Fish & Shellfish Immunology 41 (2014) 493e500

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio) Jinhua Jiang a, b, Shenggan Wu a, b, Changxing Wu a, b, Xuehua An a, b, Leiming Cai a, b, Xueping Zhao a, b, * a

State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, Zhejiang, China Key Laboratory for Pesticide Residue Detection of Ministry of Agriculture, Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, Zhejiang, China

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 7 May 2014 Received in revised form 13 August 2014 Accepted 29 September 2014 Available online 7 October 2014

Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 mg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFa which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamicepituitaryegonadal/thyroid (HPG/HPT) axis including VTG, ERa, ERb2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 mg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Carbendazim Zebrafish Apoptosis Immunotoxicity Endocrine disruption

1. Introduction The adverse effects of endocrine disrupting chemicals (EDCs) on the endocrine systems of human and wildlife have attracted global attention in recent years [1,2]. Many insecticides, herbicides and fungicides in aquatic organisms have been identified as actual or

* Corresponding author. Key Laboratory for Pesticide Residue Detection of Ministry of Agriculture, Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, Zhejiang, China. Tel.: þ86 571 86404229; fax: þ86 571 86402186. E-mail addresses: [email protected], [email protected] (J. Jiang), [email protected] (X. Zhao). http://dx.doi.org/10.1016/j.fsi.2014.09.037 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

potential EDCs, which are capable of impacting the reproductive health and survival of various fish species. However, how these pesticides affect non-target organisms is less known and to further explore the risks caused by these pesticides constitutes a big challenge. Carbendazim is a systemic broad-spectrum fungicide which is used to control various fungal pathogens and as a preservative in paint, papermaking, textile, leather industry, as well as a preservative of fruits [3]. Although carbendazim is classified by World Health Organization (WHO) as unlikely to present hazard in normal use, it is poorly catabolized and remains in tissues such as gonads, liver, adrenals, skin and other organs, many reports evidence the adverse effects of carbendazim on various aspects of reproduction

494

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500

in hamsters, mice, rats and humans, US-EPA also has classified carbendazim as a probable human carcinogen [4e6]. Carbendazim was shown to be very persistent in the water layer and have negative impacts on the measured life traits of daphnids, including a decrease on both feeding rates and reproduction on Daphnia magna [7]. Previous studies had also shown that carbendazim was harmful to Prussian carp embryonic development and hatching, and its application could seriously affect the macroinvertebrate community [8,9]. Since most published studies focused on the chronic toxicity of carbendazim to aquatic organisms [9,10], more consideration should be given to the potential hazards caused by carbendazim to reproduction and endocrine system in fish species, especially in the early life stages. Endocrine disruptions can result in developmental malformations at early life stages. Zebrafish is a well-established vertebrate model for in vivo studies on ontogenetic development and toxicology, moreover, the embryonic development was shown to be sensitive to environmental contaminants, and offer distinct morphological observations of different endpoint when exposed to chemical during the early life stages [11]. Previous reports have also demonstrated that certain EDCs including many pesticides can mimic endogenous hormone to regulate the expression of endocrine related genes, like the estrogen receptors (ERs), vitellogenins (Vtgs) and P450 aromatases, which are now monitored frequently as biomarkers for the potential EDCs in the aquatic environment [12e15]. In addition to the endocrine disruptions, many pesticides were also demonstrated to induce apoptosis and immunotoxicity in vivo and/or in vitro in previous experiments [16e20]. Furthermore, the components of immune and reproductive systems overlap, previous investigations have indicated the presence of multi-directional interactions among the endocrine disruption, cell apoptosis and immune system, the genes involved in innate immunity and cell apoptosis were demonstrated to be the targets for estrogenic compounds [21e24]. To our knowledge, whether carbendazim had the potential to induce endocrine disruption, apoptosis and immunotoxicity in zebrafish was not known before this study. In this study, zebrafish embryos were used to assess the toxic effects of carbendazim. The dose-related transcriptional changes of genes related to apoptosis pathway including P53, murine double minute 2 (Mdm2), apoptotic protease activating factor-1 (Apaf1), Bcell lymphoma/leukaemia-2 gene (Bcl2), Bcl2 associated X protein (Bax), Bcl2 binding component-3 (Bbc3), 8-oxoguanine DNA glycosylase (Ogg1), Caspase 3 (Cas3), Caspase 8 (Cas8) and Caspase 9 (Cas9), as well as the genes related to the innate immune system, such as tumor necrosis factor a (TNFa), interleukin-1 beta (IL-1b), interferon 1 (IFN), interleukin-8 (IL-8), CXCL-C1C and CC chemokine (CCL1) were determined. The expression of genes that are involved in the hypothalamicepituitaryegonadal/thyroid (HPG/HPT) axis, including the vitellogenin gene (VTG), three estrogen receptors (ERa, ERb1, ERb2), two cytochrome P450 aromatases (CYP19a, CYP19b), thyroid hormone receptor alpha a and beta (Thraa, Thrb), deiodinases (Dio1, Dio2) and thyroid stimulating hormone (Tshb) were also examined in this study to elucidate the potential mechanism of endocrine disruption induced by carbendazim.

