GENE-40124; No. of pages: 7; 4C: Gene xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues Fatemeh Ahmadi Ghahrizjani a, Kamran Ghaedi b,c,⁎, Ahmad Salamian b, Somayeh Tanhaei b, Alireza Shoaraye Nejati b, Hossein Salehi d, Mohammad Nabiuni g, Hossein Baharvand e,f, Mohammad Hossein Nasr-Esfahani b,⁎ a
Biology Department, Science and Research Branch, Islamic Azad University, Tehran, Iran Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran d Department of Anatomical Sciences, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran e Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran f Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran g Cell and Molecular Biology Department, Faculty of Biological Sciences, Kharazmi University, Karaj, Iran b c
a r t i c l e
i n f o
Article history: Received 8 October 2014 Received in revised form 27 November 2014 Accepted 5 December 2014 Available online xxxx Keywords: FNDC5 Human embryonic stem cells Neural differentiation
a b s t r a c t Availability of human embryonic stem cells (hESCs) has enhanced the capability of basic and clinical research in the context of human neural differentiation. Derivation of neural progenitor (NP) cells from hESCs facilitates the process of human embryonic development through the generation of neuronal subtypes. We have recently indicated that fibronectin type III domain containing 5 protein (FNDC5) expression is required for appropriate neural differentiation of mouse embryonic stem cells (mESCs). Bioinformatics analyses have shown the presence of three isoforms for human FNDC5 mRNA. To differentiate which isoform of FNDC5 is involved in the process of human neural differentiation, we have used hESCs as an in vitro model for neural differentiation by retinoic acid (RA) induction. The hESC line, Royan H5, was differentiated into a neural lineage in defined adherent culture treated by RA and basic fibroblast growth factor (bFGF). We collected all cell types that included hESCs, rosette structures, and neural cells in an attempt to assess the expression of FNDC5 isoforms. There was a contiguous increase in all three FNDC5 isoforms during the neural differentiation process. Furthermore, the highest level of expression of the isoforms was significantly observed in neural cells compared to hESCs and the rosette structures known as neural precursor cells (NPCs). High expression levels of FNDC5 in human fetal brain and spinal cord tissues have suggested the involvement of this gene in neural tube development. Additional research is necessary to determine the major function of FDNC5 in this process. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Mouse fibronectin type III domain-containing 5 protein (FNDC5) cDNA, originally cloned by Ferrer-Martinez et al. and Teufel et al. in 2002, encodes a protein with 209 amino acid residues.
Abbreviations: bFGF, Basic fibroblast growth factor; BSA, Bovine serum albumin; DAPI, 4,6-Diamidino-2-phenylindole; FNDC5, Fibronectin type III domain containing 5 protein; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; hESCs, Human embryonic stem cells; mESCs, Mouse embryonic stem cells; NCBI, National Center for Biotechnology Information; NP, Neural progenitor; NPCs, Neural precursor cells; PBS, Phosphate buffered saline; PTS1, Peroxisomal targeting signal type1; PVDF, Polyvinylidenedifluoride; RA, Retinoic acid; SEM, Standard error of mean; SKI, Serine–lysine–isoleucine; HRP, Horseradish peroxidase; RT-PCR, Reverse transcription-polymerase chain reaction ⁎ Corresponding authors at: Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Postal Code 8165131378, Isfahan, Iran. E-mail addresses: [email protected] (K. Ghaedi), [email protected] (M.H. Nasr-Esfahani).
Amino acid analysis has shown the presence of two hydrophobic regions and a fibronectin type III domain in the structure of this protein. There are three peptides, serine–lysine–isoleucine (SKI) similar to peroxisomal targeting signal type1 (PTS1) at the C-terminus of FNDC5. Previously, it has been suggested that SKI directs this protein into the matrix of peroxisomes (Ferrer-Martinez et al., 2002; Ostadsharif et al., 2009, 2010) thereby suggesting that FNDC5 is a peroxisomal matrix protein (Tanhaie et al., 2009). However, recently it has been reported that when the N-terminal signal peptide of FNDC5 is removed, a glycosylated mature protein, known as Irisin, is proteolytically cleaved and released into the extracellular space. Irisin is synthesized under the regulation of PGC1-α and is secreted mainly from muscle into the blood which activates a thermogenic function in adipose tissues (Boström et al., 2012). Primary Northern blot analyses have revealed that FNDC5 is mainly expressed in the heart, skeletal muscle, and brain tissues (Ferrer-Martinez et al., 2002). Our previous data have shown that the expression of FNDC5 transcripts markedly increased after retinoic acid (RA) induction
http://dx.doi.org/10.1016/j.gene.2014.12.010 0378-1119/© 2014 Elsevier B.V. All rights reserved.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
2
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
during the neural differentiation of mouse embryonic stem cells (mESCs) in neural precursor cells (NPCs) and neurospheres (Ostadsharif et al., 2011). Knockdown expression of FNDC5 during the process of NPC formation caused a significant reduced expression of both neural progenitors (NPs) and mature neuronal markers which resulted in the reduction of both neuronal and astrocyte maturation (Hashemi et al., 2013). In humans, the role of FNDC5 in neural differentiation has yet to be determined. Therefore this study examined the expression profile of FNDC5 mRNA and its three predicted isoforms during the neural differentiation process in human embryonic stem cells (hESCs).
2. Materials and methods 2.1. Human embryonic stem cells (hESCs) culture and neural differentiation The hESC line, Royan H5, was used for in vitro production of neural differentiation (Baharvand et al., 2006). Cells were passaged and maintained under feeder-free conditions, then subjected to neural differentiation as previously described (Baharvand et al., 2007). The neural differentiation procedure, as outlined in Fig. 1A, is divided into five substages (steps 1–5). Briefly, hESCs were allowed to proliferate for six days in hESc medium that contained DMEM/F12 medium, 20% knock-
Fig. 1. Characterization of human embryonic stem cell (hESC)-derived cells during neural differentiation. Schematic illustration of the protocol of neural differentiation from hESCs (A). Phase contrast of cells selected to evaluate FNDC5 expression during neural differentiation (B). A colony of hESCs grown on extracellular matrix at day 6 (a); typical rosette-neural progenitors appeared after retinoic acid (RA) induction in the outer margin of the colony (b); maturing neural cells produced in neurobasal medium at day 12 after plating of neural tubes (c). Evaluation of expressions of stem cell specific markers, OCT4 and NANOG (C); Rosette-neural progenitor markers, PAX6 and SOX1 (D); and mature neural cell markers, TUJ1 and MAP2 (E). Relative expression of target genes normalized with GAPDH. Immunofluorescence staining of neural cells with antibodies against MAP2 and TUJ1 as mature neuron markers (F). Represented value bars are the mean of triplicate independent experiments ± SEM.*p b 0.05. Bar: 200 μm.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
out serum, 2 mM L-glutamine, 1% nonessential amino acids, 100 units/ml penicillin and 100 μg/ml streptomycin (Gibco, USA), 0.1 mM β-mercaptoethanol (Sigma-Aldrich, USA), and 100 ng/ml basic-fibroblast growth factor (bFGF, Sigma-Aldrich, USA). Undifferentiated hESCs that were treated with noggin (100 ng/ml, R&D, USA) and bFGF (40 ng/ml) in the presence of 20% KSR for four days (stage 1) subsequently differentiated into neural ectoderm by induction with RA (4 × 10−6 M; Sigma-Aldrich, USA), supplemented with 5% KSR in the absence of bFGF and noggin for six days (stage 2). Induced cells were grown in the same medium without RA for an additional six days to promote neuroectodermal islands with columnar cell (rosette) formation (stage 3). Then, we exposed the cells to 25 ng/ml bFGF for an extra six days after which we observed the appearance of neural tube-like structures (stage 4). These structures were manually isolated with a sterile pulled-glass pipette and plated on laminin (5 μg/ml; Sigma-Aldrich, USA) and poly L-ornithine- (15 μg/ml; Sigma-Aldrich, USA) coated dishes in neurobasal medium, supplemented with 1% N2 and 2% B27 (Gibco, USA) for up to 12 days until completion of neural formation (stage 5).
