w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Available online at www.sciencedirect.com

ScienceDirect journal homepage: www.elsevier.com/locate/watres

Enhanced anaerobic digestion of waste activated sludge digestion by the addition of zero valent iron Yinghong Feng, Yaobin Zhang*, Xie Quan, Suo Chen Key Laboratory of Industrial Ecology and Environmental Engineering, Ministry of Education, School of Environmental Science and Technology, Dalian University of Technology, Dalian 116024, China

article info

abstract

Article history:

Anaerobic digestion is promising technology to recover energy from waste activated

Received 20 July 2013

sludge. However, the sludge digestion is limited by its low efficiency of hydrolysis

Received in revised form

eacidification. Zero valent iron (ZVI) as a reducing material is expected to enhance

27 October 2013

anaerobic process including the hydrolysiseacidification process. Considering that, ZVI

Accepted 31 October 2013

was added into an anaerobic sludge digestion system to accelerate the sludge digestion in

Available online 12 November 2013

this study. The results indicated that ZVI effectively enhanced the decomposition of protein and cellulose, the two main components of the sludge. Compared to the control test

Keywords:

without ZVI, the degradation of protein increased 21.9% and the volatile fatty acids pro-

Waste activated sludge

duction increased 37.3% with adding ZVI. More acetate and less propionate are found

Anaerobic digestion

during the hydrolysiseacidification with ZVI. The activities of several key enzymes in the

Zero-valent iron

hydrolysis and acidification increased 0.6e1 time. ZVI made the methane production raise

Methane production

43.5% and sludge reduction ratio increase 12.2 percent points. Fluorescence in situ hy-

Sludge reduction

bridization analysis showed that the abundances of hydrogen-consuming microorganisms including homoacetogens and hydrogenotrophic methanogens with ZVI were higher than the control, which reduced the H2 accumulation to create a beneficial condition for the sludge digestion in thermodynamics. ª 2013 Elsevier Ltd. All rights reserved.

1.

Introduction

Waste activated sludge (WAS) produced from municipal wastewater treatment plant is a problem with growing importance because of its huge production, potentially environmental risk and high cost for disposal. Anaerobic digestion is considered to be the most energy efficient method for destroying and stabilizing waste sludge and methane byproduct as a form of fuel may reduce treatment cost (Wang et al., 2013). Three stages are involved in the anaerobic digestion of sludge, e.g. (i) hydrolysis of biological

polymers with subsequent production of H2, acetate and other VFAs, (ii) conversion of these VFAs to H2 and acetate by syntrophic bacteria under a low hydrogen partial pressure and (iii) conversion of acetate and H2 to methane (Lv et al., 2010). Of them, hydrolysis is recognized as the ratelimiting step in the anaerobic sludge digestion (Tiehm et al., 2001; Bougrier et al., 2006). To accelerate the sludge digestion, various pre-treatments have been used to improve the hydrolysis of the sludge, including thermal (Imbierowicz and Chacuk, 2012), chemical (Chiu et al., 1997; Ibeid et al., 2013) and mechanical methods (Nah et al., 2000).

* Corresponding author. Tel.: þ86 411 8470 6460; fax: þ86 411 8470 6263. E-mail addresses: [email protected], [email protected] (Y. Zhang). 0043-1354/$ e see front matter ª 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.watres.2013.10.072

243

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

On the other hand, the microbiology of anaerobic digestion is complicated and each microbial stage has their optimal functioning conditions. They are sensitive to and possibly inhibited by operational parameters such as pH, hydrogen, volatile fatty acids and others. H2, a byproduct during acidification of organics, is considered as a thermodynamically unfavorable intermediate during anaerobic methanogenesis because it may impede the decomposition of organic acids (Fukuzaki et al., 1990). For example, propionic acid and butyric acid, two main VFA forms in acidification, can be decomposed into acetate only when pH2 is less than 104 for n-butyric acid and 105 atm for propionic acid (Siriwongrungson et al., 2007). However the partial pressure of hydrogen in practice usually exceeds this range especially as the substrates are rich in carbohydrate such as WAS (Hawkes et al., 2002). Until now, very few publications are focused on accelerating the anaerobic digestion of sludge by reducing the accumulation of hydrogen. Zero-valent iron (ZVI), a reductive material, has been widely applied in wastewater treatment, groundwater purification and soil remediation (Jiang et al., 2011). ZVI may decline the oxidation-reduction potential (ORP) when added into anaerobic systems, enabling to create a more favorable environment for anaerobic biological processes (Liu et al., 2012a). It could significantly improve conversion of complex organics into volatile fatty acids (VFAs) and methanogenesis. It was found that propionate production dropped with addition of ZVI because propionic-type fermentation did not prefer low ORP (Alkaya and Demirer, 2011; Ren et al., 2007). Although the effects of ZVI on anaerobic degradation of sucrose were primarily investigated in our previous work, the functions of ZVI in the anaerobic sludge digestion still remain unknown. As mentioned above, the sludge digestion is different with the digestion of simple organics in terms of the limiting step and H2 production rate. In this study, ZVI was added into an anaerobic digestion system for accelerating the sludge digestion. To our best knowledge, it is the first time to enhance the anaerobic digestion of sludge through adding ZVI. The effects of ZVI on hydrolysiseacidification and methanogenesis of the sludge were investigated, with the aim to provide a simple and effective method to accelerate the anaerobic digestion of sludge.

2.

Materials and methods

2.1.

