Original Papers
Enhancement of Doxorubicin Cytotoxicity by Tanshinone IIA in HepG2 Human Hepatoma Cells
Authors
Shidong Kan, Wan Man Cheung, Yanling Zhou, Wing Shing Ho
Affiliation
School of Life Science, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong
Key words " chemoprotection l " chlorogenic acid l " salvianolic acid B l " tanshinone IIA l " doxorubicin l " cytotoxicity l
Abstract !
Chlorogenic acid (1), salvianolic acid B (2), and tanshinone IIA (3) are commonly used as chemoprotective agents for chemotherapy in cancer patients. The present study deals with the effect of these three compounds on cytotoxicity of doxorubicin in HepG2 cells. The results showed that 1 and 2 reduced the cytotoxicity of doxorubicin
Introduction !
received revised accepted
June 3, 2013 Sept. 10, 2013 Nov. 6, 2013
Bibliography DOI http://dx.doi.org/ 10.1055/s-0033-1360126 Planta Med 2014; 80: 70–76 © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0032‑0943 Correspondence Wing Shing Ho School of Life Science The Chinese University of Hong Kong MMW 612 Shatin, New Territories 852-011 Hong Kong Phone: + 85 2 39 43 61 14 Fax: + 85 2 26 03 77 32 [email protected]
Doxorubicin also known as adriamycin is a widely used anticancer drug for the treatment of hematologic malignancies and solid cancer [1, 2]. However, the clinical use of doxorubicin is limited by its serious adverse cardiac effects that result in cardiomyopathy and heart failure. Increased free radical production and a reduced level of myocardial antioxidants are believed to be associated with the cardiotoxicity of doxorubicin [3, 4]. It was reported that doxorubicin caused progressive chronic cardiotoxicity resulting in heart failure within one year of treatment [5]. Therefore, the development of a strategy for therapy with doxorubicin is warranted to reduce its cardiotoxicity. Chemoprotective agents are good candidates for clinical use with doxorubicin. They can be used to attenuate the cardiotoxicity of antitumor drugs. " Fig. 1) is a naturally occurChlorogenic acid (1, l ring active phenolic compound found in many foods and botanical drugs. Due to its easy accessibility in the human diet, numerous studies have been conducted to investigate its biological functions, including antioxidant, antihypertensive, antibacterial, anti-inflammatory, antifungal, antivirus, and anticarcinogenic activities [6–9]. Salvia miltiorrhiza, also known as Danshen, is commonly used in traditional Chinese medicine (TCM) for the treatment of heart disease, cerebro-
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
through scavenging ROS generated by doxorubicin in HepG2 cells. The findings suggest that 1 and 2 could enhance the expression of SOD and decrease that of NADPH oxidase, which resulted in the elimination of ROS. On the contrary, 3 enhanced the cytotoxicity of doxorubicin in HepG2 cells. Furthermore, drug interactions between doxorubicin and 3 produce synergistic effects in HepG2 cells.
vascular disease, hepatitis, hepatocirrhosis, and cancer [10–12]. Some of the active phytochemicals can be isolated and purified from water-soluble and lipid-soluble fractions from S. miltiorrhi" Fig. 1) and tanshinone za. Salvianolic acid B (2, l " IIA (3, l Fig. 1) were considered the quality elements for S. miltiorrhiza. It was reported that 2 has multi-arrays of pharmacological effects on the liver, can reduce atherosclerosis and low-density lipoprotein and is a potential chemopreventive agent for head and neck squamous cell cancer [13–16]. Previous studies reported that 3 exhibits cardiovascular activity, including vasorelaxation, and cardioprotective effects, as well as antitumor activity in many kinds of cancer including drugresistant cancer cells [17–20]. Compounds 1, 2, and 3 are used as chemoprotective agents for cancer therapy with doxorubicin. In this paper, their effects on doxorubicin cytotoxicity were studied.
Results and Discussion ! " Fig. 2 shows the effects of 1, 2, and 3 on the cyl totoxic activity of doxorubicin in HepG2 cells. The cytotoxic activity of doxorubicin was attenuated by 1 and 2, which significantly improved the viability of HepG2 cells. At 1120 µM and 560 µM, the viability of HepG2 cells after treatment with a mixture of doxorubicin and 1 or 2 was increased to 89.2 % and 91.2 %, respectively. However, the cy-
Downloaded by: University of Connecticut. Copyrighted material.