2. Materials and methods 2.1. Chemicals and materials Carbendazim (97% purity) was purchased from Sigma (St. Louis, MO, USA). The saturated solution (8 mg/L) and the test solutions for the following experiments were prepared by diluting the carbendazim in charcoal-filtered water containing 0.01% Tween-80.

2.2. Zebrafish husbandry and embryo collection Adult wild type zebrafish (AB strain) were purchased from the Institute China Zebrafish Resource Center (Wuhan, China) and acclimatized separately at a constant temperature (27 ± 1  C) with a 14 h:10 h light/dark cycle in a flow-through system containing charcoal-filtered water. Zebrafish were fed twice daily with freshly hatched brine shrimp. Male and female zebrafish (2:1) were paired in spawning boxes overnight before spawning. Spawning was induced when the light was turned on the following morning and the fertilized eggs were washed twice with fresh water. At three hour post fertilization (hpf), embryos were collected and examined under a dissecting microscope, and embryos that had developed normally and had reached the blastula stage were selected as previous described by Westerfield for the subsequent experiments [25]. 2.3. Carbendazim exposure experiments Our preliminary toxicity study showed that 2 mg/L carbendazim was lethal to zebrafish embryo and concentrations under 0.5 mg/L had no effect to embryo development (Wu and Jiang, unpublished data). To investigate the toxic effect of carbendazim on zebrafish embryo development, zebrafish embryos at 3-hpf were randomly distributed into 6-well plates containing different concentrations of carbendazim (0, 4, 20, 100, 500 mg/L) for 96 h. The control embryos were exposed to water with only 0.01% Tween-80. Thirty fertilized embryos were randomly placed in 6-well plates using a pipette, each 6-well plate was considered as one replicate for each concentration, and three replicates were used for each treatment. During the experimental period, the plates were incubated under ambient temperature (28 ± 1  C) with a photoperiod of 14 h light/ 10 h dark, and the development of the embryos was monitored under an inverted dissecting microscope (Leica, Germany). During exposure, dead embryos/larvae were promptly counted and removed. Approximately 10% of the embryos in each treatment were found dead during the first 24 h post the exposure to carbendazim, no death was found after that period. The exposure solutions were renewed daily to keep the appropriate concentrations of carbendazim and water quality. After the exposure to different concentrations of carbendazim, about fifteen newly hatched zebrafish were collected from each treatment as a group and later used for gene expression analysis. 2.4. Gene expression analysis Total RNA was extracted from each harvested group (about 15 homogenized larvae) using Trizol reagent as instructed (Takara, Dalian, China). The RNA samples were dissolved in ribonucleasefree water, the quality and concentrations of the RNA samples were monitored using microvolume UVevis spectrophotometers (NanoDrop, Thermo Scientific, USA) and in 1% agarose gels through electrophoresis. Reverse-transcription (RT) reactions to synthesize cDNA were carried out using a reverse transcriptase kit (Takara, Dalian, China). Quantitative real-time PCR amplifications were performed on a Real-time PCR system (Biorad, CA, USA) using the SYBR green system (Takara, Dalian, China). In order to evaluate the effect of carbendazim on apoptosis, immunotoxicity and endocrine disruption, the mRNA levels of the genes involved in these pathways were analyzed, the sequences of the primers used in this study are listed in Table 1. The quantitative real-time PCR amplifications were performed with the following parameters: denaturation for 3 min at 95  C, followed by 40 cycles at 95  C for 15 s, 57  C for 15 s and 72  C for 20 s in order to quantify the fluorescence at a temperature above the denaturation of primer

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500 Table 1 Sequences of primer pairs used in the real-time quantitative PCR reaction.

495

error (SE). Values were considered statistically significant when p was less than 0.05 or 0.01.

