCTGTGCTACAGGCACCAATGGGAATTAGCCATGGTCC ATGGTGGATAAGTCACAAGAAACGACGCACTTTGGTTTTCAGACCGTCGCGTGTAGGCTGGAGCTGCTTC TCAGAACTTATAACCACGATGCAGCGCCACAACCCCTGCCGTCAGATTATGGGAATTAGCCATGGTCC ATGACTGAACAACAAATTAGCCGAACTCAGGCGTGGCTGGAAAGTTTGTGTAGGCTGGAGCTGCTTC TTATGCTGCCCACTGGCTTAGGAATATCCCTAAAACAAACAGCAGGTATGGGAATTAGCCATGGTCC ATGCGGAAACTCTGGAACGCGCTACGCCGACCCAGTGCTCGTTGGTCGGTACTGGCGCTGGTGTAGGCTGGAGCTGCTTC TTATCTGTTTTGGTGGTCGCACTCCACTAACACCAGCAATAACATGGGAATTAGCCATGGTCC ATGAGTAAATTCCTGGACCGGTTTCGCTACTTCAAACAGAAGGGTGAAACCTTTGCCGATGTGTAGGCTGGAGCTGCTTC ATGATTCAGTATCTGAACGTCTTTTTTTACGATATCTACCCGTACATTTGTGTGTAGGCTGGAGCTGCTTC TCATTTTTTCGCCTCCTGTACCTGATCGCGACCTTCATCATCCAGCCAGTTAACGTTCTTATGGGAATTAGCCATGGTCC GTGAATTTAACCCTGACCCGAAGACTCTGGATGGGCTTTGCCCTGATGGCGCTGTTAAGTGTAG GCTGGAGCTGCTTC TCAGCACACATCAGCGGCTAAGAAATAACCTTCACCATGTTGCGTCACCAGTAAATCCGCGCATGGGAATTAGCCATGGTCC ATGCCTGAAGCAACACCTTTTCAGGTGATGATTGTGGATGATCATCCACTTATGGTGTAGGCTGGAGCTGCTTC TTATTGTGCCCCGCGTTGTTGCAGGAACAGAATGGTGGCCGCCACGCGTGAGATGGGAATTAGCCATGGTCC GTGATTGTTAAACGACCCGTCTCGGCCAGTCTGGCCCGGGCCTTTTTTTACATTGTGCTGCTGTGTAGGCTGGAGCTGCTTC TTACATTAACTGACTTTCCTCACCCTCCGCAGAGCGAAAGCTAATACTCACTAACGTGCCGATGGGAATTAGCCATGGTCC TCATTTTACGCTCTCCTGTACCTGGTCATTGCCTTCGCCATCTAACCAGTCAATGTTCTTCATGGGAATTAGCCATGGTCC ATGAGTAATCAGGAACCGGCTACTATCCTGCTGATTGACGATCACCCGATGCTGCGAACTGGCGTAAAACGTGTAGGCTGGAGCTGCTTC GTGGTGGTCACCTTTATTCCCGAAAAAACTTTCACAGACGTCCAAGGAGATACCCATGAGTAATGGGAATTAGCCATGGTCC ATGTCGATAAAACAAATGCCAGGGAGGGTATTAATATCGTGTAGGCTGGAGCTGCTTC TTATGCTTTGACTATTCCACAGGTGGTACGATCCAGTATGGGAATTAGCCATGGTCC CGGACCCGCGAGGTGCGCATGAAACAGGTTTGCGTCCTCGTGTAGGCTGGAGCTGCTTC CGGATAAGGCGTTCACGCCGCATCCGGCAATCAAATGAGCATGGGAATTAGCCATGGTCC GGATCCATGAAAGGACTCAATAAAATC CATATGTCACCGTGACGATGGCGCAG CTCGAGATGAAAGGACTCAATAAAATC TTCGAATCACCGTGACGATGGCGCAG CTCGAGATGTCGATAAAACAAATGCCAGGGA TTCGAATTATGCTTTGACTATTCCACAGGTG

gspD-H1P1 gspD-H1P2 ubiE-H1P1 ubiE-H2P2 menA-H1P1 menA-H2P2 torCAD-H1P1 torCAD-H2P2 narG-H1P1 narVWYZ-H1P1 narVWYZ-H2P2 torSTR-H1P1 torSTR-H2P2 narP-H1P1 narP-H2P2 narQ-H1P1 narQ-H2P2 narG-H2P2 narXL-H1P1 narXL-H2P2 yghG-H1P1 yghG-H2P2 purK-H1P1 purk-H2H2 gspD-1 gspD-2 gspD-3 gspD-4 yghG-1 yghG-2

a

Sequence (5=-3=)a

Primer

TABLE 2 Primers used in this study gspD deletion gspD deletion ubiE deletion ubiE deletion menA deletion menA deletion torCAD deletion torCAD deletion narG deletion narVWYZ deletion narVWYZ deletion torSTR deletion torSTR deletion narP deletion narP deletion narQ deletion narQ deletion narG deletion narXL deletion narXL deletion yghG deletion yghG deletion purK deletion purK deletion T7-gspD clone T7-gspD clone Pbad-gspD clone Pbad-gspD clone Pbad-yghG clone Pbad-yghG clone

Description and/or application

Lu et al.