2.2. Immunocytochemistry analysis Differentiated cells cultivated on cover slips were washed with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde (Sigma-Aldrich, USA) in PBS for 30 min. Fixed cells were permeabilized by treatment with 0.2% Triton X-100 in PBS for 1 h. Primary antibodies were applied in blocking buffer [10% goat serum and 1 mg/ml bovine serum albumin (BSA; Sigma-Aldrich, USA) in PBS] for 1 h at 37 °C. Secondary antibodies were applied to cells for 2 h at room temperature, then washed twice with PBS, followed by the addition of 4,6-diamidino2-phenylindole (DAPI; Sigma-Aldrich, USA) for 3 min for nuclear counterstaining. Then, cells were observed under a fluorescence microscope (Olympus, BX51, Japan). In negative control samples, primary antibodies were omitted while the same staining procedure was followed. Primary antibodies were anti-mouse antibodies for MAP2 (1:60; Lifespan, USA) and anti-mouse antibody for TUJ1 (1:200; Sigma-Aldrich, USA). Secondary antibodies were FITC-conjugated goat anti-mouse IgG (1:50; Chemicon, USA) and TRITC-conjugated goat anti-mouse IgG (1:50; Sigma-Aldrich, USA).
2.3. Western blot analysis Cells were washed with PBS and lysed with TRI reagent (SigmaAldrich) according to the manufacturer's protocol. Extracted protein fractions of each sample (30 μg) were subjected to SDS-PAGE electrophoresis and transferred to a polyvinylidenedifluoride (PVDF; Biorad, USA) membrane. After an overnight blocking with 5% (w/v) non-fat dried milk (Merck, USA) in PBS, membranes were labeled with polyclonal rabbit anti-FNDC5 antibody-carboxy terminal end (Abcam, catalog No.: ab93373, final concentration 1:500) which was raised against 149–178 amino acids from the C-terminal region of human FNDC5 and monoclonal mouse anti-β-tubulin V antibody (Sigma-Aldrich, product No.: T5293, final concentration 1:2500). Membranes were subsequently treated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Dako, Japan) and goat anti-rabbit IgG (Santa Cruz Biotechnology, USA). The HRP-conjugated IgG bound to each protein band was visualized by an Amersham ECL Advance Western Blotting Detection Kit (GE Healthcare, Germany). 2.4. Embryonic tissue preparation For RNA isolation we used different tissue sections obtained from a five-month-old male embryo aborted due to a polycystic renal abnormality that was donated by his parents for the purpose of research to the Forensic Medicine Department.
3
2.5. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time quantitative PCR (RT-qPCR) Total RNA was extracted based on the TRI reagent protocol and treated with DNaseI (Fermentas, Lithuania). cDNA synthesis was performed with 2 μg of total RNA, MMLV reverse transcriptase (Fermentas, Lithuania) and a random hexamer primer. Since isoform 2 of FNDC5 was not distinguishable from isoform 1 by standard RT-qPCR, a conventional RT-PCR approach was chosen. For assessment the expression of other FNDC5 isoforms, isoforms 1 and 3, and total expression of the FNDC5, RT-qPCR was carried out with SYBR green (TaKaRa, Japan) in a Thermal Cycler Rotor-Gene 6000 (Corbett, Australia) according to the manufacturer's protocol, which used 5 μl SYBR premix ExTaq II (TaKaRa, Japan), 0.2 nM of each primer, and 25 ng cDNA in a final volume of 10 μl. Expressions of target genes were normalized to glyceraldehyde 3phosphate dehydrogenase (GAPDH) gene expression level. All measurements were performed in triplicate and we analyzed data by the ΔΔCt method. Primer pairs (Table 1) for target genes were designed by Beacon Designer software (Version 7.2, USA). Meanwhile, convectional RT-PCR was carried out for estimating the expression level of isoform 2 of FNDC5. PCR products were electrophoresed in 1% agarose gel containing ethidium bromide and bands were visualized with light (Uvidoc, UK). Finally, to analyze semi-quantitative expression of different mRNAs, the amount of cDNA was normalized based on the expression of GAPDH using Gene Tools software (Version 3.06, UK). 2.6. Statistical analysis We used SPSS (version 16, USA) for data analysis and obtained the mean ± standard error of mean (SEM) from different groups of data. Comparisons between groups were analyzed by the independent t-test and one way ANOVA, which were considered to be significant at p b 0.05. 3. Results 3.1. Evaluation of neural marker expression during neural differentiation from human embryonic stem cells (hESCs) We sought to determine whether the expression pattern of FNDC5 gene during human neural differentiation was similar to the mouse FNDC5 (Ostadsharif et al., 2011). Therefore, we differentiated hESCs by using a well-defined protocol for neural differentiation (Baharvand et al., 2007) as shown in Fig. 1A. Analysis of FNDC5 expression during neural differentiation was performed at three points during this process in hESCs, rosette structures, and neural cells. Fig. 1B shows the morphology of the aforementioned cells. We observed the colonies of feederfree adhesive hESCs which are composed of compact cells with a high ratio of nucleus to cytoplasm volume and clear boundaries (Fig. 1Ba). Reduction in KSR to 5% and RA induction resulted in the formation of several rosette structures around the middle of the colonies after 16 days (Fig. 1Bb). Neural tubes, plated in neurobasal medium supplemented with N2 and B27, produced mature neurons after 12 days (Fig. 1Bc). We performed RNA and protein extraction of the collected cells that included hESCs, rosettes, and neural cells to assess the expression of FNDC5 isoforms, stem cells and neural differentiation markers by RT-qPCR and Western blot analysis. Undifferentiated state of hESCs, the Royan H5 cell line, was confirmed by the presence of a high expression level of OCT-4 and NANOG. We observed high expressions of neural precursor cell markers (NPCs; SOX1 and PAX6) in rosette cells compared with hESCs (Fig. 1D). Production of neural cells was confirmed by the detection of a high expression level of mature neuron markers (MAP2 and TUJ1) in neural cells relative to rosettes and hESCs (Fig. 1E). To confirm the data obtained by RT-qPCR, we performed immunocytochemistry analysis of the neural markers (MAP2 and TUJ1) as seen in Fig. 1F.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
4
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Table 1 Primers used for gene expression analysis. Genes
Forward primer (5′-3′)
Reverse primer (5′-3′)
Annealing temperature (°C)
Product length
A) Primers for RT-qPCR Isoform 1 of FNDC5 Isoform 3 of FNDC5 FNDC5⁎ OCT4 NANOG PAX6 NESTIN SOX1 MAP2 TUJ1 GAPDH
CAGCACACCAGAGCACCAG CATCGTCGTGGTCCTGTTC AAGGGCAGATGTCAGCAATAC TCTATTTGGGAAGGTATTCAGC CAGCTACAAACAGGTGAAGAC TTGCTGGAGGATGATGAC TTCCCTCCGCATCCCGTCAG CCTCCGTCCATCCTCTG CGCTCAGACACCCTTCAG AAGCCAGCAGTGTCTAAACCC CCACTCCTCCACCTTTGACG
GCAGTCCAGGGATTACCAGAG AGTTGTCCCTCTCCCTGTG TCAGCAGGGATGGAAGTCA ATTGTTGTCAGCTTCCTCCA TGGTGGTAGGAAGAGTAAAGG CTATGCTGATTGGTGATGG GCCGTCACCTCCATTAGC AAAGCATCAAACAACCTCAAG CACAACAGACTCAATCACTCC GGGAGGACGAGGCCATAAATAC CCACCACCCTGTTGCTGTAG
60 60 60 60 60 60 60 60 60 60 60
109 157 90 124 147 120 186 201 105 111 107
CAAGGAGATGGAGGGAAGAGATG
60
181
B. Primers for semiquantitative RT-PCR Isoform 2 of⁎⁎ FNDC5 CAGCACACCAGAGCACCAG
⁎ This primer pair was used to amplify three isoforms of FNDC5 simultaneously. ⁎⁎ This primer pair co-amplified a fragment of FNDC5 isoform 1 (545 bp) simultaneously.