Sludge pretreatment

WAS used in this study was obtained from the secondary sedimentation tank of municipal wastewater treatment plant in Dalian, China. The sludge was concentrated by settling at 24 h, and storage at 4  C before use. To enhance the hydrolysis, the sludge was pretreated using alkalinemethod before the anaerobic fermentation according to the reference (Chu et al., 2009). The pH of sludge was adjusted to 12 using 4 mol/L of sodium hydroxide, and then the sludge was stirred at 80 rpm for 6 h. After pretreatment, the pH of sludge was adjusted to 7 for anaerobic digestion. The characteristics of raw sludge and alkaline-pretreated sludge are compared in Table 1.

Table 1 e Characteristics of the raw sludge and alkalinepretreated sludge. Parameters

Raw WAS

Alkaline-pretreated WAS

pH TSS (total suspended solids) VSS (volatile suspended solids) TCOD (total chemical oxygen demand) SCOD (soluble chemical oxygen demand) Total protein (as COD) Total polysaccharide (as COD) Soluble protein (as COD) Soluble polysaccharide (as COD)

7.16  0.1 13.4  0.954

7.06  0.1 11.7  0.412

8.57  0.104

6.54  0.142

12875  784

10829  697

634  75

4336  324

7725  575 1545  215

6820  543 1332  148

348  76

2454  286

81  47

516  176

All values are expressed in mg/L except pH. Average data and standard deviation obtained from three tests.

2.2.

Operation

The seed sludge was collected from a UASB reactor in our laboratory. The alkaline-pretreated sludge and seed sludge was mixed with a ratio of 9:1 for the anaerobic digestion. To investigate the effects of ZVI on hydrolysis and methanogenesis, respectively, the experiments were divided into the two stages. The first experiment was lasted only for 3 d to explore the effect of ZVI on hydrolysiseacidification, and the second experiment was conducted for 20 d to investigate the effect on whole anaerobic digestion of sludge including hydrolysiseacidification and methanogenesis.

2.2.1.

Effects of ZVI dosage on hydrolysiseacidification

The VFAs produced tended to be consumed by methanogens, and then it was necessary to eliminate its interference in the experiment of this first stage. Heat treatment and BESA (2bromoethanesulfonic acid) addition have been reported to efficiently get rid of methanogens from anaerobic fermentation system (Oh et al., 2003; Basu et al., 2005). Therefore, in the experiment of the first stage, the mixture sludge including alkaline-pretreated sludge and seed sludge was heated at 102  C for 30 min. After the mixture was cooled down to room temperature, BESA with a concentration of 50 mM was mixed in for use. 250 mL of the mixed sludge above was added into four serum bottles with working volume of 250 mL, respectively. Afterwards, 0, 1, 4 and 20 g/L of ZVI powder (diameter of 0.2 mm, BET surface area of 0.05 m2/ g, purity >98%) were added into the four bottles, respectively. All bottles were capped with rubber stoppers and flushed with nitrogen gas to remove oxygen before the anaerobic digestion. The bottles were placed in an air-bath shaker (120 rpm) at 35  1  C for 72 h. During the digestion, the biogas produced from each bottle was collected into gasbag for analysis. After the digestion, the mixture was poured out, and their supernatant and remainder sludge were analyzed, respectively.

244

Effects of ZVI dosage on methanogenesis

In order to study the effect of ZVI on whole anaerobic process including methanogenesis, another experiment was operated under the same conditions as the hydrolysiseacidification experiment in the first stage but without the heat treatment and BESA addition. The digestion was lasted for 20 d to ensure the complete anaerobic digestion. All the experiments were conducted in triplicate.

2.3.

Analytical methods

Sludge samples from the reactors were analyzed for total suspended solid (TSS), volatile suspended solids (VSS), total protein and total polysaccharide. Then the samples were centrifuged at 8000 rpm for 10 min and immediately filtered through a cellulose membrane with a pore size of 0.45 mm for analysis of soluble COD (SCOD), soluble protein, soluble polysaccharide and VFAs. TSS, VSS and SCOD were determined according to Standard Methods for the Examination of Water and Wastewater (Association, 1994). Proteins were measured with Lowry’s method using bovine serum albumin as a standard solution (Fr et al., 1995). Polysaccharide was measured with phenol-sulfuric acid method using glucose as a standard solution (Chaplin, 1994). The equivalent relationships between COD and substrates were as follows: 1.5 g-COD/g protein, 1.06 g-COD/g carbohydrate, 1.07 g-COD/g acetate, 1.51 g-COD/g propionate, 1.82 g-COD/g butyrate, and 2.04 g-COD/g valerate (Lu et al., 2012). The ORP was measured using an ORP combination glass-body redox electrode (Sartorius PY-R01, Germany). Fe2þ was analyzed by an adaptation of the ferrozine technique (Cooper et al., 2000). The composition of the biogas was analyzed with a gas chromatograph (Shimadzu, GC-14C/TCD, Japan) equipped with a thermal conductivity detector (TCD). The volume of biogas was calculated as the value at standard temperature and pressure (STP). The concentrations of VFAs, including acetate, propionate, butyrate, were determined using another GC (Shimadzu, GC-2010/FID, Japan) equipped with a flame ionization detector (FID). The activities of protease, cellulase, acetate kinase (AK), phosphotransacetylase (PTA), butyrate kinase (BK) and phosphotransbutyrylase (PTB) were assayed. The enzyme was extracted according to the reported method (Zhao et al., 2010). Specially, 25 mL of the mixture from the reactors was washed and resuspended in 10 mL of 100 mM sodium phosphate buffer (pH ¼ 7.4). The suspension was sonicated at 20 kHz and 4  C for 30 min to break down the sludge and then centrifuged at 10,000 rpm and 4  C for 30 min to remove debris. The extracts were kept cold on ice before they were used for the enzyme activity assay. Protease activity was determined according to Karadzic et al. (2004) with casein as the substrate. Cellulose activity was assayed with the method of Zhang and Lynd (2003) using cellulose as substrate. The assays for PTA and PTB were based on the method of Andersch et al. (1983) with acetyl-CoA and butyryl-CoA as substrates, respectively. The AK and BK activities were analyzed using the method of Allen et al. (1964) with potassium acetate and sodium butyrate as the substrates, respectively. The specific enzyme activity was defined as unit of enzyme activity per milligram of VSS.