October 2016 Volume 84 Number 10

E. coli LT Secretion under Anaerobic Conditions

after XhoI and HindIII restriction digestion. The products were then cloned into vector pBAD/His B to construct the complementation plasmids pBAD-gspD/His and pBAD-yghG/His, which can be expressed under L-arabinose by induction in a dose-dependent manner. The gspD ORF was amplified from the H10407 genome with primers gspD-1/gspD-2 (Table 2) after BamHI and NdeI restriction digestion. The product was then cloned into vector pET19b to construct the gspD expression vector pET19b-gspD/His, which can be induced by IPTG (isopropyl-␤-D-thiogalactopyranoside). The vector was then transformed into the BL21(DE3) host strain. Production of antisera. The anti-gspD antiserum was produced based on a previously described method (17), with slight modification. Briefly, the plasmid pET19b-gspD/His encoded the gspD gene and was transformed into BL21(DE3) cells. The culture was grown in 800 ml of LB broth containing 1 mM IPTG for the expression of N-terminally Histagged GspD. The cells were harvested and resuspended in 10 ml of lysis buffer (50 mM Tris [pH 8.0], 10% glycerol 0.1% Triton X-100, 100 ␮g/ml lysozyme, 1 mM phenylmethylsulfonyl fluoride [PMSF], 3 U of DNase, and 2 mM MgCl2), followed by ultrasonic treatment (300 W) for 10 s and then a 10-s suspension, with a total processing time of 30 min. The cell debris was pelleted by centrifugation at 12,000 ⫻ g for 30 min at 4°C. The supernatant was added to an Ni-nitrilotriacetic acid affinity column (Novagen HisBind purification kit), and the flow speed was controlled at ⬍4 drops/min. Ten times the column bed volume of 1⫻ binding buffer (0.5 M NaCl, 20 mM Tris-HCl, 60 mM imidazole [pH 7.9]) was added, followed by six times the column bed volume of 1⫻ wash buffer (0.5 M NaCl, 20 mM Tris-HCl, 5 mM imidazole [pH 7.9]). Finally, the target protein was eluted with six times the column bed volume of 1⫻ elution buffer (1 M imidazole, 0.5 M NaCl, 20 mM Tris-HCl [pH 7.9]). Selected fractions were applied to a desalting column (HiPrep 26/10 desalting column; GE Healthcare) and were resuspended in 20 mM Tris at pH 8.0. The preparation was then applied to an anion-exchange column (6-ml Resource Q; GE Healthcare) and eluted with a gradient of buffer A (20 mM Tris at pH 8.0) and buffer B (20 mM Tris and 500 mM NaCl at pH 8.0). A 250-␮g aliquot of each protein in complete Freund adjuvant was injected into female rabbits. Equal amounts of protein in incomplete Freund adjuvant were injected at 4, 7, and 10 weeks after the initial injection, followed by serum collection 2 weeks later. Western blotting. The bacterial pellets were resuspended in ice-cold lysis buffer (6 M urea, 2 M thiourea, 4% CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}, 1% dithiothreitol [7 ␮l], 1% PMSF, and 0.5% Ampholyte [Bio-Rad 3-10]), followed by incubation on ice for 30 min. The lysates were centrifuged at 17,000 ⫻ g and 4°C for 20 min, and the supernatant was stored at ⫺80°C until ready for use. The protein concentrations were determined by using a TaKaRa Bradford protein assay kit (catalog no. T9310A; TaKaRa). The proteins were electrophoresed in a 10% SDS-PAGE gel and then transferred to polyvinylidene difluoride (PVDF) membranes. For GspD multimeric and monomeric proteins, the whole-cell samples were separated by 3 to 8% SDS gradient PAGE (Bio-Rad) until a 75-kDa protein standard was ⬃0.5 cm from the bottom of the gel and then transferred to PVDF membranes. The membranes were blocked with 5% nonfat milk in TBST (Tris-buffered saline plus Tween) at room temperature for 1 h, followed by incubation with primary antibodies overnight at 4°C: anti-LT subunit (A⫹B) ab188541 (Abcam) for LT detection, anti-DnaK for DnaK detection, antiHis for recombinant protein GspD-His or YghG-His detection, and antiGspD antiserum for GspD detection. The membranes were washed three times in TBST, followed by incubation with secondary antibodies (a horseradish peroxidase-conjugated anti-rabbit IgG) for 2 h at room temperature. The proteins were visualized using chemiluminescent substrate (ECL detection kit; Thermo). Assays for LT secretion. The concentrations of LT in the culture supernatant were determined by using a GM1-ganglioside enzyme-linked immunosorbent assay (GM1-ELISA) and according to previously described methods (20, 26) with a slight modification. The primary antibody

October 2016 Volume 84 Number 10

was rabbit anti-cholera toxin IgG (Sigma-Aldrich) at a 1:2,500 dilution, and the secondary antibody was horseradish peroxidase-conjugated sheep anti-rabbit anti-CT antibody (Bioss Antibodies) diluted to 1:10,000. After the addition of each antibody, the samples were incubated for 60 min at 37°C. After three additional washes with PBS-T, the bound antibody was detected using TMB, and after 3 min of incubation at room temperature, the reaction was stopped by the addition of 2 M H2SO4 (30 ␮l/well), and the OD450 was measured. Standard curves were generated in each assay plate by using 2-fold serial dilutions of purified LT (165B; List Biological Laboratories) at a starting concentration of 400 ng/ml. A regression analysis (R2 ⬎ 0.96) was used to generate a standard curve for the determination of the LT concentrations in the test samples. Measurement of the relative ATP concentration. The relative ATP concentration of the bacterial whole-cell lysates was tested using an ATP determination kit (Molecular Probes) based on the manufacturer’s instructions (with a necessary modification). A 10-␮l aliquot of the bacterial culture, prepared as described above, was mixed with 90 ␮l of the standard reaction solution containing polymyxin B sulfate (104 U/ml) in a luminometer cuvette. The reaction mixture was vortexed briefly, and the luminescence was measured immediately in a fluorescence microplate reader (Tecan Infinite M200 Pro), with the luminescence readings taken for 10 s. The luminescence measurements were normalized to the bacterial density of each culture, which was measured as the OD600.

