J Huazhong Univ Sci Technol［Med Sci］ 34(6):821-824,2014 10.1007/s11596-014-1359-0 J DOI Huazhong Univ Sci Technol［Med Sci］ 34(6):2014
821
Endoplasmic Reticulum Stress-mediated Aldosterone-induced Apoptosis in Vascular Endothelial Cells Jin-ping LU (卢金萍), Xia LI (李 夏), Ya-lei JIN (金雅磊), Mei-xiang CHEN (陈梅香) Department of Internal Medicine & Geriatrics, Zhongnan Hospital of Wuhan University, Wuhan 430071, China © Huazhong University of Science and Technology and Springer-Verlag Berlin Heidelberg 2014
Summary: The aim of this study was to examine the effects of endoplasmic reticulum (ER) stress on aldosterone (Aldo)-induced apoptosis of endothelial cells. Glucose-regulated protein 78 (GRP78) and C/EBP homologous protein (CHOP, a hallmark of ER-associated apoptosis) were used to evaluate ER stress. Western blotting and real-time PCR were used to analyze indicators of ER molecule. Apoptosis was detected by annexin V/propidium iodide staining and flow cytometry. Human umbilical vein endothelial cells (HUVECs) were stimulated with different concentrations of Aldo for different durations. Aldo promoted apoptosis of HUVECs and induced ER stress, as evidenced by increased expression of GRP78 and CHOP. siRNA knockdown of CHOP attenuated Aldo-mediated apoptosis. These results indicate that ER stress may be involved in Aldo-induced apoptosis of HUVECs. Key words: endoplasmic reticulum stress; apoptosis; aldosterone; endothelial cells
A growing body of evidence substantiates a role for aldosterone (Aldo) in the pathogenesis of cardiovascular disease[1–4]. In this regard, plasma Aldo levels are significantly elevated, and exogenous infusion of Aldo can induce direct deleterious effects on vascular tissue. Recently, apoptosis of vascular endothelial cells is shown to be a key factor in the progression of vascular sclerosis[5]. However, the underlying mechanism for this phenomenon is not fully understood. Apoptosis signals are mainly activated by two pathways: an extrinsic and an intrinsic pathway that may result from mitochondrial and endoplasmic reticulum (ER) stress (ERS)[6]. Apoptosis mediated by ER plays a key role in many diseases, such as heart failure, atherosclerosis, diabetes, and Alzheimer disease. Various stimuli can disturb ER homeostasis and result in the accumulation of unfolded and misfolded proteins and pathological consequences, namely ERS[7]. Meanwhile, the accumulating unfolded proteins activate an adaptive signaling cascade known as unfolded protein response (UPR). In response to ERS, ER chaperones such as 78-kD glucose-regulated protein (GRP78) and GRP94 are up-regulated to stabilize protein folding[8]. GRP78, an established molecular chaperone, is a master modulator for the UPR network by binding to ER sensors such as protein kinase R-like ER kinase, inositol requiring 1 (IRE1), and activating transcription factor 6 and inhibiting their activation. The chaperone GRP94 facilitates folding through hydrolysis of ATP. Therefore, GRP78 and/or GRP94 were often used as ERS markers. Moderate ERS can relieve cellular dysfunction and enhance the chance for survival, but prolonged and/or severe stress leads to cell apoptosis, which is mediated by a caspase 12-dependent pathway and/or by transcriptional induction of C/EBP homologous protein (CHOP) and/or by activation of c-JUN NH2-terminal kinase (JNK). Caspase 12 is localized on the cytoplasmic side of ER and is
Jin-ping LU, E-mail: [email protected]
activated specifically by ERS but not by other apoptotic signals. When caspase 12 is activated to the cleaved forms, it can directly process caspase 9, which in turn activates caspase 3, thus leading to cell death. CHOP, an ERS response gene and a specific transcription factor, has proapoptotic characteristics by directly regulating the expression of numerous proapoptotic proteins, such as death receptor 5, ER oxidoreductin 1 and repressing transcription of antiapoptotic B cell leukemia 2, which leads to enhanced oxidant injury and thus apoptosis[9, 10]. The JNK pathway mediates the third apoptotic pathway. The cytoplasmic part of IRE1 binds to tumor necrosis factor receptor-associated factor 2 (TRAF2), which couples a plasma-membrane death receptor to JNK and stress-activated protein kinase. IRE1 and TRAF2 form a complex with a mitogen-activated protein kinase kinase kinase, apoptosis signal regulating kinase 1, to mediate ERS-induced cell apoptosis. In this study, we hypothesized that endothelial cell apoptosis may be accompanied by increased ERS, which would contribute significantly to Aldo-induced vascular injury. To test this hypothesis, we examined the effects of ERS on apoptosis of Aldo-induced endothelial cells. We used GRP78 as the hallmark to evaluate ERS and ERS-CHOP pathway-dependent apoptosis was detected. 