Target gene

Primer sequence (50 -30 )

Accession number

P53

F: TTGTCCCATATGAAGCACCA R: TGGAGCCCTTGGCCTTTTT F: AGCTGATTGGCTTCCAGAAA R: TTGGGGCGACTCTGACAGAT F: CAGGGACAATTCAGGAACAGA R: TGAAGGAAGACAGCGTTCAT F: TGATTTTCCATCTCTGCAAGA R: TACCGGGAGCAAAGTTGTAGT F: TATCAGGTTGTGGGAGACGGA R: ACAAATGCAGCGTTTCTGCT F: AACGCAGCTTTCTAACCGTG R: TCTGCTGACCGTACATCTCCA F: ATGAGCTGGATGGAAATGC R: CCTGTTCCCTGATCCAGTTAA F: GTTTTGGGCACAGATGGTAA R: TACTGTGGCCATTCCGATCA F: ATTCAGGCTTGTCGAGGAACA R: TATGGTTGACCCTGGTCATG F: CGGAGGAGGTGAGAAGGATAT R: TCCAGCACACGATCAAGATT F: TCATCTCTCGTGAATCGTGCT R: TTCAGCGAGTCGGTGTTATT F: ACAACAAAGGTGCAGCCATT R: GTTTGCGCTTCAGCATTTTC F: TTGAAAGTGCGCTTCAGCA R: CGGTCTCCTTCCTGAAGAACA F: GGCTGGAAAACAACGAGATCA R: AAGATCAAAGACGGCTCCAA F: TGGCATTTCTGACCATCATTG R: TCTTCTTAACCCATGGAGCA F: ATCATCCACCTTATGGATGCC R: CCCATGCTTCAGCACTGTATT F: GGATGCACAGATCCGAATTCT R: TGCTGTGACAGGTTGTTGGT F: TACCATCCGGTGGTGGATTT R: CCTTCGTCATCACCATAGCAA F: TGCTGCACGTCTAGAAGTGGA R: GATTGATGGGAACAGCGACA F: AGCCGCTGATGGACAACTT R: CTCCAGCAACAGGTCATACA F: TGCTGGCTGGATATTCTGATG R: ATCCTCAGGAGTCTGTGGCAA F: AAAGCCATGATCCTCCTGAA R: CTTCATCTTCATGCAGTGCA F: TCGTCCACTGGTTCTGAGTTT R: TTCATCTCATCCACCACCACA F: TGAGTGGCAGCGCATGTTAA R: ACCGGCAGCTGGCTTATAAA F: CATCACACGAGTTGTGGACTT R: TGACAGGCTCTTCCCCAAA F: TACTCTGACGCTAAACGGGGA R: CCTTGTGCTTACGGTAGTTGA F: TGCATGGGCTTCTGTTTCT R: TTCTCCTCGGGGTACAGATGA F: TCTTCCAGCCTTCCTTCCT R: ATCTTCATGGTGGAAGGAGCA

AF365873.1

3. Result

AF010255.1

3.1. Effect of carbendazim on apoptosis-related gene transcription

NM_001045472.2

The transcriptional levels of the main genes involved in cell apoptotic signaling processes in newly hatched zebrafish were altered after exposure to various concentrations of carbendazim for 96 h. The expressions of P53, Mdm2 and Bbc3 during embryo development showed 5.9, 4.7 and 2.3-fold increase, respectively, after the exposure to 500 mg/L carbendazim, however, after exposed to 20 mg/L and 100 mg/L carbendazim, the expression of Bbc3 was decreased significantly when compared with control (Fig. 1(A)e(C)). Moreover, the mRNA levels of Ogg1 were decreased in all carbendazim treatment groups (Fig. 1(D)). As for Apaf1, the mRNA level was down-regulated when exposed to 100 mg/L carbendazim (Fig. 1(E)). In addition, the transcription of the gene encoding the anti-apoptotic protein Bcl2 was decreased after the exposure to the 500 mg/L carbendazim treatment (Fig. 1(F)). As for the Bcl2 associated X protein Bax, no significant changes in gene expressions were found after the various treatments with carbendazim (Fig. 1(G)). To assess whether carbendazim could induce apoptosis via the caspase pathway, the mRNA levels of Cas3, Cas8 and Cas9 were also determined by RT-qPCR. The results showed that the transcription level of Cas8 was decreased after the exposure to a treatment with a low concentration of carbendazim (4 mg/L), while a significantly upregulation was occurred at the highest exposure concentration group (500 mg/L), with an increase of 2.80-fold compared with the control (Fig. 1(H)). The relative expression of Cas3 was downregulated after the treatment with 500 mg/L carbendazim (Fig. 1(I)). For Cas9 mRNA expression, no obvious induction was found at all the treatments (Fig. 1(J)). Taken together, carbendazim might regulate the gene transcription of the caspase pathway to affect the components of cell apoptosis.