70
Fig. 1
Chemical structures of compounds 1, 2, and 3.
totoxic activity of doxorubicin was enhanced by 3. When the concentration of 3 reached 17.0 µM, the viability of HepG2 cells remained at 4.8 % compared with the control. The results show that the cytotoxic activity of the combination of doxorubicin and 3 reached the maximal level. Lactate dehydrogenase (LDH) leakage, which is a marker of ne" Fig. 3 shows that HepG2 crotic cellular death, was measured. l cells after treatment with doxorubicin resulted in leakage of LDH. Compound 3 increased this leakage. However, 1 or 2 caused a decrease of the cytotoxic effects of doxorubicin and resulted in a decrease of LDH leakage compared to the doxorubicin-treated cancer cells. A recent study reported that caspase 3 played a central role as an " Fig. 4 shows that doxorubicin-treateffector of apoptosis [21]. l ed cells markedly increased the activity of caspase 3 compared with the control. On the contrary, 1 or 2 decreased caspase 3. However, the combination of 3 and doxorubicin significantly enhanced the caspase 3 activity leading to apoptosis of HepG2 cells.
As the concentration of 3 increased, the activity of caspase 3 increased gradually and reached the maximal level at 8.5 µM. " Figs. 2–4 show that 3 enhanced the activity of caspase 3 in l HepG2 cells resulting in cell death. However, 1 and 2 decreased the activity of caspase 3 resulting in the enhanced viability of the HepG2 cells. The antioxidative activity of 1, 2, and 3 was measured using DPPH, a stable free radical [22]. DPPH assay shows that the scavenging activity of 1 and 2 was concentration-dependent and reached a maximal level at a concentration of 560 µM and 28 µM, respectively. The IC50 values of 1 and 2 were 88.9 µM and 7.7 µM, respectively. However, the scavenging activity of 3 was lower than that of 1 and 2 and could not be determined even at the highest concentration (1700 µM). The level of ROS is believed to be associated with the cytotoxic properties of doxorubicin in the HepG2 cell line. " Fig. 5 shows that doxorubicin significantly increased the level l of ROS in the HepG2 cell line, which was reduced by 1 and 2. As the concentration increased, the amount of ROS was attenuated " Figs. 2 and 5 show that ROS reduced the cytotoxic by 1 or 2. l properties of doxorubicin. It was reported that 3 induced apoptosis and inhibited the proliferation and migration of cancer cells [23–25]. The present findings provide supportive evidences on the pharmacological activity of 3. It is believed that the excess amount of ROS generation in tumor cells causes cardiac toxicity [3]. Polyphenol compounds such as 1 and 2 could protect the heart through suppression of oxidative stress [26, 27]. However, 3 could attenuate the cardiac toxicity of doxorubicin through interactions with this drug. The combination of doxorubicin and 3 did not affect the level of ROS in cells [18, 19] and had no adverse impacts on the cytotoxic activity of doxorubicin. " Fig. 6 shows the gene expression of HepG2 cells after treatment l with 1, 2, and doxorubicin. After incubation with doxorubicin, NADPH oxidase 4 was increased 25-fold compared to untreated cells, while 1 and 2 decreased the NADPH oxidase 4 activity. The extent of reduction in activity was dose-dependent. At the concentrations of 560 µM (1) and 280 µM (2), the NADPH oxidase 4 expression decreased to 2.8- and 2.9-fold compared to untreated cells. After 6 h incubation, the SOD1 expression in doxorubicintreated cells was decreased to only 7.5 % of untreated cells. How-
Fig. 2 Effect of compounds 1, 2, and 3 on the cytotoxic activity of doxorubicin using the MTT assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Combinations of 1, 2, or 3 with doxorubicin (4.8 µM) were added to the assay. A, 1 (28 µM), 2 (14 µM), 3 (1.1 µM); B, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); C, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); D, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); E, 1 (560 µM), 2 (280 µM), 3 (17.0 µM); and F, 1 (1120 µM), 2 (560 µM), 3 (34.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
71
Downloaded by: University of Connecticut. Copyrighted material.
