Clin Physiol Funct Imaging (2015)
doi: 10.1111/cpf.12255
Endothelial nitric oxide synthase Glu298Asp gene polymorphism influences body composition and biochemical parameters but not the nitric oxide response to eccentric resistance exercise in elderly obese women Tatiane Gomes Teixeira1, Ramires Alsamir Tibana1, Dahan da Cunha Nascimento1, Nuno Manuel Frade de sar Leite Vieira3, Ota vio de Toledo No brega4, Jeeser Alves de Sousa2, Vinicius Carolino de Souza1,4, Denis Ce 5 6 1 Almeida , James Navalta and Jonato Prestes 1
Catholic University of Brasilia, Graduation Program on Physical Education, Brasilia, 2Laboratory of Exercise Physiology, Faculty Estacio of Vitoria, Vitoria, ES, Universitary Center of Brasilia (UDF), 4University of Brasilia, Brasilia, Brazil, 5Department of Physical Education of Federal University of Mato Grosso do Sul, Brazil and 6Department of Kinesiology and Nutrition Sciences, University of Nevada, Las Vegas, NV, USA 3
Summary Correspondence Jonato Prestes, Graduation Program on Physical Education, Catholic University of Brasilia Q.S. 07, Lote 01, EPTC – Bloco G, 71966-700 – Taguatinga – Federal District, Brasilia, Brazil E-mail: [email protected]
Accepted for publication Received 24 October 2014; accepted 24 March 2015
Key words ageing; eccentric training; genetics; obesity; strength training
Both endothelial nitric oxide synthase (eNOS) gene polymorphism and nitric oxide (NO) are involved in important cardiovascular, muscular and inflammatory physiological mechanisms during ageing and response to exercise. The aim of this study was to investigate the NO kinetic response following an acute eccentric resistance exercise (ERE) session and the possible effect of the Glu298Asp eNOS gene polymorphism in elderly obese women. Eighty-seven women (age 694 61 years, body weight 749 127 kg, height 1519 60 cm and BMI 325 57 kg m2) completed seven sets of ten eccentric repetitions at 110% of the ten repetitions maximum (10RM). NO concentrations remained elevated up to 48 h following the acute ERE session as compared with baseline, for GG and GT/TT groups (P32% and completion of all anthropometric testing. Obesity was determined according to the recommendations of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK, 2001), assuming a cut-off point of 30% for women. Individuals were considered sedentary according to their responses on the International Physical Activity Questionnaire. Subjects with inflammatory, rheumatic, or autoimmune conditions or use of medications (i.e. beta blockers, hormone replacement therapy, anti-inflammatory, insulin) or any type of disease that could compromise the tests and procedures were excluded. The study was approved by the Institutional Research Ethics Committee (protocol#272/2010). Study design and employed procedures are in accordance with ethical standards and the Declaration of Helsinki. Each subject was fully informed about the risks and stresses associated with study participation and gave written informed consent before the start of the study. Muscle strength evaluation Muscle strength was evaluated by the ten repetitions maximum (10RM) test according to the protocol used in previous study from our research group (Funghetto et al., 2013). The elderly women visited the laboratory on two occasions. On the first visit, they completed an recall form and physical activity questionnaire, anthropometric measures, dual-energy X-ray absorptiometry (DXA) analysis and completed an adap-
© 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd
Polymorphism, nitric oxide and exercise, T. G. Teixeira et al.
tation session on a leg extension isoinertial machine (Righetto, Sao Paulo, Brazil) utilizing three sets of 8–10 submaximal repetitions with 3–5 min of rest interval between sets. Three days later, they performed the 10RM test. Subjects rested 3 days and completed the 10RM test again to determine test–retest reproducibility (R = 099). The test was terminated at the moment subjects were unable to perform the complete movement or when voluntary concentric failure occurred. A qualified experienced resistance training professional carefully supervised and applied the familiarization session and 10RM tests. The following strategies were adopted to reduce test variations (Tibana et al., 2012): (i) standard instructions were given before the test so that the volunteer was aware of the entire routine which involved the data collection; (ii) the subject was instructed on the exercise performance; (iii) the evaluator was aware of the position adopted by the practitioner at the moment of the test, as slight variations in the positioning of the joints involved in the movement could trigger other muscles, leading to misinterpretation of the obtained scores; (iv) the subjects were verbally encouraged with the purpose to keep their motivation level high; (v) the additional load used in the study was previously measured on a precision scale. Rest intervals between trials in each exercise during the 10RM test were set between 3 and 5 min. Relative muscle strength was calculated by means of the following formula: relative strength = absolute strength (kg)/body mass (kg). The subjects refrained from any stimulating substance (caffeine or alcohol) and did not perform physical activity on the previous week of the tests. The 10RM tests were scheduled between 2:00 and 4:00 pm and were performed under standardized controlled room temperature. The knee extension exercise was chosen because lower limb strength in the elderly is particularly important, as it is strongly affected by sarcopenia and loss of functionality (Baker & Cutlip, 2010).