Mdm2 Bbc3 Ogg1 Apaf1 Bcl2 Bax Cas8 Cas3 Cas9 CXCL-C1C CCL1 IL-1b TNFa IL-8 IFN CYP19a CYP19b VTG ERa ERb1 ERb2 Dio1 Dio2 Thraa Thrb Tshb

b-actin

NM_001123308.2 AF251502.1 NM_001030253.2 AF231015.1 NM_131510.2 NM_131877.3 NM_001007404.2 NM_001115060.1 AF201450.1 AY340959.1 AB183467.1 XM_001342570.3 BC162493.1 AF183906.1 AF183908.1 NM_001044897.2 AF349412.1 AJ414566.1 AJ414567.1 AY221259.1 AY221260.1 NM_131396.1 NM_131340.1 NM_181494.2 AF057040.1

dimers. Once the amplifications were completed, melting curves were obtained to identify the PCR products. b-actin was considered as a housekeeping gene, and each mRNA level was expressed as its ratio to b-actin mRNA. The experiment was repeated three times, the relative quantification of gene expression among the treatment groups was calculated using the 2DDCt method [26].

3.2. Effect on the transcription of genes related to innate immune system To investigate the responses of genes that are known to participate in immune system, the mRNA levels of TNFa, IL-1b, IFN, IL-8, CXCL-C1C and CCL1 in the carbendazim treated zebrafish larvae were determined. The results showed that the transcription level of CXCL-C1C was significantly up-regulated in the 500 mg/L group, which was 5.16-fold higher than that of control (Fig. 2(A)), while the mRNA level of CCL1 was decreased after the exposure to the same concentration of carbendazim (Fig. 2(B)). In addition, the expression of IL-1b was down-regulated significantly when embryos exposed to 4 and 100 mg/L carbendazim for 96 h (Fig. 2(C)). With regard to TNFa, significant differences were observed between carbendazim treated groups and the control group, the mRNA level decreased significantly after exposure to 100 mg/L carbendazim, interestingly, the expression of the same gene in embryos treated with carbendazim at 4, 20 or 500 mg/L concentration showed a significant up-regulation (Fig. 2(D)). However, no significant induction was observed in IL-8 and IFN mRNA expression for all treatment conditions (Fig. 2(E) and (F)).

2.5. Statistical analysis All statistical analyzes were carried out using SPSS 13.0 (USA). Significant differences between the control and experimental groups were assessed by one-way analysis of variance (ANOVA) and Dunnett's test. All values were expressed as the mean ± standard

3.3. Effect on the transcription of genes involved in the HPG and HPT axis In order to assess the endocrine disruption of carbendazim during the early developmental stage, the expression of genes

496

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500

Fig. 1. Relative expression levels of apoptosis-related gene P53 (A), Mdm2 (B), Bbc3 (C), Ogg1 (D), Apaf1 (E), Bcl2 (F), Bax (G), Cas8 (H), Cas3 (I) and Cas9 (J) in zebrafish exposure to various concentrations of carbendazim for 96 h during embryo development. Line bars in each column of each figure denote standard errors of three repeated experiments. The asterisk represents a statistically significant difference when compared with the untreated control, * at p < 0.05 and ** at p < 0.01 levels.

involved in the HPG/HPT axis were detected. As was shown in Fig. 3, the expression levels of two cytochrome P450 aromatases CYP19a and CYP19b, were increased significantly after the treatment with 20 or 100 mg/L carbendazim (Fig. 3(A) and (B)). However, the VTG transcripts were down-regulated at 4 and 100 mg/L carbendazim treatment when compared with the control (Fig. 3(C)). In addition, after carbendazim treated for 96 h, the mRNA levels of ERa and ERb2 were both decreased significantly at 20 and 500 mg/L (Fig. 3(D) and (E)). Interestingly, no significant induction for ERb1 was observed at any concentration tested (Fig. 3(F)).

The expression of thyroid hormone synthesis related genes were also altered after the exposure of embryos to various concentrations of carbendazim for 96 h. The results demonstrated that the expression of deiodinase Dio1 was decreased after the treatment with 4, 20 and 500 mg/L of carbendazim, while the Dio2 transcripts only decreased at 500 mg/L of carbendazim (Fig. 4(A) and (B)). The expression of thyroid hormone receptor gene Thraa, was decreased only after the treatment with carbendazim at 4 or 500 mg/L concentration (Fig. 4(C)), and the other thyroid hormone receptor gene Thrb showed a down-regulation after all the

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500

497

Fig. 2. Expression of the mRNA of the innate immune-related genes CXCL-C1C (A), CCL1 (B), IL-1b (C), TNFa (D), IL-8 (E) and IFN (F) in zebrafish exposure to various concentrations of carbendazim for 96 h during embryo development. Values were normalized against b-actin as a housekeeping gene and represent the mean mRNA expression value ± SD (n ¼ 3) relative to those of the controls. The error bars represent the standard deviation (SD) of the mean. The asterisk represents a statistically significant difference when compared with the untreated control, * at p < 0.05 and ** at p < 0.01 levels.