1 MATERIALS AND METHODS 1.1 Reagents and Antibodies Aldo was purchased from Sigma (USA). Annexin V/propidium iodide (PI) apoptosis detection kit was obtained from the Beyotime Institute of Biotechnology (China). Mouse anti-CHOP monoclonal antibody (mAb) and rabbit anti-GRP78 mAb were obtained from Cell Signaling Technology (USA). 1.2 Cell Culture Human umbilical vein endothelial cells (HUVECs) (Cell Applications Inc., USA) were grown in T-75 flasks coated with endothelial cell attachment factor (Cell Ap-
822 plications Inc., USA) in complete endothelial cell growth medium (Cell Applications Inc., USA). Cells were maintained in a humidified incubator at 37ºC and 5% CO2. 1.3 Transient Transfection of HUVECs with CHOP Small Interfering RNA (siRNA) For knockdown experiments, HUVECs grown to 50% confluence in 6-well plates were transiently transfected with CHOP specific siRNA or control siRNA, a scrambled sequence non-specific for any cellular mRNA (Santa Cruz Biotechnology, Santa Cruz, USA) using Lipofectamine PLUS (Invitrogen, USA) according to the manufacturer’s instructions. When HUVECs were treated with Aldo, cells were transfected with 500 nmol/L CHOP siRNA or control siRNA for 24 h before treatment. 1.4 Quantitative Real-time Polymerase Chain Reaction The mRNA expression of the genes involved in ERS was measured using quantitative real-time polymerase chain reaction (PCR). The cells were treated with different concentrations of Aldo (10, 100, and 1000 nmol/L) for 24 h and with 100 nmol/L Aldo for various time periods (0, 6, 12, and 24 h). DMSO (0.5%) was used as a control. For a positive control, the cells were treated with 0.2 nmol/L thapsigargin (Tg) for 24 h. The total RNA was prepared using Trizol reagent (TaKaRa, Japan) according to the manufacturer’s protocol. The cDNA was prepared from the total RNA with reverse transcriptase (RT) Primer Mix using PrimeScript RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s instruction. The primers for real-time PCR analysis were as follows: CHOP (forward, AATCAGAGCTGGAACCTGAGGA; reverse, TGCTTTCAGGTGTGGTGATGTATG); GAPDH (forward, GCACCGTCAAGGCTGAGAAC; reverse, TGGTGAAGACGCCAGTGGA). The subsequent PCR amplification was carried out on a LightCycler 2.0 system (Roche Diagnostics, Switzerland) using 40 or 45 cycles of 95ºC for 20 s, 55ºC for 30 s and 72ºC for 30 s. GAPDH was used as an internal control. 1.5 Western Blotting The HUVECs were lysed and subsequently sonicated in ice-cold PBS. A total of 30 μg of protein from
J Huazhong Univ Sci Technol［Med Sci］ 34(6):2014
whole cells was denatured in boiling water for 15 min, separated by SDS-PAGE gel and then transferred onto nitrocellulose membranes. The blots were blocked with 5% nonfat dry milk, followed by incubation for 2 h with rabbit anti-GRP78 or mouse anti-CHOP antibody at a dilution of 1:1000. After being washed with PBS, the blots were then incubated with horseradish peroxidase conjugated secondary antibody (a dilution of 1:2000) for 2 h. The membranes were visualized with an enhanced chemiluminescent (ECL) system (KPL, USA) after three washes using previously described methods. 1.6 Apoptosis Detection with Annexin V/Propidium Iodide (PI) Staining Apoptosis of HUVECs was detected by Annexin V/PI staining according to the manufacturer’s instructions. Briefly, HUVECs (105 cells/mL) were harvested and centrifuged at 1000 r/min for 5 min. After washing twice with PBS, the cells were resuspended in 500 μL ice-cold binding buffer and then incubated with 2 μL Annexin V and 2 μL PI for 15 min in the dark. After resuspension in 200 μL binding buffer, the cells were analyzed on a FACScan flow cytometer (Epics Altra, USA). 1.7 Statistical Analysis Data were presented as ±s . One way ANOVA was used to compare mean values, and significance was accepted when P