Fluorescence in situ hybridization (FISH) was used to determine the abundance of homoacetogens and hydrogenotrophic methanogens in the reactors. FISH was conducted according to the method described by Wu et al. (2001). Fluorescence labels of the oligonucleotide probes used in this study included EUB338 (Bacteria, GCTGCCTCCCGTAGGAGT), ARC915 (Archaebacteria, GTGCTCCCCCGCCAATTCCT), AW (Acetobacterium sp. E. limosum, GGCTATTCCTTTCCATAGGG, homoacetogens) and MB 1174 (Methanobacteriaceae, TACCGT CGTCCACTCCTTCCTC, hydrogenotrophic methanogens) (Zhang et al., 2010; Yanagita et al., 2000; Ku¨sel et al., 1999; Lettinga et al., 2001). After hybridization, the specimens were stained with 4,6-diamidino-2-phenylindole (DAPI). The samples were observed under a confocal laser scanning microscope (Leica SP2, Heidelberger, Germany). The FISH images obtained were imported to Image-Pro Plus 6.0 for analysis of the relative abundance of microorganisms.

3.

Results and discussion

3.1.

Effect of ZVI on the hydrolysis and acidification

3.1.1.

Supernatant component and VFAs production after 3 d

Converting particulate matters to soluble substrates is the first step and is also the limiting step of the anaerobic digestion of sludge, occurring in the process of hydrolysiseacidification. Microbial cell walls contain glycan cross linked by peptide chains, causing resistance to biodegradation. During pretreatment, cell walls were ruptured and extracellular polymeric substances were degraded, and then release polysaccharide and protein as the main two components (Jimenez et al., 2012). To investigate the effect of ZVI on the hydrolysiseacidification of sludge, the dosages of ZVI with 0, 1, 4 and e20 g/L were added into in the four sludge digestion systems after removing methanogens, respectively. The digestion was lasted for 3 d. The protein, polysaccharide and VFAs including acetate, propionate, butyrate and valerate in the supernatant were determined after the fermentation for 3 d and the results are shown in

Soluble organic compound (mg COD/L)

2.2.2.

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Unknow Protein Polysaccharide VFA

5000 4000 3000 2000 1000 0 Initial

0

1 4 Dosage of ZVI (g/L)

20

Fig. 1 e Effects of ZVI on supernatant component after the fermentation for 3 d.

245

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Fig. 1. Acetate, propionate, butyrate and valerate were summed as VFAs. Protein contributed about 60% of soluble TCOD in the sludge. From Fig. 1, with the increase of ZVI from 0 to 4 g/L, the content of soluble protein decreased from 878.2 to 341.3 mg/L, and the soluble polysaccharide declined from 144.7 to 124.9 mg/L. The unknown organics in the supernatant also decreased obviously. Correspondingly, as the products of the hydrolysiseacidification, the VFAs increased from 2055.8 to 2822.1 mg/L as increasing ZVI from 0 to 4 g/L. It indicated that the VFA production at ZVI of 4 g/L was 37.3% higher than that of no-ZVI dosage. When further increasing ZVI to 20 g/L, the degradations of protein and polysaccharide and the production of VFAs had insignificant change approaching to the test at 4 g/L. The above results suggested that the ZVI could effectively accelerate the hydrolysiseacidification of the sludge.

3.1.2.

Composition of VFAs in the supernatant after 3 d

After the fermentation for 3 d, the VFA components under different dosages of ZVI were detected and shown in Fig. 2. The VFA produced mainly included acetate, propionate, butyrate and valerate, and acetate was the prevailing product. At the dosages of 0, 1, 4 and 20 g/L, the acetate concentration was 759.2, 971.0, 1373.2 and 1303.1 mg/L and its percentage in the total VFAs was 36.9%, 41.3%, 48.7% and 47.5%, respectively. It indicated that ZVI could enhance the acetate production. The result was in agreement with our previous report, in which with the addition of ZVI the acetate production from the anaerobic digestion of sucrose in solution increased 20% (Liu et al., 2012b). The maximal acetate production occurred at ZVI of 4 g/L, 80.9% higher than that of no-ZVI dosage. It also can be seen that the percentage of propionate decreased from 20.6% to 11.7% with the increase of ZVI from 0 to 4 g/L. It is well known that acetic-type, propionic-type and butyric-type fermentation are three major fermenting pathways in anaerobic digestion. The butyric-type fermentation converts organic matters to butyric and acetic acids, and the propionictype fermentation mainly produces propionic acid, whereas the acetic-type fermentation may directly decompose organics to acetate. Propionic-type fermentation is believed as a

facultative anaerobic process occurring at an ORP higher than 278 mV, while acetic-type and butyric-type fermentation are obligate anaerobic processes occurring at a more negative ORP (Ren et al., 2007; Wang et al., 2006). ZVI as a reductive material could create a more reductive atmosphere to enhance butyrictype and acetic-type fermentation and to decline propionate production. Meng et al. (2013) reported that propionate conversion rate increased from 43e77% to 67e89% by ZVI addition. It might be one reason for the increase of acetate and decrease of propionate, which might provide a favorable substrate form for methanogenesis.