Original Papers
Original Papers
Fig. 3 Effects of doxorubicin and compounds 1, 2, and 3 on LDH leakage in HepG2 cells using the LDH assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2, or 3 with doxorubicin (4.8 µM) were added. A, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); B, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); C, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); and D, 1 (560 µM), 2 (280 µM), 3 (17.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Fig. 4 Effect of doxorubicin and compounds 1, 2, and 3 on caspase 3 expression in HepG2 cells using the caspase 3 assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2, or 3 with doxorubicin (4.8 µM) were added. A, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); B, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); C, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); and D, 1 (560 µM), 2 (280 µM), 3 (17.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Fig. 5 Effects of doxorubicin and compounds 1, 2, and 3 on ROS formation in HepG2 cells using the ROS assay. Control: medium only. Doxorubicin concentration was kept at 10 µM. Different concentrations of 1, 2, or 3 with doxorubicin (10 µM) were added. A, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); B, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); C, 1 (560 µM), 2 (280 µM), 3 (17.0 µM); and D, 1 (1120 µM), 2 (560 µM), 3 (34.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
ever, 1 and 2 can enhance the expression of SOD1 up to 66.5 % and 177.5 % compared to untreated cells at the concentrations of 560 µM (1) and 280 µM (2), respectively. NADPH oxidase is the key enzyme involved in ROS formation in doxorubicin-treated cells [28]. However, ROS could be eliminated
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
by SOD [29], resulting in the enhancement of cell viability. Compound 1 and 2 can enhance the activity of SOD in HepG2 cells and decrease the activity of NADPH oxidase, which results in HepG2 cell viability.
Downloaded by: University of Connecticut. Copyrighted material.
72
Original Papers
73
Table 1 Combination effects of doxorubicin and compound 3 at different concentrations. Drug concentration (µM)
Doxorubicin (IP, %) 3 (IP, %) Mix (IP, %) CI
1
2
3
4
5
10
20
50
100
18.6 ± 3.2 15.1 ± 3.3 55.0 ± 4.6 0.90
22.3 ± 1.9 19.5 ± 3.1 60.5 ± 4.3 0.89
28.9 ± 3.9 23.3 ± 6.7 70.1 ± 2.7 0.72
40.5 ± 3.5 29.9 ± 7.1 72.9 ± 3.5 0.72
54.6 ± 3.9 33.8 ± 3.3 75.0 ± 1.6 0.54
80.0 ± 2.9 58.0 ± 2.0 89.7 ± 1.0 0.40
80.2 ± 4.6 78.6 ± 3.4 94.8 ± 1.5 0.32
84.7 ± 2.7 82.5 ± 3.3 94.6 ± 0.9 0.63
85.9 ± 2.9 82.4 ± 3.7 94.8 ± 0.4 0.99
IP, inhibition percentage (%) of HepG2 cells compared to control; Mix, mixture of doxorubicin (4 µM) and different concentrations of 3; CI, combination index. Means ± SD, n = 6
Drug combination is widely used in treating cancer. The Chou-Talalay method was the procedure commonly employed to assess the combination effect of two drugs [30–31]. The combination of doxorubicin and 3 was assessed by combination index (CI). A CI value < 1 was considered to indicate synergism, CI value = 1 addi" Table 1 shows the syntive effect, and CI value > 1 antagonism. l ergistic effects of the combination of doxorubicin and 3 in the HepG2 cell line. The results show that the combination of doxorubicin (4 µM) and 3 exhibited a synergistic effect on cancer cells and suggest that this combination would improve the cytotoxicity of doxorubicin with less cardiotoxicity. Compounds 1 and 2, however, could influence the cytotoxic activity of doxorubicin because of their scavenging activity towards ROS in cancer cells [26, 27, 32]. The results suggest that the combination of 3 and doxorubicin could produce health benefits for cancer patients. Although 1 can also produce health benefits, it might cause harmful effects on cancer patients when administered with doxorubicin for chemotherapy. S. miltiorrhiza is a popular TCM used for treatment of cardiovascular disease and heart disease in China [33]. However, the administration of its aqueous extract
may attenuate the cytotoxicity of doxorubicin as well. It is therefore necessary to choose a suitable cardioprotective agent for chemotherapy with doxorubicin. The use of 1, 2, and other antioxidants such as vitamin C and E could result in the decrease of cytotoxicity of doxorubicin. At the concentrations of 200 and 400 µM of vitamin C, the activity of doxorubicin could be decreased 18.5 % and 30.8% compared to doxorubicin treatment alone in HepG2 cells. These values could increase to 38.2 % and 62.1 % for vitamin E. Although vitamin C and E can enhance the SOD activity [34, 35], their use may result in a decrease of doxorubicin cytotoxicity due to the enhancement of SOD activity in HepG2 cells. Phenolic compounds are widely distributed in plants and in many botanical drugs and healthy food. It is reported that the major mechanism of action of cancer drugs is via ROS generation [36, 37]. Besides 1 and 2, some other phenolic compounds could have a similar attenuating effect on ROS. It is therefore important to make a suitable choice of food and chemoprotective agents to be used along with cancer therapy.
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
Downloaded by: University of Connecticut. Copyrighted material.