treatments compared with that of the control group (Fig. 4(D)). For the thyroid stimulating hormone gene Tshb, its expression did not exhibit significant changes after all the carbendazim treatments (Fig. 4(E)). 4. Discussion The objective of this study was to investigate the aquatic toxicity of carbendazim in zebrafish embryo. The results demonstrated that the exposure of zebrafish embryo to different concentrations of carbendazim lead to significant changes in the expressions of many genes that play critical roles during cell apoptosis, immunotoxicity as well as the endocrine system. Apoptosis is a highly regulated process by which an organism eliminates its unwanted cells without eliciting an inflammatory response [27]. Research had demonstrated that Mdm2 knockdown embryos were severely apoptotic, and P53 is essential for DNA damage-induced apoptosis during zebrafish embryo development [28]. Bcl-2 is one of the members of the Bcl2 family which plays an important role in the regulation of apoptosis, and during apoptotic stimulation, Bcl2 inhibits apoptosis occurring through the P53 pathway [29], and the ratio of the Bcl2/Bax protein could affect the release of mitochondrial cytochrome c [30]. Previous study showed that exposure to carbendazim resulted in impaired testicular function and subsequent germ cell apoptosis in adult rat testis [31]. In current study, the transcripts of P53, Mdm2 and Bbc3 were upregulated while the expression level of Bcl2 was decreased upon the treatment with 500 mg/L carbendazim. Our results indicated

that P53, Mdm2, Bbc3 and Bcl2 might involve in apoptosis in zebrafish embryo treated with 500 mg/L carbendazim. We speculated that the high concentration of carbendazim (500 mg/L) might change the ratio between the Bcl2 and Bax protein through altering the gene expression patterns that lead to an induction of mitochondrial cytochrome c release and then activation of apoptosis through the P53 pathway. Generally, caspase activity is a useful marker for detecting stress-induced apoptosis in the early-life stages of fish, apoptosis can occur through caspase-dependent or caspase-independent pathways. Typically, when the cell is stressed or its DNA is damaged, P53 is activated and then trigger the activation of the important regulator of apoptosis, caspase-3, and accelerate cell death [32,33]. Previous study demonstrated that caspase-8 was involved in the extrinsic pathway while caspase-9 participated in the intrinsic pathway [34]. In this study, the expression of Cas3 was down-regulated while the transcript of Cas8 was increased after 500 mg/L of carbendazim exposure, we proposed that the apoptosis observed in this study was likely due to the activation via the extrinsic pathway involving caspase-8 and through the P53 activation. Pesticides have the potential to induce cell apoptosis and immunotoxicity, the fact is that cell apoptosis would destruct the immune cells and decrease the immune defense ability [35,36]. Study also revealed that the activation of apoptosis by extrinsic pathway started in the tumor necrosis factor (TNF) family receptors [37,38]. Consistent with previous reports, our results showed that the expression of TNFa was up-regulated after the treatments with

498

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500

Fig. 3. Expression of CYP19a (A), CYP19b (B), VTG (C), ERa (D), ERb2 (E) and ERb1 (F) in zebrafish exposure to various concentrations of carbendazim for 96 h during embryo development. Values were normalized against b-actin as a housekeeping gene and represent the mean mRNA expression value ± SD (n ¼ 3) relative to the values in the controls. The error bars represent the standard deviation (SD) of the mean. The asterisk represents a statistically significant difference when compared with the untreated control, * at p < 0.05 and ** at p < 0.01 levels.

carbendazim at 4, 20 or 500 mg/L concentration, this finding suggested the presence of an overlap between apoptosis and immunotoxicity. In zebrafish, the innate immune response is the sole defense against infection by xenobiotics during embryo development [39]. The cytokines secreted by immune cells, such as IFN, and the chemokines including IL-8, CXCL-C1C and CC chemokine, are vital in modulating immune and inflammatory responses [40]. In the present study, carbendazim exposure altered the expression patterns of cytokines and chemokines including CXCL-C1C, CCL1, IL1b and TNFa, we speculated that these cytokines and chemokines were also responsible during immune response to the exposure of carbendazim. Previous study showed that some contaminants could affect fish immune system and cause endocrine disruption [41]. A number of studies have shown that many pesticides produce deleterious effects on the development of non-target organism by disrupting the endocrine system. In the present study, the expression patterns of genes that participate in the HPG/HPT axis were also studied to elucidate the potential mechanism of endocrine disruption induced by carbendazim during the development of zebrafish embryo. In oviparous vertebrates, the female-specific yolk protein precursors vitellogenins (VTG) act to transport nutrients into oocytes during the maturation of oocytes and the synthesis of VTG is regulated through 17b-estradiol activation of ERs [15,42]. VTG also has been proven to be an ideal biomarker for detecting exposure of environmental estrogens [43]. Carbendazim showed no estrogenic activity in all three estrogen receptor (ER) subtypes in Medaka (Oryzias latipes) [44]. Interestingly, the result obtained in our study