3.1.3. Total protein and polysaccharide in the remainder sludge and mass balance calculation after 3 d As shown in Fig. 3, the sludge used in this experiment contained 6820.5 mg-COD/L of protein and 1332.1 mg-COD/L of polysaccharide, accounting for 63.0% and 12.3% of organic matters in the sludge, respectively. At ZVI of 0, 1, 4 and 20 g/L, after the fermentation for 3 d, the total protein was reduced to 5077.4, 4723.5, 4317.1 and 4330 mg/L, respectively, and the total polysaccharide was reduced to 1028.6, 1008.6, 937.8 and 939.6 mg/L, respectively. It meant that the highest decomposition ratio of protein and polysaccharide, happening at the dosage of 4 g/L, was 36.7% and 29.6%, respectively. The decomposition of these two complex organics at the dosage of 20 g/L approached to that of 4 g/L. Their decomposition with no ZVI was slowest, only 25.6% for total protein and 22.9% for polysaccharide. The results were in agreement with the production of VFAs in the supernatant. It further suggested ZVI accelerated the hydrolysiseacidification of sludge. A mass balance based on COD was conducted after 3 d fermentation (see Fig. S1A in Supplementary material). The COD in the sludge anaerobic digestion included the COD from solid organic matters, soluble hydrolysis products (hydrolysate) produced from the alkaline-pretreatment, VFA, methane and others products. Before the fermentation, solid organic matters and hydrolysate produced from the alkalinepretreatment were the prevalent component, accounting for 60.0% and 37.3% of total organics, respectively. After the fermentation, the maximum ratio of solid sludge hydrolysis (or solubilization) and VFA accumulation, achieving at 4 g/L of

8000 Acetate Propionate Butyrate Valerate

1200

Concentration (mg COD/L)

Individualm VFA (mg COD/L)

1400

1000 800 600 400 200

7000

Total protein• Total polysacchride•

6000 5000 4000 3000 2000 1000 0

0

0

1 4 Dosage of ZVI (g/L)

20

Fig. 2 e Composition of VFAs after the fermentation for 3 d.

Initial

0

1

4

20

Dosage of ZVI (g/L) Fig. 3 e Changes in total organic matters after 3 d.

246

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

ZVI, was 14.49% and 23.31%, respectively. For no-ZVI dosage, there was only 9.05% for solid sludge hydrolysis and 16.23% for VFA accumulation. This result was in agreement with the conclusion that ZVI enhanced the hydrolysis and acidification of sludge. Methane was detected, but only accounting for less than 3% of total organics. Hydrogen production was decreased from 3.70 mL/g-VSS to 2.04 mL/g-VSS with increasing the ZVI dosage from 0 g/L to 20 g/L. Carbon dioxide was the major component in the biogas (see Fig. S2 in Supplementary material). Its production increased significantly from 26.3 mL/g-VSS with no ZVI to 34.2 mL/g-VSS with 4 g/L of ZVI, but decreased to 27.8 mL/g-VSS at 20 g/L of ZVI.

3.2.

Effect of ZVI on the full-scale digestion of sludge

3.2.1.

Biogas production after 20 d

To investigate effects of ZVI on the whole anaerobic sludge digestion, another experiment was conducted with no removal of methanogenesis and the fermentation was lasted for 20 d. The biogas production vs. fermentation time is recorded in Fig. 4. From Fig. 4a, the methane production increased with the increase of the ZVI dosage. At ZVI of 0, 1, 4 and 20 g/L, the cumulative methane production after 20 d was 192.6, 211.1, 233.8 and 276.4 mL/VSS, respectively. The methane production

without dosing ZVI approached to references (Heo et al., 2003). The methane production enhancing by ZVI in this study was significantly higher than those produced by raw sludge of 150 mL/g-VSS (Ferrer et al., 2008) or alkaline-pretreated sludge of 220 mL/g-VSS (Carrere et al., 2010). The methane productivity at the dosage of 20 g/L increased by 43.5% compared to the no-ZVI dosage. Different with the highest performance of hydrolysiseacidification at ZVI of 4 g/L, the highest production of methane was obtained at ZVI of 20 g/L. The percentage of methane in the biogas was also affected by ZVI dosage. The methane concentration increased gradually from 58.5% to 61.4% with the increase of ZVI dosage from 0 g/L to 4 g/L, and then increased significantly to 68.9% when further increasing ZVI dosage to 20 g/L. It indicated that dosage of ZVI improved the methane production in a wider extent. ZVI reportedly enhanced the activity of methanogens (Dinh et al., 2004; Daniels et al., 1987). Besides, ZVI could also increase the methane production from the following two aspects. Firstly, the enhanced generation of acetate in the presence of ZVI provided a suitable substrate for methanogenesis. Generally, organic acids could not be directly utilized by methanogens until they were decomposed into acetate by syntrophic acetogenic bacteria (Karakashev et al., 2006; Yang and Okos, 1987). Secondly, Fe could directly serve as an electron donor for

150

250

Cumulative CO 2 (mL/g-VSS)

Cumulative CH 4 (mL/g-VSS)

300

200

150 0 g/L 1 g/L

100

4 g/L 20 g/L

50

100

0

0 g/L 1 g/l 4 g/l

50

20 g/l

0

0

2

4

6

8

10

12

14

16

18

20

0

2

4

Fermentation time (d)