RESULTS

Effect of electron acceptors on the growth rate and LT secretion in ETEC under anaerobic conditions. In EPEC, the secretion of the virulence factors EspB and Tir by the TTS system can be restored under anaerobic conditions after adding electron acceptors (19). We therefore investigated whether the secretion of LT in wild-type ETEC H10407 through the T2S system would yield a similar result. Therefore, we compared the growth rate and the secretion of the virulence factor (LT) in ETEC grown under two low-O2 conditions, anaerobic and microaerobic, with or without electron acceptors. Under both of the low-O2 conditions, the growth rate of ETEC in the exponential phase was lower, and the cell density in the stationary phase was lower than under the aerobic conditions. In this study, terminal electron acceptors (an alternative to O2) were added as a stimulation of ETEC growth. Of the four electron acceptors tested in the study, fumarate, DMSO, TMAO, and nitrate affected ETEC growth in a similar manner. Although the growth rate in the exponential phase was not significantly affected, the growth rate was regained to a certain extent in the stationary phase (Fig. 1A). Furthermore, the expression and secretion level of the LT virulence factor that was encoded by the ETEC eltAB operon was compared between the aerobic and two-low O2 conditions. The amounts of LT secreted into the ETEC culture supernatant under anaerobic and microaerobic conditions were much lower than those under aerobic conditions (Fig. 1B). Next, the amounts of LT inside ETEC cells and of extracellular secretion in the presence of an electron acceptor were determined by Western blotting and the GM1-ELISA method. The level of LT expression inside the ETEC cells with an electron acceptor was almost the same as that without an electron acceptor. However, the amount of LT secretion in the culture supernatant with an electron acceptor (TMAO and nitrate) was greater than without any electron acceptor (Fig. 1C). Similar results were obtained using the GM1-ELISA method (Fig. 1D). It is interesting that there was no significant difference among the four electron acceptors in the ETEC growth-promoting effect; nevertheless, TMAO and nitrate had a significant effect on the restoration of LT secretion under the anaerobic conditions,

Infection and Immunity

iai.asm.org

2751

Lu et al.

FIG 1 Expression and secretion of LTa in ETEC under anaerobic conditions. (A) ETEC growth curve under anaerobic conditions with or without electron acceptors at 37°C. The bacterial cell densities were monitored using OD600 readings. (B) LTa expression and secretion in ETEC grown under aerobic, anaerobic, and microaerobic conditions at 37°C for 3 h. LTa in the culture supernatant and in the whole-cell lysate was extracted and detected, respectively, by Western blotting with anti-LT subunit (A⫹B) antibody. (C) Effect of electron acceptors on the expression and secretion of LTa. Wild-type ETEC H10407 was grown under anaerobic and microaerobic conditions at 37°C for 3 h with or without an electron acceptor. LTa in the culture supernatant and in the whole-cell lysate was extracted and detected, respectively, by Western blotting with anti-LT subunit (A⫹B) antibody. (D) Concentration of LT assayed by GM1-ELISA in supernatants from cultures of wild-type ETEC H10407 under anaerobic and microaerobic conditions. (E) Effect of electron acceptors on the LT secretion in an ETEC T2S-deficient mutant. The proteins in the culture supernatant and the whole-cell extract of wild-type H10407 (WT), a mutant lacking a functional T2S (⌬gspD), and a ⌬gspD strain complemented with pBAD-gspD/His under 0.5% L-arabinose induction were analyzed with anti-LT subunit (A⫹B) and anti-DnaK antibodies. (F) Concentrations of LT assayed by GM1-ELISA in the supernatants from the cultures and the strains and conditions used in panel E.

although DMSO and fumarate did not yield similar results. Furthermore, to exclude the LT release caused by the lysis of ETEC cells or other secretion pathways, the cytoplasmic protein DnaK was detected simultaneously, and a negative result occurred. At the same time, we found that LT was not secreted into the culture supernatant of the gspD mutant of ETEC, which lacked a functional T2S system (Fig. 1E and F). These results suggest that the LT was expressed but retained in ETEC cells without secretion under the anaerobic conditions. TMAO and nitrate increased the LT secretion, which was not caused by either the growth stimulation or another secretion pathway. Instead, the secretion was likely a result of other mechanisms that specifically respond to TMAO and nitrate. TMAO and nitrate-induced respiratory system activation is essential to LT secretion under anaerobic conditions. LT secretion was recovered by adding the terminal electron acceptors, TMAO and nitrate, which assist in electron transfer. To explore the relationship between the activation of the anaerobic respiratory system and LT secretion under the anaerobic conditions, the

2752

iai.asm.org

effect of a respiratory inhibitor on this process was examined. We found that the activation effect of TMAO and nitrate on LT secretion was completely abolished by pretreatment with amytal under the anaerobic conditions (Fig. 2A). The data indicated that activation of the respiratory system under the anaerobic conditions is essential to regain LT secretion. To further confirm the necessity of activation of the anaerobic respiratory system, a series of mutants that were deficient in respiratory electron transfer chains were used. Because quinones are essential components in these respiratory chains (⌬ubiE) that are deficient in the synthesis of ubiquinone and menaquinone (27), a ⌬menA mutant deficient in the synthesis of menaquinone and demethyl menaquinone (28) was constructed from wild-type ETEC H10407. In our study, both deficient strains (i.e., the ⌬ubiE and ⌬menA strains) impaired the restoration effect of LT secretion in response to TMAO and nitrate (Fig. 2B). Similar results were obtained with the GM1-ELISA method (Fig. 2C). These results strongly indicate that activation of the respiratory system is necessary to regain LT secretion in ETEC under anaerobic conditions.

Infection and Immunity

October 2016 Volume 84 Number 10

E. coli LT Secretion under Anaerobic Conditions

FIG 2 Role of the respiratory system in the activation of T2S and LT secretion by electron acceptors. (A) Effect of a respiratory inhibitor on the activation of LT secretion in wild-type ETEC H10407. The bacteria were grown under anaerobic conditions at 37°C for 3 h without any electron acceptor, amytal (5 mM) was added, and the samples were exposed for 30 min at 37°C. LTa in the whole-cell extract and culture supernatant was detected by Western blot analysis. (B) Effects of LT secretion on wild-type ETEC H10407 and ETEC H10407 with defective respiratory electron transfer chains. ETEC strains that were deficient in quinine synthesis (⌬ubiE and ⌬menA) were incubated under anaerobic conditions at 37°C for 3 h with or without an electron acceptor. (C) The concentration of LT in the supernatant was measured using the GM1-ELISA method with cultures of wild-type H10407 (WT) and quinine synthesis-deficient strains (⌬ubiE and ⌬menA) with or without electron acceptors.