showed that the gene transcription of two estrogen receptors ERa and ERb2, were down-regulated after 20 and 500 mg/L of carbendazim exposure, while the VTG expression was decreased after the treatment with 4 or 100 mg/L carbendazim. It was possible that the suppression of VTG expression was caused by the inactivation of ERs. We speculated that the exposure of zebrafish embryo to different concentrations of carbendazim could alter the expression of the estrogen receptors and thus affect the synthesis of VTG leading to an abnormal absorption of nutrients during the embryonic development. Cytochrome P450 (CYP) enzymes play a key role in the steroidogenic pathway that aromatize androgens to estrogens, and the CYP aromatase (CYP19) is the terminal enzyme in the formation of the steroid hormones [45]. It was shown that CYP19 was an ERdependent transcriptional activation factor, and interference with the aromatase CYP19 might cause malfunction of the reproductive system [46]. In current study, the expression of two cytochrome P450 aromatases CYP19a and CYP19b was increased significantly after 20 and 100 mg/L carbendazim treated respectively, it was possible that the reduction of VTG gene expression caused by carbendazim might up-regulate the expression of downstream genes like CYP19a and CYP19b to stimulate the synthesis of estrogens to adapt to the environment during zebrafish development. Like steroid hormones, thyroid hormones also play important roles in the regulation of development, growth and reproduction in vertebrates [47]. The alterations of gene transcriptions, hormone levels and enzyme activities related to the HPT axis caused by chemicals, could be applied to assess the effect of thyroid endocrine

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500

499

disruption [48e50]. Previous studies showed that the thyroid hormone receptor alpha a and beta served the regulatory roles during the embryonic and larval development of zebrafish [51], and the thyronine deiodinases Dio1 and Dio2 were able to convert thyroid hormone T4 into T3 [52]. In our study, we found that the expressions of both deiodinase genes Dio1 and Dio2 and two thyroid hormone receptor genes Thraa and Thrb were all decreased after carbendazim treated for 96 h, inferred that carbendazim might have the potential to affect the thyroid hormone synthesis and interfered the embryonic development of zebrafish. To our knowledge, this was the first study to evaluate apoptosis, immunotoxicity and endocrine disruption induced by carbendazim during embryo development in zebrafish. We demonstrated that the mRNA levels of some key genes involved in these pathways were significantly altered after the exposure to carbendazim, indicated the potential risk of carbendazim during zebrafish embryo development. Further investigations on the effects of carbendazim on post-hatched zebrafish are needed in order to better understand the molecular mechanism underlying the toxic effects caused by carbendazim. Moreover, explore the multi-directional interactions among the endocrine system, cell apoptosis and immune system will provide us further insight into the comprehensive knowledge on the environmental endocrine disruption chemicals. Acknowledgments The research was supported by grants from Opening Project Fund of State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control (No. 2010DS700124-KF1306) and the Innovation Project of Zhejiang Academy of Agricultural Sciences (2014CX010). References

Fig. 4. Relative expression levels of the genes involved in the HPT axis. Expression of Dio1 (A), Dio2 (B), Thraa (C), Thrb (D) and Tshb (E) in zebrafish exposure to various concentrations of carbendazim for 96 h during embryo development. Values were normalized against b-actin as a housekeeping gene and represent the mean mRNA expression value ± SD (n ¼ 3) relative to the values in the controls. The error bars represent the standard deviation (SD) of the mean. The asterisk represents a statistically significant difference when compared with the untreated control, * at p < 0.05 and ** at p < 0.01 levels.