6

8

10

12

14

16

18

20

Fermentation time (d)

a. CH4 production

c. CO2 production 60

1 g/L

70

4 g/L

50

H2 partial pressure (Pa)

80

20 g/L

60 50 40 30 20

Fe

2+

concentration (mg/L)

90

10

0 g/L 1 g/l

40

4 g/l 20 g/l

30 20 10 0

0

0

5

10

15

Fermentation time (d)

b. Fe2+ concentration

20

0

2

4

6

8

10

12

14

16

18

20

Fermentation time (d)

d. H

2

partial pressure

Fig. 4 e Effect of ZVI on biogas production after 20 d (a) CH4 production, (d) Fe2D concentration, (c) CO2 production, (d) H2 partial pressure.

247

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

(1)

CO2þ4H2 ¼ CH4þ2H2O

(2)

In the reaction (2), H2 might be produced from the chemical corrosion of Fe0 or/and from the hydrolysiseacidification. From the Fe2þ release in Fig. 4b, after the digestion for 20 d, Fe2þ in the supernatant was about 79.9 mg/L at ZVI of 20 g/L and 43.1 mg/L at 4 g/L. Even if all of Fe2þ was produced from the reaction (1), the production of CH4 from Fe was only 2.0 mL at 20 g/L and 1.1 mL at 4 g/L, whose contribution for the methane production was minor compared to the increment of methane with ZVI in Fig. 4a. In the other hand, the high dosage of ZVI unnecessarily meant the great consumption. From the Fe2þ released (79.9 mg/L), the ZVI dosage of 20 g/L could be repeatedly utilized for 250 batch (20  1000/79.9) of the sludge digestion if ignoring the loss of solid ZVI through effluent. For 20 g/L of ZVI, V (mL CH4/g Fe) ¼ DV (mL CH4/g VSS)  VSS (g/  Available batch/ZVI dosage (g/L) ¼ (276.4e192.6) L)  6.54  250/20 ¼ 6531 (mL/g-Fe). It meant that 1 kg of Fe could increase 6531 L of methane production. Moreover, it could reduce the remainder organics in the supernatant and sludge at a considerable level, saving considerable operating costs in the following treating processes. From Fig. 4c, when increasing ZVI from 0 to 4 g/L, the CO2 production rose from 123.8 to 145.7 mL/VSS. It was because CO2 was a byproduct from the hydrolysiseacidification process of sludge. However the lower CO2 production at ZVI of 20 g/L was observed. It was a result from the balance between the accelerated CO2 production and the enhanced CO2 utilization by hydrogen-utilizing microorganisms according to the reaction (1) and (2). From Fig. 4d, with the increase of ZVI, the H2 partial pressure in the biogas decreased. It further confirmed that ZVI could enhance the hydrogen-utilizing biological processes to decrease its content in the anaerobic system. Apart from autotrophic microorganisms, homoacetogens could also use CO2/H2 to decrease their contents in the biogas based on the reaction of 2CO2þ4H2 ¼ CH3COOHþ2H2O.

Protease is responsible for the decomposition of proteins to amino acids and cellulose is capable of catalyzing hydrolysis of polysaccharide to monoses, respectively. 5.5

Removal ratio

5.0

40

4.5

35

4.0

30

3.5

25

3.0

20 0

1 4 Dosage of ZVI (g/L)

20

80

b

Total protein Total polysaccharide

70

Sludge reduction after 20 d

Anaerobic digestion can only partially decompose the organic fraction due to the limitation of digestion time. Volatile solid reduction is frequently used as a parameter to characterize the performance of anaerobic sludge digestion (Arnaiz et al., 2006). From Fig. 5a, the sludge reduction without dosing ZVI approached to references (Lv et al., 2010). The content of volatile solid (VSS) was 6.54 mg/L before the digestion, and after the digestion its contents decreased to 4.73, 4.33, 4.31 and 3.93 g/L at the ZVI of 0, 1, 4, 20 g/L, respectively. It indicated that the sludge reduction increased from 27.7% to 39.9% as increasing ZVI from 0 to 20 g/L. If considering the sludge reduction caused by alkalipretreatment (Table 1), the whole reduction ratio with 20 g/L ZVI would be 54.1%, higher than many references, such as ozone pretreatment (36% VSS reduction in 30 d), ultrasonic

45

a VSS

Removal ratio (%)

3.2.2.

3.3. Specific activities of key enzymes relevant to hydrolysis and VFA production

60 50 40 30 20 0

1 4 Dosage of ZVI (g/L)

20

Fig. 5 e (a) Reduction of VSS after 20 d, (b) Reduction of protein and polysaccharide after 20 d.

VSS removal ratio

CO2þ4Fe0þ8Hþ ¼ CH4þ4Fe2þþ2H2O

pretreatment (38.9% VSS reduction in 25 d) and microwave pretreatment (23.2% VSS reduction, 15 d) (Erden et al., 2010; Kim et al., 2003; Park et al., 2004). After the digestion, the total protein and total polysaccharide in the sludge and supernatant decreased correspondingly (Fig. 5b). As increasing ZVI from 0 to 20 g/L, the removal of total protein increased from 59.1% to 67.8%, and the removal of total polysaccharide increased from 32.3% to 43.4%. The enhanced sludge reduction not only reduced the sludge amount but also decreased the residual organics in the sludge and liquid. It would facilitate to save operating costs in the following treating processes. A mass balance calculation base on COD was conducted after 20d fermentation (see Fig. S1B in Supplementary material). Solid organic matter and hydrolysate was the two major components before fermentation, and then decomposed and converted to methane during the fermentation process. The percentage of methane increased with the increasing of ZVI dosage, reaching a maximum ratio of 41.4% with 20 g/L ZVI. Other unknown component was accounting for less than 9%.