Quantitative real-time PCR and immunocytochemistry analysis confirmed neural differentiation. 3.2. Expression analysis of FNDC5 isoforms during neural differentiation Considering information obtained from the National Center for Biotechnology Information (NCBI), three isoforms were proposed for FNDC5 mRNA that differed in numbers of exons and nucleotide sequences. A schematic illustration outlining the chromosomal position of the FNDC5 gene with its expanded isoforms is shown in Fig. 2. In
order to address whether all FNDC5 isoforms were expressed in hESCs during neural differentiation, we designed real time PCR-specific primers based on the nucleotide differences between the three isoforms, which were applied to analyze mRNA expression by RT-qPCR (Table 1). To analyze the expression level of isoform 2 and to discriminate it from isoform 1, we designed a primer pair to identify isoform 2 for conventional RT-PCR. However this primer pair co-amplified 181 bp fragment of isoform 2 and 545 bp fragment of isoform 1 simultaneously (Fig. 3D). The expression levels of the FNDC5 isoforms were monitored relative to the GAPDH expression level as a housekeeping
Fig. 2. Schematic illustrations of the FNDC5 gene structure (exons and introns) and derived isoforms. The differences between exon positions are shown.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
5
Fig. 3. RT-qPCR and semi-quantitative RT-PCR analysis of the expression of FNDC5 isoforms. (A, B) RT-qPCR analysis for isoforms 1 and 3. Relative gene expression analysis of FNDC5 isoforms was assessed during neural differentiation. (C and D) Semi-quantitative RT-PCR for isoform 2. An amplified product (181 bp) of isoform 2 is indicated by arrowhead. Also, co-amplified product of isoform 1 (545 bp) is indicated in the same gel by star. M: is 100 bp DNA ladder (Thermo Scientific, USA). (E) Schematic illustration of difference between the expressions of different isoforms of FNDC5 during neural differentiation. Relative expressions were normalized with GAPDH. Samples were from triplicate independent experiments. Value bars are mean ± SEM. (*p b 0.05).
gene for all experiments. Semi-quantitative RT-PCR results for FNDC5 isoform 2 (Fig. 3C) and real-time PCR for FNDC5 isoforms 1 and 3 (Fig. 3A, B) showed a gradual increase in mRNA expression levels for all FNDC5 isoforms. The highest expression level of three isoforms was observed in neural cells compared with hESCs and rosette structures, known as neural precursor cells (NPCs), which was significant (p ≤ 0.05). Thus, the highest expression level of all three FNDC5 isoforms was observed during neural cell formation (Fig. 3E). We estimated
overall expression of FNDC5 which showed a similar expression pattern of the respective isoforms (Fig. 4). 3.3. Detection of FNDC5 protein in neural cell lysates Western blot analysis was performed to provide additional evidence for the highest expression of FNDC5 in neural cells. A faint band was detected in neural cell lysates that had the same mobility of the respective
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
6
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Fig. 4. RT-qPCR quantification of FNDC5 gene expression. Relative gene expression analysis of the FNDC5 was assessed by RT-qPCR during neural differentiation from hESCs. Relative expression of FNDC5 quantified by real-time PCR and normalized with GAPDH in triplicate independent experiments. Value bars are mean ± SEM. (*p b 0.05).
band in muscle lysate cells, which was dissimilar to the amounts of protein in rosettes and hESCs, both of which had less than detectable levels (Supplementary figure). This observation confirmed the real time data that FNDC5 sequentially increased during neural differentiation and attained its highest level in neural cells. 3.4. Expression level analysis of FNDC5 in different embryonic tissues Due to the high expression level of FNDC5 in neural cells, we analyzed various sections from the embryonic nervous system. Of note, we detected increased FNDC5 expression in neural tissues that included the forebrain, hindbrain, myelencephalon, midbrain myelencephalon and cervical spinal compared to the heart, lungs and spleen (Fig. 5). In addition, the expression level of FNDC5 was elevated in muscle tissue as well as neural tissues, which was consistent with a previous report (Mantzoros et al., 2012). 4. Discussion Ferrer-Martinez cloned mouse FNDC5 in 2002 and showed that this gene primarily expressed in adult animal tissues such as the heart, skeletal muscle, and brain. Recently, Irisin, the secretory type of FNDC5 was identified by Spiegelman and his colleagues. They have showed that Irisin acts as a myokine responsible for browning of white adipose tissue (Boström et al., 2012). Specific role of FNDC5 in energy outflow and differentiation of muscle and cardiac cells has been broadly investigated (Rabiee et al., 2014; Ellefsen et al., 2014; Aydin et al., 2014). Teufel
et al. (2002) have indicated that during embryonic development FNDC5 is primarily expressed in the brain suggesting a possible function for this gene. This protein is also expressed in Cerebellar purkinje cells of rodents (Dun et al., 2013). Our previous study provided evidence that FNDC5 expression sharply increased with RA treatment during the process of neural differentiation from mESCs (Ostadsharif et al., 2011). Therefore it seems that due to energy dependency of brain, FNDC5 serves as a critical factor in brain activities (Wrann et al., 2013). Our group has shown that FNDC5 involves in neural specification of mESCs (Hashemi et al., 2013; Seifi et al., 2014). In the present study we analyzed the expression level of FNDC5 in hESCs. Of note, our results differed from those observed for mouse neural differentiation, in which the majority of FNDC5 expression was detected during NPC formation. Recent studies by our colleagues revealed a possible function of the FNDC5 in neural differentiation of mESCs as knockdown of the FNDC5 suppressed the rate of neural differentiation and significantly emphasized involvement of FNDC5 expression in mouse neural differentiation (Hashemi et al., 2013). Concomitant to our previous studies that explored the importance of FNDC5 in the process of human neurogenesis, the expression pattern of different isoforms of FNDC5 mRNA was analyzed during neural differentiation. Our data revealed that the expression of all isoforms of FNDC5 increased prominently during neural differentiation. Similar to the mRNA expression pattern, protein estimation indicated higher amounts of protein in neural cells which implied an increase in FNDC5 expression in neural tissues. Consistently higher amounts of FNDC5 mRNA in embryonic nervous tissues in comparison with other fetal tissues have suggested that FNDC5 could be a functional protein in nervous systems which remains to be elucidated. In this regard, recent studies have indicated that neurogenesis in hippocampus is controlled by Irisin (Moon et al., 2013). Of importance, the expression level of FNDC5 is elevated by exercise as Irisin secretion from hippocampal neurons is detectable during exercise (Wrann et al., 2013). Thus, we hypothesize that FNDC5 could serve as a neurogenic factor especially in hippocampus. How FNDC5 influences neurons and its endurance remains to be evaluated. This promotes a new hope for further applications of FNDC5 in the improvement of brain performances. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.12.010. Author contributions Fatemeh Ahmadi Ghahrizjani: Collection and/or data assembly, data analysis and interpretation, manuscript writing. Ahmad Salamian: Collection and/or data assembly, data analysis and interpretation. Kamran Ghaedi: Conception and design, financial support, data analysis and interpretation, manuscript writing, and final approval of manuscript. Somayeh Tanhaei: Data analysis and interpretation. Mohammad Nabiooni: Conception and design, data analysis and interpretation. Mohammad Hossein Nasr-Esfahani: Conception and design, data analysis and interpretation, and final approval of manuscript. Hossein Baharvand: Conception and design, data analysis and interpretation, manuscript writing, and final approval of manuscript. Ethical approval statement Approval for this study, particularly for the use of human embryonic tissues, was obtained from the Institutional Review Board of Royan Institute (Tehran, Iran). Conflict of interest
Fig. 5. Relative expression levels of FNDC5 gene by RT-qPCR in different embryonic tissues. Expression data were normalized with the level of GAPDH expression.