Body composition Percentage body fat and lean body mass were determined by DXA (General Electric-GE model 8548 BX1L, year 2005, Lunar DPX type, software Encore 2005; Rommelsdorf, Germany). The tests included a complete body scan of the volunteers, in supine position, during approximately 17 min, with the apparatus always calibrated and operated by a technically trained professional.
Biochemical parameters The lipid profile (GPO/POD) and urea (Ureasi-GLDH) were measured by the enzymatic colorimetric method on Autohumalyzer equipment (Human GMBH, Germany). High-density lipoprotein cholesterol (HDL-C) was determined by ionic exchange followed by colorimetric reaction with the Lincoâ Research Inc. kit (St Louis, USA), and blood glucose by hexokinase enzymatic assay.
Acute eccentric resistance exercise Seven days after the adaptation session and 10RM tests, subjects completed an acute ERE (Funghetto et al., 2013). The session began with a series of general warming of the lower extremities on a cycle ergometer for 10 min at 60 rpm and 50 W, followed by a specific warm-up of 10 repetitions at 50% of 10RM, with a rest interval of 3–5 min. The ERE session was performed on the bilateral knee extension isoinertial machine with a load corresponding to 110% of 10RM. Participants performed only the eccentric phase of the lift (2–3 s), with the concentric phase moved by the test administrators. Individuals completed seven sets of 10 repetitions with a passive rest of 3 min between sets. Blood sample and nitrite measure Participants reported to the laboratory between 08:00 and 10:00 am, after an overnight fast, and blood samples of 5 ml were drawn from the antecubital vein into Vacutainer tubes (Becton Dickinson, Brazil) pre- and 3, 24, 48 h postexercise to analyse the nitrite kinetics. Samples were then centrifuged at room temperature at 8000 g for 15 min. All subjects were encouraged to avoid smoking, alcohol and caffeine consumption as well as unusual physical activity to avoid influence on these parameters. The serum was stored and frozen at 80°C for subsequent analysis. The serum concentration of nitrite was determined by the Griess reaction. In brief, serum samples were deproteinized by adding zinc sulphate (15 mg ml1), followed by centrifugation at 10 000 g for 10 min; 100 ll of the supernatant was applied to a microplate well, and following addition of 100 ll vanadium (III) chloride (8 mg ml1) to each well, Griess reagents [50 ll sulfanilamide (2%) and 50 ll N-(1-naphthyl) ethylendiamine dihydrochloride (01%)] were added. After 30 min incubation at 37°C, absorbance was read at 540 nm using the ELISA reader (Sunrise, Tecan, Austria). Concentration of nitric oxide in serum samples was determined from the linear standard curve established by 0–100 lM sodium nitrite. Determination of the Glu298Asp of eNOS gene polymorphism Total DNA was isolated from peripheral blood leucocytes according to standard procedures. The amplification of the (endothelial nitric oxide) eNOS gene (rs1799983) was determined by the polymerase chain reaction followed by specific enzymatic restriction (PCR-RFLP) (Pulkkinen et al., 2000) and adapted for this study, using the primers eNOS-F1 (50 AAGGCAGGAGACAGTGGATGGA30 ) and eNOS-R1 (50 CCCA GTCAATCCCTTTGGTGCTCA30 ). Each reaction (25 ll) was composed of 100 ng of DNA, 10 mM of Tris–HCl (pH 88), KCl 25 mM, MgCl2 15 mM, 02 lM for each primer, 02 mM of each dNTP, 025 mgml1 of ovalbumin and 05 U of Taq polymerase (Phoneutria, Minas Gerais, Brazil). After
© 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd
Polymorphism, nitric oxide and exercise, T. G. Teixeira et al.