VSS (mg/L)

reducing CO2 into CH4 through autotrophic methanogenesis based on the following reaction:

248

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Table 2 e Specific activities of key enzymes. ZVI dosage

Protease

0 1 4 20

3.99  4.95  7.39  7.66 

0.03 0.03 0.04 0.04

Cellulase 0.133  0.165  0.246  0.255 

0.02 0.02 0.03 0.02

AK 1.56 1.87 2.61 2.86

   

PTA

0.03 0.04 0.05 0.05

0.124  0.164  0.202  0.225 

0.001 0.001 0.02 0.01

BK 0.090 0.106 0.137 0.142

 0.003  0.004  0.005  0.003

PTB 0.007 0.008 0.011 0.011

   

0.04 0.03 0.05 0.04

The specific enzyme activity was defined as unit of enzyme activity per milligram of VSS. The data are the averages from triple tests.

The small-size organic matters are further converted to VFAs with the function of acid-forming enzyme such as AK, PTA, BK and PTB. Specifically, PTA and PTB can decompose acetyl-CoA and butyryl-CoA to acetyl and butyryl phosphate, respectively, and then are further converted to acetate and butyrate with the function of AK and BK, respectively. As shown in Table 2, the dosage of ZVI significantly improved the activities of these key enzymes above. The activities of protease and cellulose at the dosage of 20 g/L increased 92.0% and 91.7%, respectively. It was a reason for the higher performance in the hydrolysis of protease and cellulose with the presence of ZVI. The activities of acid-forming enzymes including AK, PTA, BK and PTB increased about 57%e83% at ZVI of 20 g/L. It was in agreement with the accelerated decomposition of VFAs and more acetate production during the acidification.

3.4. FISH analysis for hydrogen-consuming microorganisms Acetogenesis of fatty acids may happen if hydrogen is not accumulated but is consumed by hydrogen-consuming microorganisms (Appels et al., 2008). FISH was used to analyze the major hydrogen-consuming microorganisms including homoacetogens and hydrogenotrophic methanogens. The abundance of homoacetogens in bacteria was 38.3% at ZVI of 20 g/L, while it was only 23.8% at no dosage of ZVI (see Fig. S3 in Supplementary material). The abundance of hydrogenotrophic methanogens in archaea was 77.7% at 20 g/L compared to 54.3% without ZVI. It further proved that ZVI enhanced the growth of hydrogen-consuming microorganisms, thereby improving the production of acetate or methane.

3.5.

Possibility of using scrap iron

The function of ZVI was assumedly depended on the surface reaction of ZVI, i.e. Fe0þ2Hþ ¼ Fe2þþH2. Increase of the dosage provided a bigger surface to release more Fe2þ. From this point of view, the waste scrap iron widely existing in machinery industries may be used as ZVI. A possible doubt of utilizing the scrap iron is that the scrap has a small surface area. However, the scrap iron usually with a size of about decimeter level possibly had a better mass transfer in the high concentration sludge under mixing condition. Comparatively, the powder iron was easily immersed into sludge to slow down its function. The released Fe2þ at 20 g/L of dosage was only 80 mg/L after 20 d, while Fe2þ reached 15.7 mg/L when the scrap iron was used in anaerobic system with a HRT of 2 d in our previous study (Liu et al., 2012b). It suggested that mass transfer in the surface of the scrap did not decrease but increase. More

importantly, the scrap iron is more compatible for application. Apart from its lower cost, the scrap is more convenient to be recycled than the powder. The further investigation on the scrap iron would be conducted in the next study. Nevertheless, the study provided a novel and useful method to accelerate the anaerobic sludge digestion and to enhance methane production.

4.

Conclusions

The anaerobic digestion of sludge was limited by the low rate of hydrolysis and acidification. This study showed that the anaerobic digestion of sludge was accelerated by the addition of ZVI. The production of VFAs was enhanced by 37.3% with ZVI during the hydrolysis and acidification. After the digestion for 20 d, the methane productivity at ZVI of 20 g/L increased by 43.5%, and the sludge reduction ratio increased by 12.2 percent points. The reasons could be ascribed to the following aspects. Firstly, the activities of major enzymes related to hydrolysis and acidification were enhanced after adding ZVI. It made the digestion better catalyzed in the conversion of solid sludge and other complex organics to VFAs. Secondly, ZVI could enhance the growth of H2-utilizing microorganisms including homoacetogens and hydrogenotrophic methanogens to consume H2 and then drive the anaerobic digestion.

Acknowledgments The authors acknowledge the financial support from the National Basic Research Program of China (21177015), the National Crucial Research Project for Water Pollution Control of China (2012ZX07202006), the New Century Excellent Talent Program of the Ministry of Education of China (NCET-10-0289).

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.watres.2013.10.072.

references

Alkaya, E., Demirer, G.N., 2011. Anaerobic acidification of sugarbeet processing wastes: effect of operational parameters. Biomass and Bioenergy 35 (1), 32e39.