None of the authors has any conflicts of interest to disclose and all authors support submission to this journal.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Acknowledgment This study was funded by a grant-in-aid research (Grant No: 920007) from the Royan Institute awarded to Kamran Ghaedi, Ph.D. as principal investigator. References Aydin, S., Kuloglu, T., Aydin, S., Eren, M.N., Celik, A., Yilmaz, M., Kalayci, M., Sahin, İ., Gungor, O., Gurel, A., Ogeturk, M., Dabak, O., 2014. Cardiac, skeletal muscle and serum irisin responses to with or without water exercise in young and old male rats: cardiac muscle produces more irisin than skeletal muscle. Peptides 52, 68–73. Baharvand, H., Ashtiani, S.K., Taee, A., Massumi, M., Valojerdi, M.R., Yazdi, P.E., Moradi, S.Z., Farrokhi, A., 2006. Generation of new human embryonic stem cell lines with diploid and triploid karyotypes. Dev. Growth Differ. 48, 117–128. Baharvand, H., Mehrjardi, N.Z., Hatami, M., Kiani, S., Rao, M., Haghighi, M.M., 2007. Neural differentiation from human embryonic stem cells in a defined adherent culture condition. Dev. Biol. 51, 371–378. Boström, P., Wu, J., Jedrychowski, M.P., Korde, A., Ye, L., Lo, J.C., Rasbach, K.A., Boström, E.A., Choi, J.H., Long, J.Z., Kajimura, S., Zingaretti, M.C., Vind, B.F., Tu, H., Cinti, S., Højlund, K., Gygi, S.P., Spiegelman, B.M., 2012. A PGC1-α-dependent myokine that drives brownfat-like development of white fat and thermogenesis. Nature 481, 463–468. Dun, S.L., Lyu, R.M., Chen, Y.H., Chang, J.K., Luo, J.J., Dun, N.J., 2013. Irisin-immunoreactivity in neural and non-neural cells of the rodent. Neuroscience 240, 155–162. Ellefsen, S., Vikmoen, O., Slettaløkken, G., Whist, J.E., Nygaard, H., Hollan, I., Rauk, I., Vegge, G., Strand, T.A., Raastad, T., Rønnestad, B.R., 2014. Irisin and FNDC5: effects of 12-week strength training, and relations to muscle phenotype and body mass composition in untrained women. Eur. J. Appl. Physiol. 114 (9), 1875–1888. Ferrer-Martinez, A., Ruiz-Lozano, P., Chien, K.R., 2002. Mouse PeP: a novel peroxisomal protein linked to myoblast differentiation and development. Dev. Dyn. 224, 154–167. Hashemi, M.S., Ghaedi, K., Salamian, A., Karbalaie, K., Emadi-Baygi, M., Tanhaei, S., Nasr-Esfahani, M.H., Baharvand, H., 2013. FNDC5 knockdown significantly decreased neural differentiation rate of mouse embryonic stem cells. Neuroscience 231, 296–304.
7
Mantzoros, C.S., Huh, Y.J., Panagiotou, G., Mougios, V., Brinkoetter, M., Vamvinia, M.T., Schneider, B.E., 2012. FNDC5 and irisin in humans: I. Predictors of circulating concentrations in serum and plasma and II. mRNA expression and circulating concentrations in response to weight loss and exercise. Metabolism 61 (12), 1725–1738. Moon, H.S., Dincer, F., Mantzoros, C.S., 2013. Pharmacological concentrations of irisin increase cell proliferation without influencing markers of neurite outgrowth and synaptogenesis in mouse H19-7 hippocampal cell lines. Metabolism 62, 1131–1136. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Parivar, K., Tanhaie, S., Karbalaie, K., Baharvand, H., 2009. Cytosolic localization of mouse peroxisomal protein/ΔSKI fused with enhanced green fluorescent protein into Chinese hamster ovary-K1 and P19 cells. Yakhteh Med. J. 11, 154–159. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Tanhaie, S., Karbalaie, K., Baharvand, H., 2010. Sorting analysis of mouse peroxisomal protein by in vitro studies. Iran. J. Biothechnol. 8, 186–192. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Mojbafan, M., Tanhaie, S., Karbalaie, K., Baharvand, H., 2011. The expression of peroxisomal protein transcripts increased by retinoic acid during neural differentiation. Differentiation 81, 127–132. Rabiee, F., Forouzanfar, M., Ghazvini Zadegan, F., Tanhaei, S., Ghaedi, K., Motovali Bashi, M., Baharvand, H., Nasr-Esfahani, M.H., 2014. Induced expression of Fndc5 significantly increased cardiomyocyte differentiation rate of mouse embryonic stem cells. Gene 551 (2), 127–137. Seifi, T., Ghaedi, K., Tanhaei, S., Karamali, F., Kiani-Esfahani, A., Peymani, M., Peymani, M., Baharvand, H., Nasr-Esfahani, M.H., 2014. Identification, cloning, and functional analysis of the TATA-less mouse FNDC5 promoter during neural differentiation. Cell. Mol. Neurobiol. 34 (5), 715–725. Tanhaie, S., Ghaedi, K., Karbalaii, K., Razavi, S., Ostadsharif, M., Nazari-Jahantigh, M., Rabeei, F., Nematollahi, M., Baharvand, H., Nasr Esfahani, M.H., 2009. Mouse peroxisomal protein cDNA cloning and characterization of its intracellular localization. Yakhteh Med. J. 11, 196–203. Teufel, A., Malik, N., Mukhopadhyay, M., Westphal, H., 2002. Frcp1 and Frcp2, two novel fibronectin type III repeat containing genes. Gene 224, 79–83. Wrann, C.D., White, J.P., Salogiannnis, J., Laznik-Bogoslavski, D., Wu, J., Ma, D., Lin, J.D., Greenberg, M.E., Spiegelman, B.M., 2013. Exercise induces hippocampal BDNF through a PGC-1α/FNDC5 pathway. Cell Metab. 18 (5), 649–659.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues Fatemeh Ahmadi Ghahrizjani a, Kamran Ghaedi b,c,⁎, Ahmad Salamian b, Somayeh Tanhaei b, Alireza Shoaraye Nejati b, Hossein Salehi d, Mohammad Nabiuni g, Hossein Baharvand e,f, Mohammad Hossein Nasr-Esfahani b,⁎ a
Biology Department, Science and Research Branch, Islamic Azad University, Tehran, Iran Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Isfahan, Iran Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran d Department of Anatomical Sciences, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran e Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran f Department of Developmental Biology, University of Science and Culture, ACECR, Tehran, Iran g Cell and Molecular Biology Department, Faculty of Biological Sciences, Kharazmi University, Karaj, Iran b c
a r t i c l e
i n f o
Article history: Received 8 October 2014 Received in revised form 27 November 2014 Accepted 5 December 2014 Available online xxxx Keywords: FNDC5 Human embryonic stem cells Neural differentiation
a b s t r a c t Availability of human embryonic stem cells (hESCs) has enhanced the capability of basic and clinical research in the context of human neural differentiation. Derivation of neural progenitor (NP) cells from hESCs facilitates the process of human embryonic development through the generation of neuronal subtypes. We have recently indicated that fibronectin type III domain containing 5 protein (FNDC5) expression is required for appropriate neural differentiation of mouse embryonic stem cells (mESCs). Bioinformatics analyses have shown the presence of three isoforms for human FNDC5 mRNA. To differentiate which isoform of FNDC5 is involved in the process of human neural differentiation, we have used hESCs as an in vitro model for neural differentiation by retinoic acid (RA) induction. The hESC line, Royan H5, was differentiated into a neural lineage in defined adherent culture treated by RA and basic fibroblast growth factor (bFGF). We collected all cell types that included hESCs, rosette structures, and neural cells in an attempt to assess the expression of FNDC5 isoforms. There was a contiguous increase in all three FNDC5 isoforms during the neural differentiation process. Furthermore, the highest level of expression of the isoforms was significantly observed in neural cells compared to hESCs and the rosette structures known as neural precursor cells (NPCs). High expression levels of FNDC5 in human fetal brain and spinal cord tissues have suggested the involvement of this gene in neural tube development. Additional research is necessary to determine the major function of FDNC5 in this process. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Mouse fibronectin type III domain-containing 5 protein (FNDC5) cDNA, originally cloned by Ferrer-Martinez et al. and Teufel et al. in 2002, encodes a protein with 209 amino acid residues.