The effect of TMAO and nitrate on LT secretion is achieved through restoration of the integrity of the respiratory chain under anaerobic conditions. During the last step of respiration, electrons are transferred from quinines to the terminal electron acceptors utilizing an electron acceptor-specific reductase. It has been verified that the complete respiration chain is essential for LT secretion under anaerobic conditions. In addition, we further investigated whether the effect of TMAO and nitrate on LT secretion is achieved by activation of the T2S system. First, several genes in the signaling pathways of the electron acceptor-specific reductase were inactivated, and the effect of TMAO and nitrate on the restored function of LT secretion was studied. TMAO reductase is encoded by torCAD (29), which is regulated by the TorSTR protein (30). Three operons encode three different nitrate reductases. First, the narGHJI operon encodes the most important nitrate reductase located in the cytoplasmic membrane, which is activated by the NarXL signaling pathway (31, 32). The second nitrate reductase is encoded by the narVWYZ operon (33) and displays biochemical activity similar to that of NarGHJI. The napFDAGHBC operon encodes the third nitrate reductase, which is located in the periplasm and is activated by the NarPQ signaling pathway (34). First, torCAD, narG, and narVWYZ were deleted separately in wild-type ETEC H1040, and the effect of regaining the LT secretion stimulated by TMAO and nitrate was determined. We found that these mutants specifically inhibited the restoration effect of the electron acceptor on LT toxin secretion. For instance, with TMAO, the LT toxin was almost undetectable in the ⌬torCAD culture supernatant under anaerobic conditions but was not affected by the response to nitrate (Fig. 3A). Similarly, LT was accumulated inside the ⌬narG cells but was almost not secreted in the supernatant, even with nitrate stimulation. Next, an ETEC H10407 strain lacking the reg-

October 2016 Volume 84 Number 10

FIG 3 Role of TMAO and nitrate-specific electron acceptor-specific reductase and its signal transduction systems in the activation of T2S and LT secretion under anaerobic conditions. (A) ETEC was grown under anaerobic conditions at 37°C for 3 h with or without an electron acceptor. LTa in the supernatant and whole cells was detected by using a Western blot assay. Strains: ⌬torCAD strain, deficient in TMAO reductase; narG strain, deficient in nitrate reductase; ⌬narVWYZ strain, deficient in NarVWYZ nitrate reductase; ⌬torSTR strain, lacking the TMAO-specific signaling system; ⌬narQ strain, lacking the nitratespecific sensor kinase; ⌬narP strain, lacking the nitrate-specific response regulator; ⌬narXL strain, lacking the nitrate-specific signaling system. (B) Concentrations of LT in the supernatant measured using the GM1-ELISA method from cultures of wild-type H10407 (WT) and the other strains described in panel A with or without electron acceptors.

Infection and Immunity

iai.asm.org

2753

Lu et al.

FIG 4 Relationship between the cellular ATP concentration and LT secretion under anaerobic conditions. (A) Cellular ATP concentration in wildtype ETEC with or without electron acceptors. The ⌬purK mutant grown in Dulbecco modified Eagle medium (DMEM) under anaerobic conditions at 37°C for 3 h with adenine and guanine. The ATP concentration was tested using an ATP determination kit, and the data quantification is shown as the means ⫾ the standard deviations (n ⫽ 3). (B) Cellular ATP concentration and LT secretion in wild-type ETEC H10407 grown with TMAO or nitrate and the ⌬purK mutant grown in DMEM under anaerobic conditions at 37°C for 3 h with adenine or guanine.

ulation function in the electron acceptor-specific reductase was constructed (⌬torSTR ⌬narP ⌬narQ ⌬narXL). We found that the LT expressed inside the cell was not affected. However, the LT secreted into the supernatant in response to TMAO or nitrate was specifically absent. LT was almost not detected in the ⌬torSTR culture supernatant even when TMAO was stimulated, and even if presenting nitrate in the ⌬narXL strain, the LT secretion was completely impaired (Fig. 3A). Similar results were obtained with the GM1-ELISA (Fig. 3B). These results suggest that the effect of TMAO and nitrate on LT secretion is achieved through specific restoration of the integrity of the respiratory chain under anaerobic conditions. Increasing ATP concentrations under an anaerobic condition does not promote LT secretion. GspE is an ATPase in the T2S system and, through the interaction with GspL to produce ATP, provides a driving force to the T2S system for secretion. To determine the relationship between increasing ATP and LT secretion under anaerobic conditions, the ATP concentrations of wildtype ETEC H10407 with or without electron acceptors were first measured. We found that all four electron accepters increased the ATP concentration (as shown in Fig. 4). Then, we increased the ATP concentration in ⌬purK ETEC by culturing with added adenine; however, LT in the supernatant was not detected. This result suggests that the increase in the ATP concentration is not the main reason for LT secretion under anaerobic conditions promoted by TMAO and nitrate. TMAO and nitrate facilitate the assembly of a functional T2S under anaerobic conditions through restoration of the integrity of the respiratory chain. Proteins destined to be secreted by the

2754

iai.asm.org

FIG 5 Electron acceptor-induced functional GspD protein assembly and LT secretion through specifically active corresponding reductases. (A) A Western blot analysis was performed for the whole-cell samples of the wild-type H10407 (WT), a ⌬gspD strain, or a ⌬gspD strain complemented with pBADgspD/His and strains with specific deficiencies in the respiratory chain, e.g., the ⌬torCAD (deficient in TMAO reductase) and ⌬narG (deficient in nitrate reductase) strains. These strains were cultured as previously described under anaerobic conditions with TMAO or nitrate. L-Arabinose (Ara; 0.5 mM) was used for the induction of plasmid-encoded protein GspD expression. The GspD secretin (multimer) and the monomer were observed by using an antiGspD antibody. The positions of the GspD secretin and the monomer are labeled on the left side of the panel, and the location of the standard protein marker is provided on the right side of each panel. (B) A Western blot analysis with anti-His antibody was performed to measure target protein GspD expression. (C) LT concentrations assayed by ELISA in the supernatants from cultures of strains corresponding to those in panel A.