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Allen, S., Kellermeyer, R., Stjernholm, R., Wood, H.G., 1964. Purification and properties of enzymes involved in the propionic acid fermentation. J. Bacteriol. 87 (1), 171e187. Andersch, W., Bahl, H., Gottschalk, G., 1983. Level of enzymes involved in acetate, butyrate, acetone and butanol formation by Clostridium acetobutylicum. Eur. J. Appl. Microbiol. Biotechnol. 18 (6), 327e332. Appels, L., Baeyens, J., Degre`ve, J., Dewil, R., 2008. Principles and potential of the anaerobic digestion of waste-activated sludge. Prog. Energy Combustion Sci. 34 (6), 755e781. Arnaiz, C., Gutierrez, J., Lebrato, J., 2006. Biomass stabilization in the anaerobic digestion of wastewater sludges. Bioresour. Technol. 97 (10), 1179e1184. Association, A.P.H, 1994. Water Environment Federation (1998) Standard Methods for the Examination of Water and Wastewater (Washington, DC). Basu, S., Oleszkiewicz, J., Sparling, R., 2005. Effect of sulfidogenic and methanogenic inhibitors on reductive dehalogenation of 2-chlorophenol. Environ. Technol. 26 (12), 1383e1392. Bougrier, C., Albasi, C., Delgenes, J., Carrere, H., 2006. Effect of ultrasonic, thermal and ozone pre-treatments on waste activated sludge solubilisation and anaerobic biodegradability. Chem. Eng. Process. Process Intensification 45 (8), 711e718. Carrere, H., Dumas, C., Battimelli, A., Batstone, D.J., Delgenes, J.P., Steyer, J.P., Ferrer, I., 2010. Pretreatment methods to improve sludge anaerobic degradability: a review. J. Hazard. Mater. 183 (1), 1e15. Chaplin, M.F., 1994. Carbohydrate Analysis. Wiley Online Library. Chiu, Y.C., Chang, C.N., Lin, J.G., Huang, S.J., 1997. Alkaline and ultrasonic pretreatment of sludge before anaerobic digestion. Water Sci. Technol. 36 (11), 155e162. Chu, L., Yan, S., Xing, X.H., Sun, X., Jurcik, B., 2009. Progress and perspectives of sludge ozonation as a powerful pretreatment method for minimization of excess sludge production. Water Res. 43 (7), 1811e1822. Cooper, D.C., Picardal, F., Rivera, J., Talbot, C., 2000. Zinc immobilization and magnetite formation via ferric oxide reduction by Shewanella putrefaciens 200. Environ. Sci. Technol. 34 (1), 100e106. Daniels, L., Belay, N., Rajagopal, B.S., Weimer, P.J., 1987. Bacterial methanogenesis and growth from CO2 with elemental iron as the sole source of electrons. Science 237 (4814), 509e511. Dinh, H.T., Kuever, J., Mußmann, M., Hassel, A.W., Stratmann, M., Widdel, F., 2004. Iron corrosion by novel anaerobic microorganisms. Nature 427 (6977), 829e832. Erden, G., Demir, O., Filibeli, A., 2010. Disintegration of biological sludge: effect of ozone oxidation and ultrasonic treatment on aerobic digestibility. Bioresour. Technol. 101 (21), 8093e8098. Ferrer, I., Ponsa´, S., Va´zquez, F., Font, X., 2008. Increasing biogas production by thermal (70 C) sludge pre-treatment prior to thermophilic anaerobic digestion. Biochem. Eng. J. 42 (2), 186e192. Fr, B., Griebe, T., Nielsen, P., 1995. Enzymatic activity in the activated-sludge floc matrix. Appl. Microbiol. Biotechnol. 43 (4), 755e761. Fukuzaki, S., Nishio, N., Shobayashi, M., Nagai, S., 1990. Inhibition of the fermentation of propionate to methane by hydrogen, acetate, and propionate. Appl. Environ. Microbiol. 56 (3), 719e723. Hawkes, F., Dinsdale, R., Hawkes, D., Hussy, I., 2002. Sustainable fermentative hydrogen production: challenges for process optimisation. Int. J. Hydrogen Energy 27 (11), 1339e1347. Heo, N., Park, S., Lee, J., Kang, H., 2003. Solubilization of waste activated sludge by alkaline pretreatment and biochemical methane potential (BMP) tests for anaerobic co-digestion of municipal organic waste. Water Sci. Technol. 48 (8), 211e219. Ibeid, S., Elektorowicz, M., Oleszkiewicz, J., 2013. Modification of activated sludge properties caused by application of