Abbreviations: bFGF, Basic fibroblast growth factor; BSA, Bovine serum albumin; DAPI, 4,6-Diamidino-2-phenylindole; FNDC5, Fibronectin type III domain containing 5 protein; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; hESCs, Human embryonic stem cells; mESCs, Mouse embryonic stem cells; NCBI, National Center for Biotechnology Information; NP, Neural progenitor; NPCs, Neural precursor cells; PBS, Phosphate buffered saline; PTS1, Peroxisomal targeting signal type1; PVDF, Polyvinylidenedifluoride; RA, Retinoic acid; SEM, Standard error of mean; SKI, Serine–lysine–isoleucine; HRP, Horseradish peroxidase; RT-PCR, Reverse transcription-polymerase chain reaction ⁎ Corresponding authors at: Department of Cellular Biotechnology at Cell Science Research Center, Royan Institute for Biotechnology, ACECR, Postal Code 8165131378, Isfahan, Iran. E-mail addresses: [email protected] (K. Ghaedi), [email protected] (M.H. Nasr-Esfahani).
Amino acid analysis has shown the presence of two hydrophobic regions and a fibronectin type III domain in the structure of this protein. There are three peptides, serine–lysine–isoleucine (SKI) similar to peroxisomal targeting signal type1 (PTS1) at the C-terminus of FNDC5. Previously, it has been suggested that SKI directs this protein into the matrix of peroxisomes (Ferrer-Martinez et al., 2002; Ostadsharif et al., 2009, 2010) thereby suggesting that FNDC5 is a peroxisomal matrix protein (Tanhaie et al., 2009). However, recently it has been reported that when the N-terminal signal peptide of FNDC5 is removed, a glycosylated mature protein, known as Irisin, is proteolytically cleaved and released into the extracellular space. Irisin is synthesized under the regulation of PGC1-α and is secreted mainly from muscle into the blood which activates a thermogenic function in adipose tissues (Boström et al., 2012). Primary Northern blot analyses have revealed that FNDC5 is mainly expressed in the heart, skeletal muscle, and brain tissues (Ferrer-Martinez et al., 2002). Our previous data have shown that the expression of FNDC5 transcripts markedly increased after retinoic acid (RA) induction
http://dx.doi.org/10.1016/j.gene.2014.12.010 0378-1119/© 2014 Elsevier B.V. All rights reserved.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
2
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
during the neural differentiation of mouse embryonic stem cells (mESCs) in neural precursor cells (NPCs) and neurospheres (Ostadsharif et al., 2011). Knockdown expression of FNDC5 during the process of NPC formation caused a significant reduced expression of both neural progenitors (NPs) and mature neuronal markers which resulted in the reduction of both neuronal and astrocyte maturation (Hashemi et al., 2013). In humans, the role of FNDC5 in neural differentiation has yet to be determined. Therefore this study examined the expression profile of FNDC5 mRNA and its three predicted isoforms during the neural differentiation process in human embryonic stem cells (hESCs).
2. Materials and methods 2.1. Human embryonic stem cells (hESCs) culture and neural differentiation The hESC line, Royan H5, was used for in vitro production of neural differentiation (Baharvand et al., 2006). Cells were passaged and maintained under feeder-free conditions, then subjected to neural differentiation as previously described (Baharvand et al., 2007). The neural differentiation procedure, as outlined in Fig. 1A, is divided into five substages (steps 1–5). Briefly, hESCs were allowed to proliferate for six days in hESc medium that contained DMEM/F12 medium, 20% knock-
Fig. 1. Characterization of human embryonic stem cell (hESC)-derived cells during neural differentiation. Schematic illustration of the protocol of neural differentiation from hESCs (A). Phase contrast of cells selected to evaluate FNDC5 expression during neural differentiation (B). A colony of hESCs grown on extracellular matrix at day 6 (a); typical rosette-neural progenitors appeared after retinoic acid (RA) induction in the outer margin of the colony (b); maturing neural cells produced in neurobasal medium at day 12 after plating of neural tubes (c). Evaluation of expressions of stem cell specific markers, OCT4 and NANOG (C); Rosette-neural progenitor markers, PAX6 and SOX1 (D); and mature neural cell markers, TUJ1 and MAP2 (E). Relative expression of target genes normalized with GAPDH. Immunofluorescence staining of neural cells with antibodies against MAP2 and TUJ1 as mature neuron markers (F). Represented value bars are the mean of triplicate independent experiments ± SEM.*p b 0.05. Bar: 200 μm.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
out serum, 2 mM L-glutamine, 1% nonessential amino acids, 100 units/ml penicillin and 100 μg/ml streptomycin (Gibco, USA), 0.1 mM β-mercaptoethanol (Sigma-Aldrich, USA), and 100 ng/ml basic-fibroblast growth factor (bFGF, Sigma-Aldrich, USA). Undifferentiated hESCs that were treated with noggin (100 ng/ml, R&D, USA) and bFGF (40 ng/ml) in the presence of 20% KSR for four days (stage 1) subsequently differentiated into neural ectoderm by induction with RA (4 × 10−6 M; Sigma-Aldrich, USA), supplemented with 5% KSR in the absence of bFGF and noggin for six days (stage 2). Induced cells were grown in the same medium without RA for an additional six days to promote neuroectodermal islands with columnar cell (rosette) formation (stage 3). Then, we exposed the cells to 25 ng/ml bFGF for an extra six days after which we observed the appearance of neural tube-like structures (stage 4). These structures were manually isolated with a sterile pulled-glass pipette and plated on laminin (5 μg/ml; Sigma-Aldrich, USA) and poly L-ornithine- (15 μg/ml; Sigma-Aldrich, USA) coated dishes in neurobasal medium, supplemented with 1% N2 and 2% B27 (Gibco, USA) for up to 12 days until completion of neural formation (stage 5).