T2S system are folded and transported out of the membrane through a pore formed by a multimeric GspD complex (secretin), which is located in the outer membrane. The GspD protein with a multimeric form is essential to the function of T2S. Therefore, we assumed that the electron acceptors likely facilitate the localization and multimerization of the GspD protein under anaerobic conditions. Therefore, to determine whether TMAO and nitrate are inducers of GspD assembly under anaerobic conditions, the status of GspD was determined with or without an electron acceptor by Western blotting, and the LT in the supernatant was also determined. As shown in Fig. 5, under aerobic conditions, the GspD proteins of wild-type ETEC and the ⌬gspD mutant complemented with pBAD-gspD/His could be multimerized and were able to secrete LT toxin, whereas the ⌬gspD mutant could not. Under anaerobic conditions, although the GspD protein was ex-

Infection and Immunity

October 2016 Volume 84 Number 10

E. coli LT Secretion under Anaerobic Conditions

pressed, only a monomer form of the GspD protein was detected in wild-type ETEC H10407, and it was unable to secrete LT. However, when TMAO or nitrate was added, the multimeric form of the GspD protein was restored. These data show that both TMAO and nitrate are induced to assemble T2S under anaerobic conditions. The results shown in Fig. 2 and 3 reveal that the integrity of the respiratory chain can be recovered by TMAO or nitrate through a specific pathway under anaerobic conditions. We wanted to further investigate the relationships between the integrity of the respiratory chain and the T2S assembly under anaerobic conditions. The multimeric form of the GspD protein was detected in ETEC deficient in the electron acceptor-specific reductase ⌬torCAD, ⌬narG, and wild-type H10407 strains. As shown in Fig. 5, electron acceptors were able to induce multimeric GspD in a specific manner. TMAO was unable to induce the multimeric form of GspD in ⌬torCAD regularly (this strain with an incomplete respiratory chain is deficient in TMAO reductase). In contrast, by adding nitrate, the GspD protein was not able to be regularly assembled in the ⌬narG mutant, a strain with an incomplete respiratory chain that is deficient in nitrate reductase. These data strongly indicate that the integrated respiratory chain is essential for assembling the functional T2S system. In addition, TMAO and nitrate induced a functional T2S system assembly under anaerobic conditions through integration of the respiratory chain by specifically activating the corresponding signaling pathway. In an effective T2S system, the GspD multimerized primer, which is localized to the outer membrane, requires YghG, a lipoprotein with a pilot function. In the absence of YghG, GspD is present in the inner membrane fractions accompanied by the abrogation of LT secretion. Therefore, we assumed that the T2S system assembly under anaerobic conditions also assists with the YghG pilotin protein. To confirm whether the GspD assembly is affected by YghG under anaerobic conditions, the ⌬yghG strain and its complemented strain with pBAD-yghG/His in trans were used, and the GspD assembly and LT concentration were tested with or without TMAO. As shown in Fig. 6, the expression of the yghG gene in the wild type and the complemented strain with pBAD-yghG/His in the ⌬yghG mutant resulted in GspD multimerization and LT secretion in the aerobic condition, as expected. However, under anaerobic conditions and without any electron acceptor, the GspD was not assembled in any of the strains mentioned above, and the LT in the supernatant was nearly undetectable by the GM1-ELISA method. The results indicate that the pilotin function of the YghG protein can be restored under anaerobic conditions only in the presence of an electron acceptor. In this study, 0, 0.1, and 0.5% L-arabinose were used to induce YghG expression, which was encoded by the pBAD-yghG/His vector. YghG expression was slightly promoted with an increase in L-arabinose concentration and, at the same time, the expression levels of the secretin form of GspD and LT in the supernatant were increased accordingly in both the TMAO and the nitrate groups. DISCUSSION

LT is a major virulence determinant of ETEC, which is released from the bacteria through the T2S system (15). Previously, many studies focused on the relationship between the T2S system and LT secretion under aerobic conditions (8, 35, 36). However, in the present study, the failure to identify LT in the culture supernatant under anaerobic and microaerobic conditions in vitro contra-

October 2016 Volume 84 Number 10

FIG 6 Electron acceptor-induced functional GspD protein assembly and LT secretion require the pilot protein YghG. (A) A Western blot analysis was performed for whole-cell samples of the wild-type H10407 (WT), ⌬yghG mutant, or a ⌬yghG strain complemented with pBAD-yghG/H under aerobic or anaerobic conditions, which were treated with TMAO or nitrate. L-Arabinose (Ara) was used for the induction of plasmid-encoded protein YghG expression, and the Ara concentrations (%) are shown. The GspD secretin (multimer) and the monomer were observed using an anti-GspD antibody. The positions of GspD secretin and the monomer are labeled on the left side of the panel, and the locations of the standard protein markers are shown on the right side of the panel. (B) A Western blot analysis with anti-His antibody was performed to indicate the target protein YghG expression. The samples were used according to panel A. (C) LT concentrations assayed via ELISA in the supernatant from cultures of strains corresponding to those in panels A and B.

dicted the well-understood concept that ETEC can release the toxin in the human or porcine intestine because the intestinal tract is microaerobic. We explored the key factors that cause LT secretion in ETEC under anaerobic conditions and the possible mechanisms. Initially, we found that the terminal electron acceptors (TMAO and nitrate) not only promote the ETEC growth rate but also activate LT secretion under anaerobic conditions. In addition, while the growth rate was increased using DMSO and fumarate, the LT secretion was not restored (Fig. 1). Although it is not clear why DMSO and fumarate were not able to activate the secretion of LT toxin, at least it is clear that a growth promotion effect is not a unique requirement for LT secretion under anaerobic conditions. Because ETEC is a facultative anaerobe, a regulating system exists to cope with anaerobic and microaerobic conditions (37) that assists with electron transfer from the donor to terminal acceptors. Low-molecular-weight oxygen-containing molecules are