1 minute of hot start at 80°C, the amplification programme was composed of an initial denaturation step beginning at 96°C for 2 min, followed by 35 cycles of denaturation at 96°C for 30 s, annealing at 56°C for 1 min and extension at 72°C through 1 min, with a final extension step at 72°C for 5 min. The polymerase chain reaction products underwent enzymatic digestion using 05 U of restriction Mbol endonuclease (Jena Bioscience, Germany) at 37°C overnight in a total volume of 15 ll. The fragments were then submitted to agarose gel electrophoresis at 22% and identified under molecular weight pattern of DNA. Statistical analysis The results are expressed as mean standard deviation (SD). Shapiro–Wilk tests were applied to check for normality distribution of the study variables. In the case of a nonparametric distribution, a logarithmic transformation was performed. Hardy–Weinberg equilibrium was determined using a chisquare test to compare the observed genotype frequencies with those expected under Hardy–Weinberg equilibrium. Mixed-model ANOVA was used to compare the NO concentrations between genotype groups over the course of 48 h postexercise. Compound sphericity was verified by the Mauchley test. When the assumption of sphericity was not met, the significance of F-ratios was adjusted according to the Greenhouse–Geisser procedure. Tukey’s post hoc test with Bonferroni adjustment was applied in the event of significance. Strength, anthropometric and blood parameter comparisons between genotype groups were made by independent t-test. Multiple linear regression analyses were performed first to assess the associations of strength with anthropometric variables and second to assess the associations of genotype group with strength, anthropometric and blood parameters. Sample size was determined a priori using G*Power version 3.1.3 (Kiel, Germany) with the level of significance set at P = 005 and power (1 b) = 080. We conducted a pilot study to evaluate the effect size for NO response between genotype groups and the effect size f was 0.25 (medium effect size). Based on these a priori calculations and the pilot study, the required sample size was 74. The level of significance was P≤005 and SPSS version 20.0 (Somers, NY, USA) software was used.
(b = 0582, P
doi: 10.1111/cpf.12255
Endothelial nitric oxide synthase Glu298Asp gene polymorphism influences body composition and biochemical parameters but not the nitric oxide response to eccentric resistance exercise in elderly obese women Tatiane Gomes Teixeira1, Ramires Alsamir Tibana1, Dahan da Cunha Nascimento1, Nuno Manuel Frade de sar Leite Vieira3, Ota vio de Toledo No brega4, Jeeser Alves de Sousa2, Vinicius Carolino de Souza1,4, Denis Ce 5 6 1 Almeida , James Navalta and Jonato Prestes 1
Catholic University of Brasilia, Graduation Program on Physical Education, Brasilia, 2Laboratory of Exercise Physiology, Faculty Estacio of Vitoria, Vitoria, ES, Universitary Center of Brasilia (UDF), 4University of Brasilia, Brasilia, Brazil, 5Department of Physical Education of Federal University of Mato Grosso do Sul, Brazil and 6Department of Kinesiology and Nutrition Sciences, University of Nevada, Las Vegas, NV, USA 3
Summary Correspondence Jonato Prestes, Graduation Program on Physical Education, Catholic University of Brasilia Q.S. 07, Lote 01, EPTC – Bloco G, 71966-700 – Taguatinga – Federal District, Brasilia, Brazil E-mail: [email protected]
Accepted for publication Received 24 October 2014; accepted 24 March 2015
Key words ageing; eccentric training; genetics; obesity; strength training
Both endothelial nitric oxide synthase (eNOS) gene polymorphism and nitric oxide (NO) are involved in important cardiovascular, muscular and inflammatory physiological mechanisms during ageing and response to exercise. The aim of this study was to investigate the NO kinetic response following an acute eccentric resistance exercise (ERE) session and the possible effect of the Glu298Asp eNOS gene polymorphism in elderly obese women. Eighty-seven women (age 694 61 years, body weight 749 127 kg, height 1519 60 cm and BMI 325 57 kg m2) completed seven sets of ten eccentric repetitions at 110% of the ten repetitions maximum (10RM). NO concentrations remained elevated up to 48 h following the acute ERE session as compared with baseline, for GG and GT/TT groups (P32% and completion of all anthropometric testing. Obesity was determined according to the recommendations of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK, 2001), assuming a cut-off point of 30% for women. Individuals were considered sedentary according to their responses on the International Physical Activity Questionnaire. Subjects with inflammatory, rheumatic, or autoimmune conditions or use of medications (i.e. beta blockers, hormone replacement therapy, anti-inflammatory, insulin) or any type of disease that could compromise the tests and procedures were excluded. The study was approved by the Institutional Research Ethics Committee (protocol#272/2010). Study design and employed procedures are in accordance with ethical standards and the Declaration of Helsinki. Each subject was fully informed about the risks and stresses associated with study participation and gave written informed consent before the start of the study. Muscle strength evaluation Muscle strength was evaluated by the ten repetitions maximum (10RM) test according to the protocol used in previous study from our research group (Funghetto et al., 2013). The elderly women visited the laboratory on two occasions. On the first visit, they completed an recall form and physical activity questionnaire, anthropometric measures, dual-energy X-ray absorptiometry (DXA) analysis and completed an adap-
© 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd
Polymorphism, nitric oxide and exercise, T. G. Teixeira et al.