821
Endoplasmic Reticulum Stress-mediated Aldosterone-induced Apoptosis in Vascular Endothelial Cells Jin-ping LU (卢金萍), Xia LI (李 夏), Ya-lei JIN (金雅磊), Mei-xiang CHEN (陈梅香) Department of Internal Medicine & Geriatrics, Zhongnan Hospital of Wuhan University, Wuhan 430071, China © Huazhong University of Science and Technology and Springer-Verlag Berlin Heidelberg 2014
Summary: The aim of this study was to examine the effects of endoplasmic reticulum (ER) stress on aldosterone (Aldo)-induced apoptosis of endothelial cells. Glucose-regulated protein 78 (GRP78) and C/EBP homologous protein (CHOP, a hallmark of ER-associated apoptosis) were used to evaluate ER stress. Western blotting and real-time PCR were used to analyze indicators of ER molecule. Apoptosis was detected by annexin V/propidium iodide staining and flow cytometry. Human umbilical vein endothelial cells (HUVECs) were stimulated with different concentrations of Aldo for different durations. Aldo promoted apoptosis of HUVECs and induced ER stress, as evidenced by increased expression of GRP78 and CHOP. siRNA knockdown of CHOP attenuated Aldo-mediated apoptosis. These results indicate that ER stress may be involved in Aldo-induced apoptosis of HUVECs. Key words: endoplasmic reticulum stress; apoptosis; aldosterone; endothelial cells
A growing body of evidence substantiates a role for aldosterone (Aldo) in the pathogenesis of cardiovascular disease[1–4]. In this regard, plasma Aldo levels are significantly elevated, and exogenous infusion of Aldo can induce direct deleterious effects on vascular tissue. Recently, apoptosis of vascular endothelial cells is shown to be a key factor in the progression of vascular sclerosis[5]. However, the underlying mechanism for this phenomenon is not fully understood. Apoptosis signals are mainly activated by two pathways: an extrinsic and an intrinsic pathway that may result from mitochondrial and endoplasmic reticulum (ER) stress (ERS)[6]. Apoptosis mediated by ER plays a key role in many diseases, such as heart failure, atherosclerosis, diabetes, and Alzheimer disease. Various stimuli can disturb ER homeostasis and result in the accumulation of unfolded and misfolded proteins and pathological consequences, namely ERS[7]. Meanwhile, the accumulating unfolded proteins activate an adaptive signaling cascade known as unfolded protein response (UPR). In response to ERS, ER chaperones such as 78-kD glucose-regulated protein (GRP78) and GRP94 are up-regulated to stabilize protein folding[8]. GRP78, an established molecular chaperone, is a master modulator for the UPR network by binding to ER sensors such as protein kinase R-like ER kinase, inositol requiring 1 (IRE1), and activating transcription factor 6 and inhibiting their activation. The chaperone GRP94 facilitates folding through hydrolysis of ATP. Therefore, GRP78 and/or GRP94 were often used as ERS markers. Moderate ERS can relieve cellular dysfunction and enhance the chance for survival, but prolonged and/or severe stress leads to cell apoptosis, which is mediated by a caspase 12-dependent pathway and/or by transcriptional induction of C/EBP homologous protein (CHOP) and/or by activation of c-JUN NH2-terminal kinase (JNK). Caspase 12 is localized on the cytoplasmic side of ER and is
Jin-ping LU, E-mail: [email protected]
activated specifically by ERS but not by other apoptotic signals. When caspase 12 is activated to the cleaved forms, it can directly process caspase 9, which in turn activates caspase 3, thus leading to cell death. CHOP, an ERS response gene and a specific transcription factor, has proapoptotic characteristics by directly regulating the expression of numerous proapoptotic proteins, such as death receptor 5, ER oxidoreductin 1 and repressing transcription of antiapoptotic B cell leukemia 2, which leads to enhanced oxidant injury and thus apoptosis[9, 10]. The JNK pathway mediates the third apoptotic pathway. The cytoplasmic part of IRE1 binds to tumor necrosis factor receptor-associated factor 2 (TRAF2), which couples a plasma-membrane death receptor to JNK and stress-activated protein kinase. IRE1 and TRAF2 form a complex with a mitogen-activated protein kinase kinase kinase, apoptosis signal regulating kinase 1, to mediate ERS-induced cell apoptosis. In this study, we hypothesized that endothelial cell apoptosis may be accompanied by increased ERS, which would contribute significantly to Aldo-induced vascular injury. To test this hypothesis, we examined the effects of ERS on apoptosis of Aldo-induced endothelial cells. We used GRP78 as the hallmark to evaluate ERS and ERS-CHOP pathway-dependent apoptosis was detected. 