Infection and Immunity

iai.asm.org

2755

Lu et al.

usually utilized as terminal electron acceptors, which are abundant in the intestine because they originate from food or are the products of metabolism (24). The main function of terminal electron acceptors is to achieve electron transfer under anaerobic conditions and thereby complete the respiratory system (38). Next, the relationship between respiratory system activation and LT secretion under anaerobic conditions was examined. With the addition of the respiratory inhibitor (amytal) (Fig. 2A) or in quinine synthesis-deficient ETEC strains (⌬ubiE and ⌬menA) (Fig. 2B), neither TMAO nor nitrate was able to restore the secretion of LT toxin. The data suggest that restoration of the LT secretion under anaerobic conditions was dependent on the activity of the respiratory system. The respiratory chains of E. coli consist of various dehydrogenases and terminal or redox enzymes, which are linked by quinines. Each pathway was regulated rigorously; for example, the presence of nitrate is able to repress other terminal reductases, such as fumarate or DMSO reductases, and nitrate regulation is affected by membranous nitrate sensors (NarX and NarQ) and cytoplasmic response regulators (NarL and NarP), which communicate via protein phosphorylation (38, 39). To further investigate whether the activation of LT secretion by TMAO and nitrate is through activation of the respiratory system, a series of mutants that were deficient in the TMAO- or the nitrate-specific signaling system and reductase were constructed, and the responses to these mutants were examined. As shown in Fig. 3, the effects of LT secretion restoration by TMAO and nitrate were regulated separately. For instance, during the last step of respiration, TMAO with two protons (H⫹) generated TMA, H2O, and ATP in a reaction catalyzed by TorCAD (38, 40). In the ⌬torCAD strain, the LT secretion response to TMAO was almost nonexistent, and the response to nitrate was not affected (Fig. 3A). A similar phenomenon was also detected in the ⌬narG strain. The next question is whether the LT secretion is activated by ATP incensement because ATP is also a driving force for secretion by the T2S system. In this study, we increased the ATP concentration in ETEC using the purK mutant and by growing the bacteria in medium containing adenine; however, LT secretion was still at a low level under the anaerobic conditions; even the ATP concentration in the ⌬purK mutant with adenine was higher than in the wild-type ETEC with TMAO or nitrate. These data suggest that an increase in the ATP level was not directly correlated with LT secretion and the T2S activity. According to previous studies, a functional T2S system is assembled in a dodecameric form and localizes to the outer membrane (41). The C-terminal 300 to 400 residues of GspD are the most conserved among the secretin superfamily (42, 43), which form the actual outer membrane pore for LT secretion (15). In the present study, we found that the terminal electron acceptor (TMAO and nitrate) could facilitate the GspD protein assembled under anaerobic conditions and thereby restore LT secretion (Fig. 5A). In addition, we found that this process was associated with activation of a specific electron transfer chain. This result further confirmed that the integrity of the respiratory chain is essential for the assembly of the T2S system. Based on previous research, the gspCDEFGHIJKLM cluster and three upstream genes—yghJ, pppA, and yghG—were cotranscribed, and deletion of the yghG gene prevented assembly of the GspD secretin, which resulted in a nonfunctional T2S system (35). In the present study, under anaerobic conditions, the secretin form of GspD was not detected in the ⌬yghG strain even when TMAO or nitrate was added. This result

2756

iai.asm.org

indicates that the electron acceptor-induced functional T2S requires YghG. As shown in Fig. 6, along with an increased amount of YghG expression induced by L-arabinose, the secretin form of GspD was also increased, strongly suggesting that YghG is an effective pilot protein and plays a crucial role in GspD protein assembly under anaerobic conditions. In summary, the results of our study illustrate that the restoration effect of electron acceptors on LT secretion was realized through completing the electron transfer of the respiratory chain. The integrated respiratory chain promoted the GspD assembly in the T2S system; thus, the secretion of LT toxin under anaerobic conditions was active. These results suggest that LT released in the intestine is likely to be precisely regulated and closely related to the activation of the anaerobic respiratory system and the assembly of the T2S system. These results also suggest that in an in vitro LT secretion study, the intestinal environment should be considered. In this study, the key factors of ETEC secreting LT toxin under anaerobic conditions were first reported, and a probable mechanism of ETEC secreting LT toxin in the intestinal oxygen-deficient environment was provided. These data have contributed to a deeper understanding of ETEC pathogenesis and interactions between a pathogen and the environment. In additional research regarding the complex environment of the human intestine, the effects of various types of food ingredients or metabolites or even the microbes on the toxin secretion of pathogens require further elucidation. ACKNOWLEDGMENT This study was supported by the National Natural Science Foundation of China (grant 31300121).

FUNDING INFORMATION This work, including the efforts of Xi Lu, was funded by National Natural Science Foundation of China (31300121).

REFERENCES 1. Berberov EM, Zhou Y, Francis DH, Scott MA, Kachman SD, Moxley RA. 2004. Relative importance of heat-labile enterotoxin in the causation of severe diarrheal disease in the gnotobiotic piglet model by a strain of enterotoxigenic Escherichia coli that produces multiple enterotoxins. Infect Immun 72:3914 –3924. http://dx.doi.org/10.1128/IAI.72.7.3914-3924 .2004. 2. Walker RI, Steele D, Aguado T. 2007. Analysis of strategies to successfully vaccinate infants in developing countries against enterotoxigenic Escherichia coli (ETEC) disease. Vaccine 25:2545–2566. http://dx.doi.org /10.1016/j.vaccine.2006.12.028. 3. Rowe B, Taylor J, Bettelheim KA. 1970. An investigation of traveller’s diarrhoea. Lancet i:1–5. 4. Qadri F, Svennerholm AM, Faruque AS, Sack RB. 2005. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin Microbiol Rev 18:465– 483. http://dx.doi.org/10.1128/CMR.18.3.465-483.2005. 5. NCBI. 1999. New frontiers in the development of vaccines against enterotoxinogenic (ETEC) and enterohaemorrhagic (EHEC) E. coli infections. Wkly Epidemiol Rec 74:98 –101. 6. Moss J, Garrison S, Oppenheimer NJ, Richardson SH. 1979. NADdependent ADP-ribosylation of arginine and proteins by Escherichia coli heat-labile enterotoxin. J Biol Chem 254:6270 – 6272. 7. Read LT, Hahn RW, Thompson CC, Bauer DL, Norton EB, Clements JD. 2014. Simultaneous exposure to Escherichia coli heat-labile and heatstable enterotoxins increases fluid secretion and alters cyclic nucleotide and cytokine production by intestinal epithelial cells. Infect Immun 82: 5308 –5316. http://dx.doi.org/10.1128/IAI.02496-14. 8. Johnson AM, Kaushik RS, Francis DH, Fleckenstein JM, Hardwidge PR. 2009. Heat-labile enterotoxin promotes Escherichia coli adherence to