tation session on a leg extension isoinertial machine (Righetto, Sao Paulo, Brazil) utilizing three sets of 8–10 submaximal repetitions with 3–5 min of rest interval between sets. Three days later, they performed the 10RM test. Subjects rested 3 days and completed the 10RM test again to determine test–retest reproducibility (R = 099). The test was terminated at the moment subjects were unable to perform the complete movement or when voluntary concentric failure occurred. A qualified experienced resistance training professional carefully supervised and applied the familiarization session and 10RM tests. The following strategies were adopted to reduce test variations (Tibana et al., 2012): (i) standard instructions were given before the test so that the volunteer was aware of the entire routine which involved the data collection; (ii) the subject was instructed on the exercise performance; (iii) the evaluator was aware of the position adopted by the practitioner at the moment of the test, as slight variations in the positioning of the joints involved in the movement could trigger other muscles, leading to misinterpretation of the obtained scores; (iv) the subjects were verbally encouraged with the purpose to keep their motivation level high; (v) the additional load used in the study was previously measured on a precision scale. Rest intervals between trials in each exercise during the 10RM test were set between 3 and 5 min. Relative muscle strength was calculated by means of the following formula: relative strength = absolute strength (kg)/body mass (kg). The subjects refrained from any stimulating substance (caffeine or alcohol) and did not perform physical activity on the previous week of the tests. The 10RM tests were scheduled between 2:00 and 4:00 pm and were performed under standardized controlled room temperature. The knee extension exercise was chosen because lower limb strength in the elderly is particularly important, as it is strongly affected by sarcopenia and loss of functionality (Baker & Cutlip, 2010).
Body composition Percentage body fat and lean body mass were determined by DXA (General Electric-GE model 8548 BX1L, year 2005, Lunar DPX type, software Encore 2005; Rommelsdorf, Germany). The tests included a complete body scan of the volunteers, in supine position, during approximately 17 min, with the apparatus always calibrated and operated by a technically trained professional.
Biochemical parameters The lipid profile (GPO/POD) and urea (Ureasi-GLDH) were measured by the enzymatic colorimetric method on Autohumalyzer equipment (Human GMBH, Germany). High-density lipoprotein cholesterol (HDL-C) was determined by ionic exchange followed by colorimetric reaction with the Lincoâ Research Inc. kit (St Louis, USA), and blood glucose by hexokinase enzymatic assay.