2.2. Immunocytochemistry analysis Differentiated cells cultivated on cover slips were washed with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde (Sigma-Aldrich, USA) in PBS for 30 min. Fixed cells were permeabilized by treatment with 0.2% Triton X-100 in PBS for 1 h. Primary antibodies were applied in blocking buffer [10% goat serum and 1 mg/ml bovine serum albumin (BSA; Sigma-Aldrich, USA) in PBS] for 1 h at 37 °C. Secondary antibodies were applied to cells for 2 h at room temperature, then washed twice with PBS, followed by the addition of 4,6-diamidino2-phenylindole (DAPI; Sigma-Aldrich, USA) for 3 min for nuclear counterstaining. Then, cells were observed under a fluorescence microscope (Olympus, BX51, Japan). In negative control samples, primary antibodies were omitted while the same staining procedure was followed. Primary antibodies were anti-mouse antibodies for MAP2 (1:60; Lifespan, USA) and anti-mouse antibody for TUJ1 (1:200; Sigma-Aldrich, USA). Secondary antibodies were FITC-conjugated goat anti-mouse IgG (1:50; Chemicon, USA) and TRITC-conjugated goat anti-mouse IgG (1:50; Sigma-Aldrich, USA).
2.3. Western blot analysis Cells were washed with PBS and lysed with TRI reagent (SigmaAldrich) according to the manufacturer's protocol. Extracted protein fractions of each sample (30 μg) were subjected to SDS-PAGE electrophoresis and transferred to a polyvinylidenedifluoride (PVDF; Biorad, USA) membrane. After an overnight blocking with 5% (w/v) non-fat dried milk (Merck, USA) in PBS, membranes were labeled with polyclonal rabbit anti-FNDC5 antibody-carboxy terminal end (Abcam, catalog No.: ab93373, final concentration 1:500) which was raised against 149–178 amino acids from the C-terminal region of human FNDC5 and monoclonal mouse anti-β-tubulin V antibody (Sigma-Aldrich, product No.: T5293, final concentration 1:2500). Membranes were subsequently treated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Dako, Japan) and goat anti-rabbit IgG (Santa Cruz Biotechnology, USA). The HRP-conjugated IgG bound to each protein band was visualized by an Amersham ECL Advance Western Blotting Detection Kit (GE Healthcare, Germany). 2.4. Embryonic tissue preparation For RNA isolation we used different tissue sections obtained from a five-month-old male embryo aborted due to a polycystic renal abnormality that was donated by his parents for the purpose of research to the Forensic Medicine Department.
3
2.5. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time quantitative PCR (RT-qPCR) Total RNA was extracted based on the TRI reagent protocol and treated with DNaseI (Fermentas, Lithuania). cDNA synthesis was performed with 2 μg of total RNA, MMLV reverse transcriptase (Fermentas, Lithuania) and a random hexamer primer. Since isoform 2 of FNDC5 was not distinguishable from isoform 1 by standard RT-qPCR, a conventional RT-PCR approach was chosen. For assessment the expression of other FNDC5 isoforms, isoforms 1 and 3, and total expression of the FNDC5, RT-qPCR was carried out with SYBR green (TaKaRa, Japan) in a Thermal Cycler Rotor-Gene 6000 (Corbett, Australia) according to the manufacturer's protocol, which used 5 μl SYBR premix ExTaq II (TaKaRa, Japan), 0.2 nM of each primer, and 25 ng cDNA in a final volume of 10 μl. Expressions of target genes were normalized to glyceraldehyde 3phosphate dehydrogenase (GAPDH) gene expression level. All measurements were performed in triplicate and we analyzed data by the ΔΔCt method. Primer pairs (Table 1) for target genes were designed by Beacon Designer software (Version 7.2, USA). Meanwhile, convectional RT-PCR was carried out for estimating the expression level of isoform 2 of FNDC5. PCR products were electrophoresed in 1% agarose gel containing ethidium bromide and bands were visualized with light (Uvidoc, UK). Finally, to analyze semi-quantitative expression of different mRNAs, the amount of cDNA was normalized based on the expression of GAPDH using Gene Tools software (Version 3.06, UK). 2.6. Statistical analysis We used SPSS (version 16, USA) for data analysis and obtained the mean ± standard error of mean (SEM) from different groups of data. Comparisons between groups were analyzed by the independent t-test and one way ANOVA, which were considered to be significant at p b 0.05. 3. Results 3.1. Evaluation of neural marker expression during neural differentiation from human embryonic stem cells (hESCs) We sought to determine whether the expression pattern of FNDC5 gene during human neural differentiation was similar to the mouse FNDC5 (Ostadsharif et al., 2011). Therefore, we differentiated hESCs by using a well-defined protocol for neural differentiation (Baharvand et al., 2007) as shown in Fig. 1A. Analysis of FNDC5 expression during neural differentiation was performed at three points during this process in hESCs, rosette structures, and neural cells. Fig. 1B shows the morphology of the aforementioned cells. We observed the colonies of feederfree adhesive hESCs which are composed of compact cells with a high ratio of nucleus to cytoplasm volume and clear boundaries (Fig. 1Ba). Reduction in KSR to 5% and RA induction resulted in the formation of several rosette structures around the middle of the colonies after 16 days (Fig. 1Bb). Neural tubes, plated in neurobasal medium supplemented with N2 and B27, produced mature neurons after 12 days (Fig. 1Bc). We performed RNA and protein extraction of the collected cells that included hESCs, rosettes, and neural cells to assess the expression of FNDC5 isoforms, stem cells and neural differentiation markers by RT-qPCR and Western blot analysis. Undifferentiated state of hESCs, the Royan H5 cell line, was confirmed by the presence of a high expression level of OCT-4 and NANOG. We observed high expressions of neural precursor cell markers (NPCs; SOX1 and PAX6) in rosette cells compared with hESCs (Fig. 1D). Production of neural cells was confirmed by the detection of a high expression level of mature neuron markers (MAP2 and TUJ1) in neural cells relative to rosettes and hESCs (Fig. 1E). To confirm the data obtained by RT-qPCR, we performed immunocytochemistry analysis of the neural markers (MAP2 and TUJ1) as seen in Fig. 1F.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
4
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Table 1 Primers used for gene expression analysis. Genes
Forward primer (5′-3′)
Reverse primer (5′-3′)
Annealing temperature (°C)
Product length
A) Primers for RT-qPCR Isoform 1 of FNDC5 Isoform 3 of FNDC5 FNDC5⁎ OCT4 NANOG PAX6 NESTIN SOX1 MAP2 TUJ1 GAPDH
CAGCACACCAGAGCACCAG CATCGTCGTGGTCCTGTTC AAGGGCAGATGTCAGCAATAC TCTATTTGGGAAGGTATTCAGC CAGCTACAAACAGGTGAAGAC TTGCTGGAGGATGATGAC TTCCCTCCGCATCCCGTCAG CCTCCGTCCATCCTCTG CGCTCAGACACCCTTCAG AAGCCAGCAGTGTCTAAACCC CCACTCCTCCACCTTTGACG
GCAGTCCAGGGATTACCAGAG AGTTGTCCCTCTCCCTGTG TCAGCAGGGATGGAAGTCA ATTGTTGTCAGCTTCCTCCA TGGTGGTAGGAAGAGTAAAGG CTATGCTGATTGGTGATGG GCCGTCACCTCCATTAGC AAAGCATCAAACAACCTCAAG CACAACAGACTCAATCACTCC GGGAGGACGAGGCCATAAATAC CCACCACCCTGTTGCTGTAG
60 60 60 60 60 60 60 60 60 60 60
109 157 90 124 147 120 186 201 105 111 107
CAAGGAGATGGAGGGAAGAGATG
60
181
B. Primers for semiquantitative RT-PCR Isoform 2 of⁎⁎ FNDC5 CAGCACACCAGAGCACCAG
⁎ This primer pair was used to amplify three isoforms of FNDC5 simultaneously. ⁎⁎ This primer pair co-amplified a fragment of FNDC5 isoform 1 (545 bp) simultaneously.