Infection and Immunity

October 2016 Volume 84 Number 10

E. coli LT Secretion under Anaerobic Conditions

9.

10.

11.

12.

13. 14. 15.

16.

17.

18.

19. 20.

21.

22.

23.

24.

intestinal epithelial cells. J Bacteriol 191:178 –186. http://dx.doi.org/10 .1128/JB.00822-08. Fekete PZ, Mateo KS, Zhang W, Moxley RA, Kaushik RS, Francis DH. 2013. Both enzymatic and nonenzymatic properties of heat-labile enterotoxin are responsible for LT-enhanced adherence of enterotoxigenic Escherichia coli to porcine IPEC-J2 cells. Vet Microbiol 164:330 –335. http://dx .doi.org/10.1016/j.vetmic.2013.02.019. Koh SY, George S, Brozel V, Moxley R, Francis D, Kaushik RS. 2008. Porcine intestinal epithelial cell lines as a new in vitro model for studying adherence and pathogenesis of enterotoxigenic Escherichia coli. Vet Microbiol 130:191–197. http://dx.doi.org/10.1016/j.vetmic.2007.12.018. Verbrugghe E, Van Parys A, Leyman B, Boyen F, Arnouts S, Lundberg U, Ducatelle R, Van den Broeck W, Yekta MA, Cox E, Haesebrouck F, Pasmans F. 2015. Heat-labile enterotoxin of Escherichia coli promotes intestinal colonization of Salmonella enterica. Comp Immunol Microbiol Infect Dis 43:1–7. http://dx.doi.org/10.1016/j.cimid.2015.09.002. Wang X, Gao X, Hardwidge PR. 2012. Heat-labile enterotoxin-induced activation of NF-␬B and MAPK pathways in intestinal epithelial cells impacts enterotoxigenic Escherichia coli (ETEC) adherence. Cell Microbiol 14:1231–1241. http://dx.doi.org/10.1111/j.1462-5822.2012.01793.x. Wang X, Hardwidge PR. 2012. Enterotoxigenic Escherichia coli prevents host NF-␬B activation by targeting I␬B␣ polyubiquitination. Infect Immun 80:4417– 4425. http://dx.doi.org/10.1128/IAI.00809-12. Sandkvist M. 2001. Biology of type II secretion. Mol Microbiol 40:271– 283. http://dx.doi.org/10.1046/j.1365-2958.2001.02403.x. Tauschek M, Gorrell RJ, Strugnell RA, Robins-Browne RM. 2002. Identification of a protein secretory pathway for the secretion of heatlabile enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc Natl Acad Sci U S A 99:7066 –7071. http://dx.doi.org/10.1073/pnas .092152899. Bitter W, Koster M, Latijnhouwers M, de Cock H, Tommassen J. 1998. Formation of oligomeric rings by XcpQ and PilQ, which are involved in protein transport across the outer membrane of Pseudomonas aeruginosa. Mol Microbiol 27:209 –219. http://dx.doi.org/10.1046/j.1365-2958.1998 .00677.x. Strozen TG, Li G, Howard SP. 2012. YghG (GspS␤) is a novel pilot protein required for localization of the GspS␤ type II secretion system secretin of enterotoxigenic Escherichia coli. Infect Immun 80:2608 –2622. http://dx.doi.org/10.1128/IAI.06394-11. Haycocks JR, Sharma P, Stringer AM, Wade JT, Grainger DC. 2015. The molecular basis for control of ETEC enterotoxin expression in response to environment and host. PLoS Pathog 11:e1004605. http://dx.doi.org/10 .1371/journal.ppat.1004605. Beltrametti F, Kresse AU, Guzman CA. 1999. Transcriptional regulation of the esp genes of enterohemorrhagic Escherichia coli. J Bacteriol 181: 3409 –3418. Wijemanne P, Xing J, Berberov EM, Marx DB, Francis DH, Moxley RA. 2015. Relationship between heat-labile enterotoxin secretion capacity and virulence in wild-type porcine-origin enterotoxigenic Escherichia coli strains. PLoS One 10:e0117663. http://dx.doi.org/10.1371/journal.pone .0117663. Luo Q, Kumar P, Vickers TJ, Sheikh A, Lewis WG, Rasko DA, Sistrunk J, Fleckenstein JM. 2014. Enterotoxigenic Escherichia coli secretes a highly conserved mucin-degrading metalloprotease to effectively engage intestinal epithelial cells. Infect Immun 82:509 –521. http://dx.doi.org/10.1128 /IAI.01106-13. Baldi DL, Higginson EE, Hocking DM, Praszkier J, Cavaliere R, James CE, Bennett-Wood V, Azzopardi KI, Turnbull L, Lithgow T, RobinsBrowne RM, Whitchurch CB, Tauschek M. 2012. The type II secretion system and its ubiquitous lipoprotein substrate, SslE, are required for biofilm formation and virulence of enteropathogenic Escherichia coli. Infect Immun 80:2042–2052. http://dx.doi.org/10.1128/IAI.06160-11. Mudrak B, Kuehn MJ. 2010. Specificity of the type II secretion systems of enterotoxigenic Escherichia coli and Vibrio cholerae for heat-labile enterotoxin and cholera toxin. J Bacteriol 192:1902–1911. http://dx.doi.org/10 .1128/JB.01542-09. Ando H, Abe H, Sugimoto N, Tobe T. 2007. Maturation of functional type III secretion machinery by activation of anaerobic respiration in enterohaemorrhagic Escherichia coli. Microbiology 153:464 – 473. http://dx .doi.org/10.1099/mic.0.2006/000893-0.