249

continuous and intermittent current. Water Res. 47 (2), 903e910. Imbierowicz, M., Chacuk, A., 2012. Kinetic model of excess activated sludge thermohydrolysis. Water Res. 46 (17), 5747e5755. Jiang, Z., Lv, L., Zhang, W., Du, Q., Pan, B., Yang, L., Zhang, Q., 2011. Nitrate reduction using nanosized zero-valent iron supported by polystyrene resins: role of surface functional groups. Water Res. 45 (6), 2191e2198. Jimenez, J., Vedrenne, F., Denis, C., Mottet, A., De´le´ris, S., Steyer, J.-P., Cacho Rivero, J.A., 2012. A statistical comparison of protein and carbohydrate characterisation methodology applied on sewage sludge samples. Water Res. 47 (5), 1751e1762. Karadzic, I., Masui, A., Fujiwara, N., 2004. Purification and characterization of a protease from Pseudomonas aeruginosa grown in cutting oil. J. Biosci. Bioeng. 98 (3), 145e152. Karakashev, D., Batstone, D.J., Trably, E., Angelidaki, I., 2006. Acetate oxidation is the dominant methanogenic pathway from acetate in the absence of Methanosaetaceae. Appl. Environ. Microbiol. 72 (7), 5138e5141. Kim, J., Park, C., Kim, T.H., Lee, M., Kim, S., Kim, S.W., Lee, J., 2003. Effects of various pretreatments for enhanced anaerobic digestion with waste activated sludge. J. Biosci. Bioeng. 95 (3), 271e275. Ku¨sel, K., Pinkart, H.C., Drake, H.L., Devereux, R., 1999. Acetogenic and sulfate-reducing bacteria inhabiting the rhizoplane and deep cortex cells of the sea grass Halodule wrightii. Appl. Environ. Microbiol. 65 (11), 5117e5123. Lettinga, G., Rebac, S., Zeeman, G., 2001. Challenge of psychrophilic anaerobic wastewater treatment. Trends. Biotechnol. 19 (9), 363e370. Liu, Y., Zhang, Y., Quan, X., Li, Y., Zhao, Z., Meng, X., Chen, S., 2012a. Optimization of anaerobic acidogenesis by adding Fe0 powder to enhance anaerobic wastewater treatment. Chem. Eng. J. 192 (1), 179e185. Liu, Y., Zhang, Y., Zhao, Z., Li, Y., Quan, X., Chen, S., 2012b. Enhanced azo dye wastewater treatment in a two-stage anaerobic system with Fe0 dosing. Bioresour. Technol. 121, 148e153. Lu, L., Xing, D., Liu, B., Ren, N., 2012. Enhanced hydrogen production from waste activated sludge by cascade utilization of organic matter in microbial electrolysis cells. Water Res. 46 (4), 1015e1026. Lv, W., Schanbacher, F.L., Yu, Z., 2010. Putting microbes to work in sequence: recent advances in temperature-phased anaerobic digestion processes. Bioresour. Technol. 101 (24), 9409e9414. Meng, X., Zhang, Y., Li, Q., Quan, X., 2013. Adding Fe0 powder to enhance the anaerobic conversion of propionate to acetate. Biochem. Eng. J. 73 (15), 80e85. Nah, I.W., Kang, Y.W., Hwang, K.-Y., Song, W.-K., 2000. Mechanical pretreatment of waste activated sludge for anaerobic digestion process. Water Res. 34 (8), 2362e2368. Oh, S.-E., Van Ginkel, S., Logan, B.E., 2003. The relative effectiveness of pH control and heat treatment for enhancing biohydrogen gas production. Environ. Sci. Technol. 37 (22), 5186e5190. Park, B., Ahn, J.H., Kim, J., Hwang, S., 2004. Use of microwave pretreatment for enhanced anaerobiosis of secondary sludge. Resour. Sludge: Forging New Front. 50 (9), 17e23. Ren, N., Chua, H., Chan, S., Tsang, Y., Wang, Y., Sin, N., 2007. Assessing optimal fermentation type for bio-hydrogen production in continuous-flow acidogenic reactors. Bioresour. Technol. 98 (9), 1774e1780. Siriwongrungson, V., Zeng, R.J., Angelidaki, I., 2007. Homoacetogenesis as the alternative pathway for H2 sink during thermophilic anaerobic degradation of butyrate under suppressed methanogenesis. Water Res. 41 (18), 4204e4210.

250

w a t e r r e s e a r c h 5 2 ( 2 0 1 4 ) 2 4 2 e2 5 0

Tiehm, A., Nickel, K., Zellhorn, M., Neis, U., 2001. Ultrasonic waste activated sludge disintegration for improving anaerobic stabilization. Water Res. 35 (8), 2003e2009. Wang, L., Aziz, T.N., de los Reyes III, F.L., 2013. Determining the limits of anaerobic co-digestion of thickened waste activated sludge with grease interceptor waste. Water Res. 47 (11), 3835e3844. Wang, L., Zhou, Q., Li, F., 2006. Avoiding propionic acid accumulation in the anaerobic process for biohydrogen production. Biomass and Bioenergy 30 (2), 177e182. Wu, J.-H., Liu, W.-T., Tseng, I.-C., Cheng, S.-S., 2001. Characterization of microbial consortia in a terephthalatedegrading anaerobic granular sludge system. Microbiology 147 (2), 373e382. Yanagita, K., Kamagata, Y., Kawaharasaki, M., Suzuki, T., Nakamura, Y., Minato, H., 2000. Phylogenetic analysis of methanogens in sheep rumen ecosystem and detection of Methanomicrobium mobile by fluorescence in situ hybridization. Biosci. Biotechnol. Biochem. 64 (8), 1737e1742.

Yang, S.-T., Okos, M., 1987. Kinetic study and mathematical modeling of methanogenesis of acetate using pure cultures of methanogens. Biotechnol. Bioeng. 30 (5), 661e667. Zhang, P., Chen, Y., Zhou, Q., Zheng, X., Zhu, X., Zhao, Y., 2010. Understanding short-chain fatty acids accumulation enhanced in waste activated sludge alkaline fermentation: kinetics and microbiology. Environ. Sci. Technol. 44 (24), 9343e9348. Zhang, Y., Lynd, L.R., 2003. Quantification of cell and cellulase mass concentrations during anaerobic cellulose fermentation: development of an enzyme-linked immunosorbent assaybased method with application to Clostridium thermocellum batch cultures. Anal. Chem. 75 (2), 219e227. Zhao, Y., Chen, Y., Zhang, D., Zhu, X., 2010. Waste activated sludge fermentation for hydrogen production enhanced by anaerobic process improvement and acetobacteria inhibition: the role of fermentation pH. Environ. Sci. Technol. 44 (9), 3317e3323.