[1] Mills LJ, Chichester C. Review of evidence: are endocrine-disrupting chemicals in the aquatic environment impacting fish populations. Sci Total Environ 2005;343:1e34. [2] Gray LE, Ostby J, Furr J, Wolf CJ, Lambright C, Parks L, et al. Effects of environmental antiandrogens on reproductive development in experimental animals. Hum Reprod Update 2001;7:248e64. [3] Selmanoglu G, Barlas N, Songur S, Kockaya EA. Carbendazim-induced haematological, biochemical and histopathological changes to the liver and kidney of male rats. Hum Exp Toxicol 2001;20:625e30. [4] Carter SD, Hess RA, Laskey JW. The fungicide methyl 2-benzimidazole carbamate causes infertility in male Sprague-Dawley rats. Biol Reprod 1987;37:709e17. [5] Akbarsha MA, Kadalmani B, Girija R, Faridha A, Hamid KS. Spermatotoxic effect of carbendazim. Indian J Exp Biol 2001;39:921e4. [6] Farag A, Ebrahim H, ElMazoudy R, Kadous E. Developmental toxicity of fungicide carbendazim in female mice. Birth Defects Res B Dev Reprod Toxicol 2011;92:122e30. [7] Ribeiro F, Ferreira NC, Ferreira A, Soares AM, Loureiro S. Is ultraviolet radiation a synergistic stressor in combined exposures? The case study of Daphnia magna exposure to UV and carbendazim. Aquat Toxicol 2011;102:114e22. [8] Cuppen JG, Van den Brink PJ, Camps E, Uil KF, Brock TC. Impact of the fungicide carbendazim in freshwater microcosms. I. Water quality, breakdown of particulate organic matter and responses of macroinvertebrates. Aquat Toxicol 2000;48:233e50. [9] Ludwikowska A, Bojarski B, Socha S, Lutnicka H. The effect of carbendazim on embryonic Prussian carp (Carassius gibelio) development and hatching. Arch Pol Fish 2013;21:367e71. [10] Palanikumar L, Kumaraguru AK, Ramakritinan CM, Anand M. Toxicity, biochemical and clastogenic response of chlorpyrifos and carbendazim in milkfish Chanos chanos. Int J Environ Sci Technol 2014;11:765e74. [11] Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn 1995;203:253e310. [12] Chang JH, Gui WJ, Wang MH, Zhu GN. Effects of butachlor on estrogen receptor, vitellogenin and P450 aromatase gene expression in the early life stage of zebrafish. J Environ Sci Health A Tox Hazard Subst Environ Eng 2012;47:1672e7. [13] Jin YX, Chen RJ, Sun LW, Qian HF, Liu WP, Fu ZW. Induction of estrogenresponsive gene transcription in the embryo, larval, juvenile and adult life stages of zebrafish as biomarkers of short-term exposure to endocrine

500

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21] [22]

[23]

[24]

[25] [26]

[27] [28]

[29] [30]

[31]

[32] [33]

J. Jiang et al. / Fish & Shellfish Immunology 41 (2014) 493e500 disrupting chemicals. Comp Biochem Physiol C Toxicol Pharmacol 2009;150: 414e20. Arukwe A, Knudsen FR, Goksoyr A. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ Health Perspect 1997;105:418e22. Sumpter JP, Jobling S. Vitellogenesis as a biomarker for estrogenic contamination of the aquatic environment. Environ Health Perspect 1995;103(Suppl. 7):173e8. Jin YX, Wang LG, Ruan ML, Liu JW, Yang YF, Zhou C, et al. Cypermethrin exposure during puberty induces oxidative stress and endocrine disruption in male mice. Chemosphere 2011;84:124e30. Jin YX, Zheng SS, Fu ZW. Embryonic exposure to cypermethrin induces apoptosis and immunotoxicity in zebrafish (Danio rerio). Fish Shellfish Immunol 2011;30:1049e54. Tangtian H, Bo L, Wenhua L, Shin PK, Wu RS. Estrogenic potential of benzotriazole on marine medaka (Oryzias melastigma). Ecotoxicol Environ Saf 2012;80:327e32. Adedara IA, Vaithinathan S, Jubendradass R, Mathur PP, Farombi EO. Kolaviron prevents carbendazim-induced steroidogenic dysfunction and apoptosis in testes of rats. Environ Toxicol Pharmacol 2013;35:444e53. Tu WQ, Niu LL, Liu WP, Xu C. Embryonic exposure to butachlor in zebrafish (Danio rerio): endocrine disruption, developmental toxicity and immunotoxicity. Ecotoxicol Environ Saf 2013;89:189e95. Lutton B, Callard I. Evolution of reproductive-immune interactions. Integr Comp Biol 2006;46:1060e71. Yoo BS, Jung KH, Hana SB, Kim HM. Apoptosis-mediated immunotoxicity of polychlorinated biphenyls (PCBs) in murine splenocytes. Toxicol Lett 1997;91: 83e9. Fukuyama T, Tajima Y, Ueda H, Hayashi K, Shutoh Y, Harada T, et al. Apoptosis in immunocytes induced by several types of pesticides. J Immunotoxicol 2010;7:39e56. Williams TD, Diab AM, George SG, Sabine V, Chipman JK. Gene expression responses of European flounder (Platichthys flesus) to 17-beta estradiol. Toxicol Lett 2007;168:236e48. Westerfield M. The zebrafish book: a guide for the laboratory use of zebrafish Danio rerio (Brachydanio). University of Oregon Press; 1993. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: 402e8. Pallardy M, Biola A, Lebrec H, Breard J. Assessment of apoptosis in xenobioticinduced immunotoxicity. Methods 1999;19:36e47. Langheinrich U, Hennen E, Stott G, Vacun G. Zebrafish as a model organism for the identification and characterization of drugs and genes affecting p53 signaling. Curr Biol 2002;12:2023e8. Bernardi P, Petronilli V, Di Lisa F, Forte M. A mitochondrial perspective on cell death. Trends Biochem Sci 2001;26:112e7. Hildeman DA, Mitchell T, Aronow B, Wojciechowski S, Kappler J, Marrack P. Control of Bcl-2 expression by reactive oxygen species. Proc Natl Acad Sci U S A 2003;100:15035e40. Moffit JS, Bryant BH, Hall SJ, Boekelheide K. Dose-dependent effects of sertoli cell toxicants 2,5-hexanedione, carbendazim, and mono-(2-ethylhexyl) phthalate in adult rat testis. Toxicol Pathol 2007;35:719e27. Sheikh MS, Fornace Jr AJ. Role of p53 family members in apoptosis. J Cell Physiol 2000;182:171e81. Cohen GM. Caspases: the executioners of apoptosis. Biochem J 1997;326(Pt 1):1e16.