Fig. 6 Expressions of NADPH oxidase 4 and SOD1 after compounds 1 and 2, and doxorubicin treatment in HepG2 cells. A NADPH oxidase 4 expression compared to control. B SOD1 expression compared to control. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2 with doxorubicin (4.8 µM) were added. 1 (L), 1 (56 µM). 1 (M), (280 µM). 1 (H), (560 µM). 2 (L), (28 µM). 2 (M), (140 µM). 2 (H), (280 µM). Means ± SD, n = 3; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Original Papers
Materials and Methods
acids, streptomycin (100 mg/mL), and penicillin (100 mg/mL). The cells were passaged at a split ratio of 1 : 3 every 2–3 days.
!
Plant materials and extraction procedures Lonicera japonica Thunb (batch No. 04082010) and S. miltiorrhiza (batch No. 02 052 012) were purchased from Kam Hing Hong Co. and identified by Dr. Shuguang Wang [Department of TCM, Shanghai Institute of Pharmaceutical Industry (SIPI), Shanghai, PRC]. The plant specimens (SIPI-12-008-JYH and SIPI-12-009DS) were deposited in the hebarium of SIPI. Compound 2 (purity over 99%) was prepared according to the previous method described [38]. Compounds 1 and 3 (purity over 98 %) were purified through the chromatography of microsphere resin NM100 (donated by SIPI). Firstly, 1 L of microsphere resin was washed with distilled water prior to filling the glass column (diameter 6 cm). The flowers of L. japonica (500 g) were ground into powder prior to soaking with 5 L of 95 % ethanol and stirring for 2 h. The mixture was filtered and concentrated by rotary evaporator at 45 °C to dryness. The residue was dissolved in 500 mL and adjusted to pH 6.5 before placing onto the column at 1 L/h. Distilled water was used to elute the column, and the effluent was collected by fraction. The elution of 1 (> 98 % purity) was collected and freeze-dried to powder. The dried roots of S. miltiorrhiza (500 g) in 4 L 80 % ethanol were decocted at 70 °C for 1 h prior to filtration. The filtrate was concentrated by rotary evaporator at 45 °C to dryness. The residue was dissolved in 500 mL 70% ethanol prior to placing it onto the column at 1 L/h. 90 % ethanol was used to elute the column, and the effluent with 3 (> 70 % purity) was collected. The fraction was pooled and crystallized with acetone and water (v : v = 3 : 1). The crystal of compound 3, with purity over 98 %, was collected and dried prior to use.
Reagents NaOH, ethanol, hydrochloride acid, and phosphoric acid were obtained from Sigma-Aldrich. HPLC grade acetonitrile was purchased from Tedia. All aqueous solutions were prepared using double distilled water. Doxorubicin (purity 98–102 %), vitamin C (purity 99%), and vitamin E (purity 95.5 %) were purchased from Sigma-Aldrich. Reference compounds of 1, 2, and 3 (purity over 98%) were purchased from Tauto Biotech Co. Ltd.
HPLC analysis The extraction and purification of 1, 2, and 3 were analyzed by the Agilent HP 1100 system with an autosampler and DAD detector. The liquid chromatography was performed on a reversedphase column (Zorbax 300SB‑C18, 4.6 × 250 mm, 5 µm; Agilent). The flow rate was at 0.8 mL/min. The column temperature was set at 20 °C. The mobile phase for 1 was composed of 0.5 % phosphoric acid and acetonitrile (87 : 13, v : v), and the detection wavelength was set at 327 nm. The mobile phase for 2 was composed of 0.5 % phosphoric acid and acetonitrile (70 : 30, v : v), and the wave length was set at 286 nm. The mobile phase for 3 was composed of water and acetonitrile (25 : 75, v : v), and the wavelength was set at 270 nm.
Cell line and culture Cultures of human hepatoma cell line HepG2 were obtained from ATCC and grown on Eagleʼs minimum essential medium (EMEM; GIBCO). It was supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 2 mM L-glutamine, MEM nonessential amino
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
Cell treatment and MTT assay HepG2 cells were seeded in 96-well plates at a concentration of 3 × 103 cells in 0.1 mL EMEM/well and incubated for 24 h at 37 °C under 5 % CO2. The cells were incubated for 24 h with doxorubicin (4.8 µM) alone and with different concentrations of compounds 1 (28–1120 µM), 2 (14–560 µM), and 3 (1.1–34.0 µM) with doxorubicin (4.8 µM). Cells were incubated with the fresh medium as the control. The medium was replaced with 100 µL fresh medium prior to the addition of 20 µL of MTT (5 mg/mL in PBS) per well after incubation. The plate was incubated for 2 h at 37 °C in a humidified 5% CO2 atmosphere. At the end of the incubation period, the medium was removed and 100 µL DMSO was added to each well. The plate was gently shaken to solubilize the purple-colored formazans. The MTT assay was performed on the microtiter plate reader according to the manufacturerʼs protocols (Spectramax 190; Molecular Devices).