October 2016 Volume 84 Number 10

25. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640 – 6645. http://dx.doi.org/10.1073/pnas.120163297. 26. Ristaino PA, Levine MM, Young CR. 1983. Improved gm1-enzymelinked immunosorbent assay for detection of Escherichia coli heat-labile enterotoxin. J Clin Microbiol 18:808 – 815. 27. Lee PT, Hsu AY, Ha HT, Clarke CF. 1997. A c-methyltransferase involved in both ubiquinone and menaquinone biosynthesis: isolation and identification of the Escherichia coli ubiE gene. J Bacteriol 179:1748 –1754. 28. Suvarna K, Stevenson D, Meganathan R, Hudspeth ME. 1998. Menaquinone (vitamin K2) biosynthesis: localization and characterization of the menA gene from Escherichia coli. J Bacteriol 180:2782–2787. 29. Ansaldi M, Bordi C, Lepelletier M, Mejean V. 1999. TorC apocytochrome negatively autoregulates the trimethylamine N-oxide (TMAO) reductase operon in Escherichia coli. Mol Microbiol 33:284 –295. http://dx .doi.org/10.1046/j.1365-2958.1999.01468.x. 30. Mejean V, Iobbi-Nivol C, Lepelletier M, Giordano G, Chippaux M, Pascal MC. 1994. TMAO anaerobic respiration in Escherichia coli: involvement of the tor operon. Mol Microbiol 11:1169 –1179. http://dx.doi .org/10.1111/j.1365-2958.1994.tb00393.x. 31. Darwin AJ, Li J, Stewart V. 1996. Analysis of nitrate regulatory protein NarL-binding sites in the fdnG and narG operon control regions of Escherichia coli K-12. Mol Microbiol 20:621– 632. http://dx.doi.org/10.1046/j .1365-2958.1996.5491074.x. 32. Walker MS, DeMoss JA. 1994. NarL-phosphate must bind to multiple upstream sites to activate transcription from the narG promoter of Escherichia coli. Mol Microbiol 14:633– 641. http://dx.doi.org/10.1111/j.1365 -2958.1994.tb01302.x. 33. Blasco F, Iobbi C, Ratouchniak J, Bonnefoy V, Chippaux M. 1990. Nitrate reductases of Escherichia coli: sequence of the second nitrate reductase and comparison with that encoded by the narGHJI operon. Mol Gen Genet 222:104 –111. 34. Darwin AJ, Ziegelhoffer EC, Kiley PJ, Stewart V. 1998. Fnr, NarP, and NarL regulation of Escherichia coli K-12 napF (periplasmic nitrate reductase) operon transcription in vitro. J Bacteriol 180:4192– 4198. 35. Yang J, Baldi DL, Tauschek M, Strugnell RA, Robins-Browne RM. 2007. Transcriptional regulation of the yghJ-pppA-yghG-gspCDEFGHIJKLM cluster, encoding the type II secretion pathway in enterotoxigenic Escherichia coli. J Bacteriol 189:142–150. http://dx.doi.org/10.1128/JB.01115-06. 36. Ho TD, Davis BM, Ritchie JM, Waldor MK. 2008. Type 2 secretion promotes enterohemorrhagic Escherichia coli adherence and intestinal colonization. Infect Immun 76:1858 –1865. http://dx.doi.org/10.1128/IAI .01688-07. 37. Shalel-Levanon S, San KY, Bennett GN. 2005. Effect of ArcA and FNR on the expression of genes related to the oxygen regulation and the glycolysis pathway in Escherichia coli under microaerobic growth conditions. Biotechnol Bioeng 92:147–159. http://dx.doi.org/10.1002/bit.20583. 38. Unden G, Bongaerts J. 1997. Alternative respiratory pathways of Escherichia coli: energetics and transcriptional regulation in response to electron acceptors. Biochim Biophys Acta 1320:217–234. http://dx.doi.org/10 .1016/S0005-2728(97)00034-0. 39. Garland PB, Downie JA, Haddock BA. 1975. Proton translocation and the respiratory nitrate reductase of Escherichia coli. Biochem J 152:547– 559. http://dx.doi.org/10.1042/bj1520547. 40. Jones RW. 1980. The role of the membrane-bound hydrogenase in the energy-conserving oxidation of molecular hydrogen by Escherichia coli. Biochem J 188:345–350. http://dx.doi.org/10.1042/bj1880345. 41. Korotkov KV, Johnson TL, Jobling MG, Pruneda J, Pardon E, Héroux A, Turley S, Steyaert J, Holmes RK, Sandkvist M, Hol WG. 2011. Structural and functional studies on the interaction of GspC and GspD in the type II secretion system. PLoS Pathog 7:e1002228. http://dx.doi.org/10 .1371/journal.ppat.1002228. 42. Guilvout I, Chami M, Engel A, Pugsley AP, Bayan N. 2006. Bacterial outer membrane secretin PulD assembles and inserts into the inner membrane in the absence of its pilotin. EMBO J 25:5241–5249. http://dx.doi .org/10.1038/sj.emboj.7601402. 43. Guilvout I, Nickerson NN, Chami M, Pugsley AP. 2008. In vitro multimerization and membrane insertion of bacterial outer membrane secretin PulD. J Mol Biol 382:13–23. http://dx.doi.org/10.1016/j.jmb.2008.06 .055.

Infection and Immunity

iai.asm.org

2757