[34] Jin Z, El-Deiry WS. Overview of cell death signaling pathways. Cancer Biol Ther 2005;4:139e63. [35] Battaglia CL, Gogal Jr RM, Zimmerman K, Misra HP. Malathion, lindane, and piperonyl butoxide, individually or in combined mixtures, induce immunotoxicity via apoptosis in murine splenocytes in vitro. Int J Toxicol 2010;29: 209e20. [36] Roh YS, Cho A, Islam MR, Cho SD, Kim J, Kim JH, et al. 3,30 -Diindolylmethane induces immunotoxicity via splenocyte apoptosis in neonatal mice. Toxicol Lett 2011;206:218e28. [37] Green DR, Reed JC. Mitochondria and apoptosis. Science 1998;281:1309e12. [38] Fan TJ, Han LH, Cong RS, Liang J. Caspase family proteases and apoptosis. Acta Biochim Biophys Sin Shanghai 2005;37:719e27. [39] Trede NS, Langenau DM, Traver D, Look AT, Zon LI. The use of zebrafish to understand immunity. Immunity 2004;20:367e79. [40] Sieger D, Stein C, Neifer D, van der Sar AM, Leptin M. The role of gamma interferon in innate immunity in the zebrafish embryo. Dis Model Mech 2009;2:571e81. [41] Milla S, Depiereux S, Kestemont P. The effects of estrogenic and androgenic endocrine disruptors on the immune system of fish: a review. Ecotoxicology 2011;20:305e19. [42] Menuet A, Le Page Y, Torres O, Kern L, Kah O, Pakdel F. Analysis of the estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct effects of ERalpha, ERbeta1 and ERbeta2. J Mol Endocrinol 2004;32:975e86. [43] Heppell SA, Denslow ND, Folmar LC, Sullivan CV. Universal assay of vitellogenin as a biomarker for environmental estrogens. Environ Health Perspect 1995;103(Suppl. 7):9e15. [44] Chakraborty T, Katsu Y, Zhou LY, Miyagawa S, Nagahama Y, Iguchi T. Estrogen receptors in medaka (Oryzias latipes) and estrogenic environmental contaminants: an in vitroein vivo correlation. J Steroid Biochem Mol Biol 2011;123: 115e21. [45] Hinfray N, Palluel O, Turies C, Cousin C, Porcher JM, Brion F. Brain and gonadal aromatase as potential targets of endocrine disrupting chemicals in a model species, the zebrafish (Danio rerio). Environ Toxicol 2006;21:332e7. [46] Gibson GG, Plant NJ, Swales KE, Ayrton A, El-Sankary W. Receptor-dependent transcriptional activation of cytochrome P4503A genes: induction mechanisms, species differences and interindividual variation in man. Xenobiotica 2002;32:165e206. [47] Jugan ML, Levi Y, Blondeau JP. Endocrine disruptors and thyroid hormone physiology. Biochem Pharmacol 2010;79:939e47. [48] Picard-Aitken M, Fournier H, Pariseau R, Marcogliese DJ, Cyr DG. Thyroid disruption in walleye (Sander vitreus) exposed to environmental contaminants: cloning and use of iodothyronine deiodinases as molecular biomarkers. Aquat Toxicol 2007;83:200e11. [49] Yu LQ, Deng J, Shi XJ, Liu CS, Yu K, Zhou BS. Exposure to DE-71 alters thyroid hormone levels and gene transcription in the hypothalamicepituitaryethyroid axis of zebrafish larvae. Aquat Toxicol 2010;97:226e33. [50] Chen Q, Yu LQ, Yang LH, Zhou BS. Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae. Aquat Toxicol 2012;110-111:141e8. [51] Liu YW, Lo LJ, Chan WK. Temporal expression and T3 induction of thyroid hormone receptors alpha1 and beta1 during early embryonic and larval development in zebrafish, Danio rerio. Mol Cell Endocrinol 2000;159:187e95. [52] Orozco A, Valverde RC. Thyroid hormone deiodination in fish. Thyroid 2005;15:799e813.