1 MATERIALS AND METHODS 1.1 Reagents and Antibodies Aldo was purchased from Sigma (USA). Annexin V/propidium iodide (PI) apoptosis detection kit was obtained from the Beyotime Institute of Biotechnology (China). Mouse anti-CHOP monoclonal antibody (mAb) and rabbit anti-GRP78 mAb were obtained from Cell Signaling Technology (USA). 1.2 Cell Culture Human umbilical vein endothelial cells (HUVECs) (Cell Applications Inc., USA) were grown in T-75 flasks coated with endothelial cell attachment factor (Cell Ap-
822 plications Inc., USA) in complete endothelial cell growth medium (Cell Applications Inc., USA). Cells were maintained in a humidified incubator at 37ºC and 5% CO2. 1.3 Transient Transfection of HUVECs with CHOP Small Interfering RNA (siRNA) For knockdown experiments, HUVECs grown to 50% confluence in 6-well plates were transiently transfected with CHOP specific siRNA or control siRNA, a scrambled sequence non-specific for any cellular mRNA (Santa Cruz Biotechnology, Santa Cruz, USA) using Lipofectamine PLUS (Invitrogen, USA) according to the manufacturer’s instructions. When HUVECs were treated with Aldo, cells were transfected with 500 nmol/L CHOP siRNA or control siRNA for 24 h before treatment. 1.4 Quantitative Real-time Polymerase Chain Reaction The mRNA expression of the genes involved in ERS was measured using quantitative real-time polymerase chain reaction (PCR). The cells were treated with different concentrations of Aldo (10, 100, and 1000 nmol/L) for 24 h and with 100 nmol/L Aldo for various time periods (0, 6, 12, and 24 h). DMSO (0.5%) was used as a control. For a positive control, the cells were treated with 0.2 nmol/L thapsigargin (Tg) for 24 h. The total RNA was prepared using Trizol reagent (TaKaRa, Japan) according to the manufacturer’s protocol. The cDNA was prepared from the total RNA with reverse transcriptase (RT) Primer Mix using PrimeScript RT reagent Kit (TaKaRa, Japan) according to the manufacturer’s instruction. The primers for real-time PCR analysis were as follows: CHOP (forward, AATCAGAGCTGGAACCTGAGGA; reverse, TGCTTTCAGGTGTGGTGATGTATG); GAPDH (forward, GCACCGTCAAGGCTGAGAAC; reverse, TGGTGAAGACGCCAGTGGA). The subsequent PCR amplification was carried out on a LightCycler 2.0 system (Roche Diagnostics, Switzerland) using 40 or 45 cycles of 95ºC for 20 s, 55ºC for 30 s and 72ºC for 30 s. GAPDH was used as an internal control. 1.5 Western Blotting The HUVECs were lysed and subsequently sonicated in ice-cold PBS. A total of 30 μg of protein from
J Huazhong Univ Sci Technol［Med Sci］ 34(6):2014
whole cells was denatured in boiling water for 15 min, separated by SDS-PAGE gel and then transferred onto nitrocellulose membranes. The blots were blocked with 5% nonfat dry milk, followed by incubation for 2 h with rabbit anti-GRP78 or mouse anti-CHOP antibody at a dilution of 1:1000. After being washed with PBS, the blots were then incubated with horseradish peroxidase conjugated secondary antibody (a dilution of 1:2000) for 2 h. The membranes were visualized with an enhanced chemiluminescent (ECL) system (KPL, USA) after three washes using previously described methods. 1.6 Apoptosis Detection with Annexin V/Propidium Iodide (PI) Staining Apoptosis of HUVECs was detected by Annexin V/PI staining according to the manufacturer’s instructions. Briefly, HUVECs (105 cells/mL) were harvested and centrifuged at 1000 r/min for 5 min. After washing twice with PBS, the cells were resuspended in 500 μL ice-cold binding buffer and then incubated with 2 μL Annexin V and 2 μL PI for 15 min in the dark. After resuspension in 200 μL binding buffer, the cells were analyzed on a FACScan flow cytometer (Epics Altra, USA). 1.7 Statistical Analysis Data were presented as ±s . One way ANOVA was used to compare mean values, and significance was accepted when P