LDH assay Following incubation, the media were analyzed for the LDH activity using an LDH cytotoxicity assay kit (Promega). Briefly, after 24 h of drug treatment, 50 µL of supernate from each well was transferred to a fresh 96-well plate prior to the addition of 50 µL of the substrate for 30 min. Subsequently, 50 µL of stop solution was added and the absorbance at 490 nm was examined by a microtiter plate reader (Spectramax 190; Molecular Devices). The results are expressed as the mean absorbance normalized to the percentage of the control value.
Caspase 3 assay The activity of the caspase 3 was determined using the assay kit from Promega. Briefly, after 10 h drug treatment, the medium was replaced by caspase 3 reagent and incubated for 3 h at room temperature. The fluorescence was recorded using a fluorescence microplate reader (TECAN infinite M200) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
DPPH (1,1-diphenyl-2-picrylhydrazyl radical 2,2-diphenyl-1-(2,4,6-trinitrophenyl)hydrazyl) radical scavenging assay The antioxidative ability of 1, 2, and 3 was measured using DPPH. The reaction mixture contained 10 µL of DPPH (1 mM in ethanol), 89.6 µL of ethanol (99%), and 0.4 µL of 1, 2, and 3 (in DMSO). The reaction mixture was kept in the dark for 30 min. The decrease in the absorption at 517 nm was measured. The scavenging activity was calculated and expressed as IC50, which is defined as the concentration of 1 (or 2 and 3) required for inhibition of half the DPPH radical.
ROS assay ROS in the cell line was measured according to the manufacturerʼs protocols using the ROS assay kit from Invitrogen. The dye chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM‑H2DCFDA), which is oxidized to fluorescent 2′,7′-dichlorofluorescin (CM‑DCF) by hydroperoxides, was used to measure the relative level of cellular peroxides. HepG2 cells were incubated with 10 mM dye at 37 °C for 1 h and washed with PB. Subsequently, 100 µL of fresh medium was added, incubated for 30 min with different concentrations of the compounds and incubated for another hour. The drug was removed and washed twice
Downloaded by: University of Connecticut. Copyrighted material.
74
with PBS. The fluorescence was measured using a fluorescence microplate reader (Tecan infinite M200) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
Quantitative real-time PCR RNA was extracted from the treated HepG2 cells with the RNeasy mini kit (Qiagen). The treating time for NADPH oxidase 4 and SOD1 was 12 h and 6 h, respectively. First strand cDNA was synthesized by PCR using a PrimeScript RT Master Mix (Takara). The expression level of NADPH oxidase 4 and SOD1 was measured using RT2 Realtime SYBR Green/ROX PCR Master Mix (SA Biosciences) with NADPH oxidase 4 and SOD1 primer (NADPH oxidase 4: 5′-GGAACACGACAATCAGCCTT‑3′ and 5′-TGGAAACCAAAGAGACCCTG‑3′. SOD1: 5′-CTGAAGGCCTGCATGGATTC‑3′ and 5′CCAAGTCTCCAACATGCCTCTC − 3′). A G3PDH primer (5′-ACCACAGTCCATGCCATCAC‑3′ and 5′-TCCACCCTGTTGCTGTA‑3′) was used as an endogenous control [39]. The real-time PCR was done in triplicate. The HotStart DNA polymerase was first activated at 95 °C for 10 min for 40 cycles, including denaturation at 95 °C for 15 s and annealing for 1 min. The data was analyzed using the 2–ΔΔCt method.
Combination effects of doxorubicin and 3 on the HepG2 Cell line Different concentrations of doxorubicin and 3 were added to the cell culture and incubated for 24 h at 37 °C under 5 % CO2 prior to the MTT assay. The combination effects of the two compounds were calculated as the CI value [30–31].
Statistical analysis Data represent means ± SD of at least three separate experiments (p < 0.05).
Acknowledgements !
This work was supported by grant No. 6903088 from Keenway Industries Ltd.
Conflict of Interest !
The authors declare that there are no conflicts of interest.