Quantitative real-time PCR and immunocytochemistry analysis confirmed neural differentiation. 3.2. Expression analysis of FNDC5 isoforms during neural differentiation Considering information obtained from the National Center for Biotechnology Information (NCBI), three isoforms were proposed for FNDC5 mRNA that differed in numbers of exons and nucleotide sequences. A schematic illustration outlining the chromosomal position of the FNDC5 gene with its expanded isoforms is shown in Fig. 2. In
order to address whether all FNDC5 isoforms were expressed in hESCs during neural differentiation, we designed real time PCR-specific primers based on the nucleotide differences between the three isoforms, which were applied to analyze mRNA expression by RT-qPCR (Table 1). To analyze the expression level of isoform 2 and to discriminate it from isoform 1, we designed a primer pair to identify isoform 2 for conventional RT-PCR. However this primer pair co-amplified 181 bp fragment of isoform 2 and 545 bp fragment of isoform 1 simultaneously (Fig. 3D). The expression levels of the FNDC5 isoforms were monitored relative to the GAPDH expression level as a housekeeping
Fig. 2. Schematic illustrations of the FNDC5 gene structure (exons and introns) and derived isoforms. The differences between exon positions are shown.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
5
Fig. 3. RT-qPCR and semi-quantitative RT-PCR analysis of the expression of FNDC5 isoforms. (A, B) RT-qPCR analysis for isoforms 1 and 3. Relative gene expression analysis of FNDC5 isoforms was assessed during neural differentiation. (C and D) Semi-quantitative RT-PCR for isoform 2. An amplified product (181 bp) of isoform 2 is indicated by arrowhead. Also, co-amplified product of isoform 1 (545 bp) is indicated in the same gel by star. M: is 100 bp DNA ladder (Thermo Scientific, USA). (E) Schematic illustration of difference between the expressions of different isoforms of FNDC5 during neural differentiation. Relative expressions were normalized with GAPDH. Samples were from triplicate independent experiments. Value bars are mean ± SEM. (*p b 0.05).
gene for all experiments. Semi-quantitative RT-PCR results for FNDC5 isoform 2 (Fig. 3C) and real-time PCR for FNDC5 isoforms 1 and 3 (Fig. 3A, B) showed a gradual increase in mRNA expression levels for all FNDC5 isoforms. The highest expression level of three isoforms was observed in neural cells compared with hESCs and rosette structures, known as neural precursor cells (NPCs), which was significant (p ≤ 0.05). Thus, the highest expression level of all three FNDC5 isoforms was observed during neural cell formation (Fig. 3E). We estimated
overall expression of FNDC5 which showed a similar expression pattern of the respective isoforms (Fig. 4). 3.3. Detection of FNDC5 protein in neural cell lysates Western blot analysis was performed to provide additional evidence for the highest expression of FNDC5 in neural cells. A faint band was detected in neural cell lysates that had the same mobility of the respective
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
6
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Fig. 4. RT-qPCR quantification of FNDC5 gene expression. Relative gene expression analysis of the FNDC5 was assessed by RT-qPCR during neural differentiation from hESCs. Relative expression of FNDC5 quantified by real-time PCR and normalized with GAPDH in triplicate independent experiments. Value bars are mean ± SEM. (*p b 0.05).
band in muscle lysate cells, which was dissimilar to the amounts of protein in rosettes and hESCs, both of which had less than detectable levels (Supplementary figure). This observation confirmed the real time data that FNDC5 sequentially increased during neural differentiation and attained its highest level in neural cells. 3.4. Expression level analysis of FNDC5 in different embryonic tissues Due to the high expression level of FNDC5 in neural cells, we analyzed various sections from the embryonic nervous system. Of note, we detected increased FNDC5 expression in neural tissues that included the forebrain, hindbrain, myelencephalon, midbrain myelencephalon and cervical spinal compared to the heart, lungs and spleen (Fig. 5). In addition, the expression level of FNDC5 was elevated in muscle tissue as well as neural tissues, which was consistent with a previous report (Mantzoros et al., 2012). 4. Discussion Ferrer-Martinez cloned mouse FNDC5 in 2002 and showed that this gene primarily expressed in adult animal tissues such as the heart, skeletal muscle, and brain. Recently, Irisin, the secretory type of FNDC5 was identified by Spiegelman and his colleagues. They have showed that Irisin acts as a myokine responsible for browning of white adipose tissue (Boström et al., 2012). Specific role of FNDC5 in energy outflow and differentiation of muscle and cardiac cells has been broadly investigated (Rabiee et al., 2014; Ellefsen et al., 2014; Aydin et al., 2014). Teufel
et al. (2002) have indicated that during embryonic development FNDC5 is primarily expressed in the brain suggesting a possible function for this gene. This protein is also expressed in Cerebellar purkinje cells of rodents (Dun et al., 2013). Our previous study provided evidence that FNDC5 expression sharply increased with RA treatment during the process of neural differentiation from mESCs (Ostadsharif et al., 2011). Therefore it seems that due to energy dependency of brain, FNDC5 serves as a critical factor in brain activities (Wrann et al., 2013). Our group has shown that FNDC5 involves in neural specification of mESCs (Hashemi et al., 2013; Seifi et al., 2014). In the present study we analyzed the expression level of FNDC5 in hESCs. Of note, our results differed from those observed for mouse neural differentiation, in which the majority of FNDC5 expression was detected during NPC formation. Recent studies by our colleagues revealed a possible function of the FNDC5 in neural differentiation of mESCs as knockdown of the FNDC5 suppressed the rate of neural differentiation and significantly emphasized involvement of FNDC5 expression in mouse neural differentiation (Hashemi et al., 2013). Concomitant to our previous studies that explored the importance of FNDC5 in the process of human neurogenesis, the expression pattern of different isoforms of FNDC5 mRNA was analyzed during neural differentiation. Our data revealed that the expression of all isoforms of FNDC5 increased prominently during neural differentiation. Similar to the mRNA expression pattern, protein estimation indicated higher amounts of protein in neural cells which implied an increase in FNDC5 expression in neural tissues. Consistently higher amounts of FNDC5 mRNA in embryonic nervous tissues in comparison with other fetal tissues have suggested that FNDC5 could be a functional protein in nervous systems which remains to be elucidated. In this regard, recent studies have indicated that neurogenesis in hippocampus is controlled by Irisin (Moon et al., 2013). Of importance, the expression level of FNDC5 is elevated by exercise as Irisin secretion from hippocampal neurons is detectable during exercise (Wrann et al., 2013). Thus, we hypothesize that FNDC5 could serve as a neurogenic factor especially in hippocampus. How FNDC5 influences neurons and its endurance remains to be evaluated. This promotes a new hope for further applications of FNDC5 in the improvement of brain performances. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.12.010. Author contributions Fatemeh Ahmadi Ghahrizjani: Collection and/or data assembly, data analysis and interpretation, manuscript writing. Ahmad Salamian: Collection and/or data assembly, data analysis and interpretation. Kamran Ghaedi: Conception and design, financial support, data analysis and interpretation, manuscript writing, and final approval of manuscript. Somayeh Tanhaei: Data analysis and interpretation. Mohammad Nabiooni: Conception and design, data analysis and interpretation. Mohammad Hossein Nasr-Esfahani: Conception and design, data analysis and interpretation, and final approval of manuscript. Hossein Baharvand: Conception and design, data analysis and interpretation, manuscript writing, and final approval of manuscript. Ethical approval statement Approval for this study, particularly for the use of human embryonic tissues, was obtained from the Institutional Review Board of Royan Institute (Tehran, Iran). Conflict of interest
Fig. 5. Relative expression levels of FNDC5 gene by RT-qPCR in different embryonic tissues. Expression data were normalized with the level of GAPDH expression.