Acute eccentric resistance exercise Seven days after the adaptation session and 10RM tests, subjects completed an acute ERE (Funghetto et al., 2013). The session began with a series of general warming of the lower extremities on a cycle ergometer for 10 min at 60 rpm and 50 W, followed by a specific warm-up of 10 repetitions at 50% of 10RM, with a rest interval of 3–5 min. The ERE session was performed on the bilateral knee extension isoinertial machine with a load corresponding to 110% of 10RM. Participants performed only the eccentric phase of the lift (2–3 s), with the concentric phase moved by the test administrators. Individuals completed seven sets of 10 repetitions with a passive rest of 3 min between sets. Blood sample and nitrite measure Participants reported to the laboratory between 08:00 and 10:00 am, after an overnight fast, and blood samples of 5 ml were drawn from the antecubital vein into Vacutainer tubes (Becton Dickinson, Brazil) pre- and 3, 24, 48 h postexercise to analyse the nitrite kinetics. Samples were then centrifuged at room temperature at 8000 g for 15 min. All subjects were encouraged to avoid smoking, alcohol and caffeine consumption as well as unusual physical activity to avoid influence on these parameters. The serum was stored and frozen at 80°C for subsequent analysis. The serum concentration of nitrite was determined by the Griess reaction. In brief, serum samples were deproteinized by adding zinc sulphate (15 mg ml1), followed by centrifugation at 10 000 g for 10 min; 100 ll of the supernatant was applied to a microplate well, and following addition of 100 ll vanadium (III) chloride (8 mg ml1) to each well, Griess reagents [50 ll sulfanilamide (2%) and 50 ll N-(1-naphthyl) ethylendiamine dihydrochloride (01%)] were added. After 30 min incubation at 37°C, absorbance was read at 540 nm using the ELISA reader (Sunrise, Tecan, Austria). Concentration of nitric oxide in serum samples was determined from the linear standard curve established by 0–100 lM sodium nitrite. Determination of the Glu298Asp of eNOS gene polymorphism Total DNA was isolated from peripheral blood leucocytes according to standard procedures. The amplification of the (endothelial nitric oxide) eNOS gene (rs1799983) was determined by the polymerase chain reaction followed by specific enzymatic restriction (PCR-RFLP) (Pulkkinen et al., 2000) and adapted for this study, using the primers eNOS-F1 (50 AAGGCAGGAGACAGTGGATGGA30 ) and eNOS-R1 (50 CCCA GTCAATCCCTTTGGTGCTCA30 ). Each reaction (25 ll) was composed of 100 ng of DNA, 10 mM of Tris–HCl (pH 88), KCl 25 mM, MgCl2 15 mM, 02 lM for each primer, 02 mM of each dNTP, 025 mgml1 of ovalbumin and 05 U of Taq polymerase (Phoneutria, Minas Gerais, Brazil). After
© 2015 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd
Polymorphism, nitric oxide and exercise, T. G. Teixeira et al.
1 minute of hot start at 80°C, the amplification programme was composed of an initial denaturation step beginning at 96°C for 2 min, followed by 35 cycles of denaturation at 96°C for 30 s, annealing at 56°C for 1 min and extension at 72°C through 1 min, with a final extension step at 72°C for 5 min. The polymerase chain reaction products underwent enzymatic digestion using 05 U of restriction Mbol endonuclease (Jena Bioscience, Germany) at 37°C overnight in a total volume of 15 ll. The fragments were then submitted to agarose gel electrophoresis at 22% and identified under molecular weight pattern of DNA. Statistical analysis The results are expressed as mean standard deviation (SD). Shapiro–Wilk tests were applied to check for normality distribution of the study variables. In the case of a nonparametric distribution, a logarithmic transformation was performed. Hardy–Weinberg equilibrium was determined using a chisquare test to compare the observed genotype frequencies with those expected under Hardy–Weinberg equilibrium. Mixed-model ANOVA was used to compare the NO concentrations between genotype groups over the course of 48 h postexercise. Compound sphericity was verified by the Mauchley test. When the assumption of sphericity was not met, the significance of F-ratios was adjusted according to the Greenhouse–Geisser procedure. Tukey’s post hoc test with Bonferroni adjustment was applied in the event of significance. Strength, anthropometric and blood parameter comparisons between genotype groups were made by independent t-test. Multiple linear regression analyses were performed first to assess the associations of strength with anthropometric variables and second to assess the associations of genotype group with strength, anthropometric and blood parameters. Sample size was determined a priori using G*Power version 3.1.3 (Kiel, Germany) with the level of significance set at P = 005 and power (1 b) = 080. We conducted a pilot study to evaluate the effect size for NO response between genotype groups and the effect size f was 0.25 (medium effect size). Based on these a priori calculations and the pilot study, the required sample size was 74. The level of significance was P≤005 and SPSS version 20.0 (Somers, NY, USA) software was used.
(b = 0582, P