References 1 Schlumberger M, Parmentier C, Delisle MJ, Couette JE, Droz JP, Sarrazin D. Combination therapy for anaplastic giant cell thyroid carcinoma. Cancer 1991; 67: 564–566 2 Duggan ST, Keating GM. Pegylated liposomal doxorubicin: a review of its use in metastatic breast cancer, ovarian cancer, multiple myeloma and AIDS-related Kaposiʼs sarcoma. Drugs 2011; 71: 2531–2558 3 Singal PK, Li T, Kumar D, Danelisen I, Iliskovic N. Adriamycin-induced heart failure: mechanism and modulation. Mol Cell Biochem 2000; 207: 77–86 4 Barry E, Alvarez JA, Scully RE, Miller TL, Lipshultz SE. Anthracycline-induced cardiotoxicity: course, pathophysiology, prevention and management. Expert Opin Pharmacother 2007; 8: 1039–1058 5 Von Hoff DD, Layard MW, Basa P, Davis jr. HL, Von Hoff AL, Rozencweig M, Muggia FM. Risk factors for doxorubicin-induced congestive heart failure. Ann Intern Med 1979; 91: 710–717 6 Bahadir O, Citoglu GS, Coban T. Antioxidant activity of some Scorzonera species and quantitative analysis of chlorogenic acid. Planta Med 2010; 76: 1227
7 Zhao Y, Wang J, Ballevre O, Luo H, Zhang W. Antihypertensive effects and mechanisms of chlorogenic acids. Hypertens Res 2012; 35: 370– 374 8 Wu WB, Hung DK, Chang FW, Ong ET, Chen BH. Anti-inflammatory and anti-angiogenic effects of flavonoids isolated from Lycium barbarum Linnaeus on human umbilical vein endothelial cells. Food Funct 2012; 3: 1068–1081 9 Ozcelik B, Kartal M, Orhan I. Cytotoxicity, antiviral and antimicrobial activities of alkaloids, flavonoids, and phenolic acids. Pharm Biol 2011; 49: 396–402 10 Lu Y, Foo LY. Polyphenolics of Salvia–a review. Phytochemistry 2002; 59: 117–140 11 Che XH, Park EJ, Zhao YZ, Kim WH, Sohn DH. Tanshinone II A induces apoptosis and S phase cell cycle arrest in activated rat hepatic stellate cells. Basic Clin Pharmacol Toxicol 2010; 106: 30–37 12 Zhang Y, Wei RX, Zhu XB, Cai L, Jin W, Hu H. Tanshinone IIA induces apoptosis and inhibits the proliferation, migration, and invasion of the osteosarcoma MG‑63 cell line in vitro. Anticancer Drug 2012; 23: 212–219 13 Lay IS, Chiu JH, Shiao MS, Lu WY, Wu CW. Crude extract of Salvia miltiorrhiza and salvianolic acid B enhance in vitro angiogenesis in murine SVR endothelial cell line. Planta Med 2003; 69: 26–32 14 Zhao Y, Hao Y, Ji H, Fang Y, Guo Y, Sha W, Zhou Y, Pang X, Southerland WM, Califano JA, Gu X. Combination effects of salvianolic acid B with low-dose celecoxib on inhibition of head and neck squamous cell carcinoma growth in vitro and in vivo. Cancer Prev Res 2010; 3: 787–796 15 Wang R, Yu XY, Guo ZY, Wang YJ, Wu Y, Yuan YF. Inhibitory effects of salvianolic acid B on CCl(4)-induced hepatic fibrosis through regulating NF-κB/IκBα signaling. J Ethnopharmacol 2012; 144: 592–598 16 Joe Y, Zheng M, Kim HJ, Kim S, Uddin MJ, Park C, Ryu do G, Kang SS, Ryoo S, Ryter SW, Chang KC, Chung HT. Salvianolic acid B exerts vasoprotective effects through the modulation of heme oxygenase-1 and arginase activities. J Pharmacol Exp Ther 2012; 341: 850–858 17 Su CC, Chen GW, Kang JC, Chan MH. Growth inhibition and apoptosis induction by tanshinone IIA in human colon adenocarcinoma cells. Planta Med 2008; 74: 1357–1362 18 Hong HJ, Liu JC, Chen PY, Chen JJ, Chan P, Cheng TH. Tanshinone IIA prevents doxorubicin-induced cardiomyocyte apoptosis through Akt-dependent pathway. Int J Cardiol 2012; 157: 174–179 19 Jiang B, Zhang L, Wang Y, Li M, Wu W, Guan S, Liu X, Yang M, Wang J, Guo DA. Tanshinone IIA sodium sulfonate protects against cardiotoxicity induced by doxorubicin in vitro and in vivo. Food Chem Toxicol 2009; 47: 1538–1544 20 Slusarczyk S, Zimmermann S, Kaiser M, Matkowski A, Hamburger M, Adams M. Antiplasmodial and antitrypanosomal activity of tanshinone-type diterpenoids from Salvia miltiorrhiza. Planta Med 2011; 77: 1594–1596 21 Boatright KM, Salvesen GS. Mechanisms of caspase activation. Curr Opin Cell Biol 2003; 15: 725–731 22 Rao YK, Geethangili M, Fang SH, Tzeng YM. Antioxidant