None of the authors has any conflicts of interest to disclose and all authors support submission to this journal.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
F. Ahmadi Ghahrizjani et al. / Gene xxx (2014) xxx–xxx
Acknowledgment This study was funded by a grant-in-aid research (Grant No: 920007) from the Royan Institute awarded to Kamran Ghaedi, Ph.D. as principal investigator. References Aydin, S., Kuloglu, T., Aydin, S., Eren, M.N., Celik, A., Yilmaz, M., Kalayci, M., Sahin, İ., Gungor, O., Gurel, A., Ogeturk, M., Dabak, O., 2014. Cardiac, skeletal muscle and serum irisin responses to with or without water exercise in young and old male rats: cardiac muscle produces more irisin than skeletal muscle. Peptides 52, 68–73. Baharvand, H., Ashtiani, S.K., Taee, A., Massumi, M., Valojerdi, M.R., Yazdi, P.E., Moradi, S.Z., Farrokhi, A., 2006. Generation of new human embryonic stem cell lines with diploid and triploid karyotypes. Dev. Growth Differ. 48, 117–128. Baharvand, H., Mehrjardi, N.Z., Hatami, M., Kiani, S., Rao, M., Haghighi, M.M., 2007. Neural differentiation from human embryonic stem cells in a defined adherent culture condition. Dev. Biol. 51, 371–378. Boström, P., Wu, J., Jedrychowski, M.P., Korde, A., Ye, L., Lo, J.C., Rasbach, K.A., Boström, E.A., Choi, J.H., Long, J.Z., Kajimura, S., Zingaretti, M.C., Vind, B.F., Tu, H., Cinti, S., Højlund, K., Gygi, S.P., Spiegelman, B.M., 2012. A PGC1-α-dependent myokine that drives brownfat-like development of white fat and thermogenesis. Nature 481, 463–468. Dun, S.L., Lyu, R.M., Chen, Y.H., Chang, J.K., Luo, J.J., Dun, N.J., 2013. Irisin-immunoreactivity in neural and non-neural cells of the rodent. Neuroscience 240, 155–162. Ellefsen, S., Vikmoen, O., Slettaløkken, G., Whist, J.E., Nygaard, H., Hollan, I., Rauk, I., Vegge, G., Strand, T.A., Raastad, T., Rønnestad, B.R., 2014. Irisin and FNDC5: effects of 12-week strength training, and relations to muscle phenotype and body mass composition in untrained women. Eur. J. Appl. Physiol. 114 (9), 1875–1888. Ferrer-Martinez, A., Ruiz-Lozano, P., Chien, K.R., 2002. Mouse PeP: a novel peroxisomal protein linked to myoblast differentiation and development. Dev. Dyn. 224, 154–167. Hashemi, M.S., Ghaedi, K., Salamian, A., Karbalaie, K., Emadi-Baygi, M., Tanhaei, S., Nasr-Esfahani, M.H., Baharvand, H., 2013. FNDC5 knockdown significantly decreased neural differentiation rate of mouse embryonic stem cells. Neuroscience 231, 296–304.
7
Mantzoros, C.S., Huh, Y.J., Panagiotou, G., Mougios, V., Brinkoetter, M., Vamvinia, M.T., Schneider, B.E., 2012. FNDC5 and irisin in humans: I. Predictors of circulating concentrations in serum and plasma and II. mRNA expression and circulating concentrations in response to weight loss and exercise. Metabolism 61 (12), 1725–1738. Moon, H.S., Dincer, F., Mantzoros, C.S., 2013. Pharmacological concentrations of irisin increase cell proliferation without influencing markers of neurite outgrowth and synaptogenesis in mouse H19-7 hippocampal cell lines. Metabolism 62, 1131–1136. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Parivar, K., Tanhaie, S., Karbalaie, K., Baharvand, H., 2009. Cytosolic localization of mouse peroxisomal protein/ΔSKI fused with enhanced green fluorescent protein into Chinese hamster ovary-K1 and P19 cells. Yakhteh Med. J. 11, 154–159. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Tanhaie, S., Karbalaie, K., Baharvand, H., 2010. Sorting analysis of mouse peroxisomal protein by in vitro studies. Iran. J. Biothechnol. 8, 186–192. Ostadsharif, M., Ghaedi, K., Nasr-Esfahani, M.H., Mojbafan, M., Tanhaie, S., Karbalaie, K., Baharvand, H., 2011. The expression of peroxisomal protein transcripts increased by retinoic acid during neural differentiation. Differentiation 81, 127–132. Rabiee, F., Forouzanfar, M., Ghazvini Zadegan, F., Tanhaei, S., Ghaedi, K., Motovali Bashi, M., Baharvand, H., Nasr-Esfahani, M.H., 2014. Induced expression of Fndc5 significantly increased cardiomyocyte differentiation rate of mouse embryonic stem cells. Gene 551 (2), 127–137. Seifi, T., Ghaedi, K., Tanhaei, S., Karamali, F., Kiani-Esfahani, A., Peymani, M., Peymani, M., Baharvand, H., Nasr-Esfahani, M.H., 2014. Identification, cloning, and functional analysis of the TATA-less mouse FNDC5 promoter during neural differentiation. Cell. Mol. Neurobiol. 34 (5), 715–725. Tanhaie, S., Ghaedi, K., Karbalaii, K., Razavi, S., Ostadsharif, M., Nazari-Jahantigh, M., Rabeei, F., Nematollahi, M., Baharvand, H., Nasr Esfahani, M.H., 2009. Mouse peroxisomal protein cDNA cloning and characterization of its intracellular localization. Yakhteh Med. J. 11, 196–203. Teufel, A., Malik, N., Mukhopadhyay, M., Westphal, H., 2002. Frcp1 and Frcp2, two novel fibronectin type III repeat containing genes. Gene 224, 79–83. Wrann, C.D., White, J.P., Salogiannnis, J., Laznik-Bogoslavski, D., Wu, J., Ma, D., Lin, J.D., Greenberg, M.E., Spiegelman, B.M., 2013. Exercise induces hippocampal BDNF through a PGC-1α/FNDC5 pathway. Cell Metab. 18 (5), 649–659.
Please cite this article as: Ahmadi Ghahrizjani, F., et al., Enhanced expression of FNDC5 in human embryonic stem cell-derived neural cells along with relevant embryonic neural tissues, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.12.010