and cytotoxic activities of naturally occurring phenolic and related compounds: a comparative study. Food Chem Toxicol 2007; 45: 1770–1776 23 Liu F, Yu G, Wang G, Liu H, Wu X, Wang Q, Liu M, Liao K, Wu M, Cheng X, Hao H. An NQO1-initiated and p 53-independent apoptotic pathway determines the anti-tumor effect of tanshinone IIA against non-small cell lung cancer. PLoS One 2012; 7: e42138 24 Tang C, Xue HL, Bai CL, Fu R. Regulation of adhesion molecules expression in TNF-α-stimulated brain microvascular endothelial cells by tanshinone IIA: involvement of NF-κB and ROS generation. Phytother Res 2011; 25: 376–380 25 Lee WY, Cheung CC, Liu KW, Fung KP, Wong J, Lai PB, Yeung JH. Cytotoxic effects of tanshinones from Salvia miltiorrhiza on doxorubicin-resistant human liver cancer cells. J Nat Prod 2010; 73: 854–859 26 Chlopcikova S, Psotova J, Miketova P, Sousek J, Lichnovsky V, Simanek V. Chemoprotective effect of plant phenolics against anthracycline-induced toxicity on rat cardiomyocytes. Part II. caffeic, chlorogenic and rosmarinic acids. Phytother Res 2004; 18: 408–413 27 Jiang B, Zhang L, Li M, Wu W, Yang M, Wang J, Guo DA. Salvianolic acids prevent acute doxorubicin cardiotoxicity in mice through suppression of oxidative stress. Food Chem Toxicol 2008; 46: 1510–1515 28 Acharya S, Peters AM, Norton AS, Murdoch GK, Hill RA. NADPH oxidase-4 mediated ROS generation modulates C2C12 differentiation via ERK1/2 pathway. Pflugers Arch 2013; 465: 1181–1196
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
75
Downloaded by: University of Connecticut. Copyrighted material.
Original Papers
Original Papers
30
31 32
33
34
29 Cho YS, Uranio MF, Ambruosi B, Paternoster MS, Totaro P, Sardanelli AM, DellʼAquila ME. Intracellular Reactive Oxygen Species (ROS) level and total Superoxide Dismutase (SOD) activity in human oocytes. Hum Reprod 2011; 26: I184 Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 1984; 22: 27–55 Chou TC. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res 2010; 70: 440–446 Righeschi C, Eichhorn T, Karioti A, Bilia AR, Efferth T. Microarray-based mRNA expression profiling of leukemia cells treated with the flavonoid, casticin. Cancer Genom Proteom 2012; 9: 143–151 You JS, Pan TL, Lee YS. Protective effects of Danshen (Salvia miltiorrhiza) on adriamycin-induced cardiac and hepatic toxicity in rats. Phytother Res 2007; 21: 1146–1152 Ziaie S, Jamaati H, Hajimahmoodi M, Hashemian SM, Fahimi F, Farzanegan B, Moghaddam G, Radmand G, Vandani B, Nadji SA, Mousavi S, Hamishehkar H, Mojtahedzadeh M. The Relationship between vitamin E plasma and BAL concentrations, SOD activity and ventilatory support measures in critically Ill patients. Iran J Pharm Res 2011; 10: 953–960
35 de Jesus CCL, Atallah AN, Valente O, Trevisani VFM. Vitamin C and superoxide dismutase (SOD) for diabetic retinopathy. Cochrane Database Syst Rev 2008; DOI: 10.1002/14651858.CD006695.pub2 36 Collier AC, Pritsos KL, Pritsos CA. TCDD as a biological response modifier for Mitomycin C: oxygen tension affects enzyme activation, reactive oxygen species and cell death. Life Sci 2006; 78: 1499–1507 37 Herman S, Zurgil N, Deutsch M. Low dose methotrexate induces apoptosis with reactive oxygen species involvement in T lymphocytic cell lines to a greater extent than in monocytic lines. Inflamm Res 2005; 54: 273–280 38 Kan S, Li J, Huang W, Shao L, Chen D. Microsphere resin chromatography combined with microbial biotransformation for the separation and purification of salvianolic acid B in aqueous extract of roots of Salvia multiorrihza Bunge. J Chromatogr A 2009; 1216: 3881–3886 39 Suazo M, Olivares F, Mendez MA, Pulgar R, Prohaska JR, Arredondo M, Pizarro F, Olivares M, Araya M, Gonzalez M. CCS and SOD1 mRNA are reduced after copper supplementation in peripheral mononuclear cells of individuals with high serum ceruloplasmin concentration. J Nutr Biochem 2008; 19: 269–274
Downloaded by: University of Connecticut. Copyrighted material.
76
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
Enhancement of Doxorubicin Cytotoxicity by Tanshinone IIA in HepG2 Human Hepatoma Cells
Authors
Shidong Kan, Wan Man Cheung, Yanling Zhou, Wing Shing Ho
Affiliation
School of Life Science, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong
Key words " chemoprotection l " chlorogenic acid l " salvianolic acid B l " tanshinone IIA l " doxorubicin l " cytotoxicity l
Abstract !
Chlorogenic acid (1), salvianolic acid B (2), and tanshinone IIA (3) are commonly used as chemoprotective agents for chemotherapy in cancer patients. The present study deals with the effect of these three compounds on cytotoxicity of doxorubicin in HepG2 cells. The results showed that 1 and 2 reduced the cytotoxicity of doxorubicin
Introduction !
received revised accepted
June 3, 2013 Sept. 10, 2013 Nov. 6, 2013
Bibliography DOI http://dx.doi.org/ 10.1055/s-0033-1360126 Planta Med 2014; 80: 70–76 © Georg Thieme Verlag KG Stuttgart · New York · ISSN 0032‑0943 Correspondence Wing Shing Ho School of Life Science The Chinese University of Hong Kong MMW 612 Shatin, New Territories 852-011 Hong Kong Phone: + 85 2 39 43 61 14 Fax: + 85 2 26 03 77 32 [email protected]
Doxorubicin also known as adriamycin is a widely used anticancer drug for the treatment of hematologic malignancies and solid cancer [1, 2]. However, the clinical use of doxorubicin is limited by its serious adverse cardiac effects that result in cardiomyopathy and heart failure. Increased free radical production and a reduced level of myocardial antioxidants are believed to be associated with the cardiotoxicity of doxorubicin [3, 4]. It was reported that doxorubicin caused progressive chronic cardiotoxicity resulting in heart failure within one year of treatment [5]. Therefore, the development of a strategy for therapy with doxorubicin is warranted to reduce its cardiotoxicity. Chemoprotective agents are good candidates for clinical use with doxorubicin. They can be used to attenuate the cardiotoxicity of antitumor drugs. " Fig. 1) is a naturally occurChlorogenic acid (1, l ring active phenolic compound found in many foods and botanical drugs. Due to its easy accessibility in the human diet, numerous studies have been conducted to investigate its biological functions, including antioxidant, antihypertensive, antibacterial, anti-inflammatory, antifungal, antivirus, and anticarcinogenic activities [6–9]. Salvia miltiorrhiza, also known as Danshen, is commonly used in traditional Chinese medicine (TCM) for the treatment of heart disease, cerebro-
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
through scavenging ROS generated by doxorubicin in HepG2 cells. The findings suggest that 1 and 2 could enhance the expression of SOD and decrease that of NADPH oxidase, which resulted in the elimination of ROS. On the contrary, 3 enhanced the cytotoxicity of doxorubicin in HepG2 cells. Furthermore, drug interactions between doxorubicin and 3 produce synergistic effects in HepG2 cells.
vascular disease, hepatitis, hepatocirrhosis, and cancer [10–12]. Some of the active phytochemicals can be isolated and purified from water-soluble and lipid-soluble fractions from S. miltiorrhi" Fig. 1) and tanshinone za. Salvianolic acid B (2, l " IIA (3, l Fig. 1) were considered the quality elements for S. miltiorrhiza. It was reported that 2 has multi-arrays of pharmacological effects on the liver, can reduce atherosclerosis and low-density lipoprotein and is a potential chemopreventive agent for head and neck squamous cell cancer [13–16]. Previous studies reported that 3 exhibits cardiovascular activity, including vasorelaxation, and cardioprotective effects, as well as antitumor activity in many kinds of cancer including drugresistant cancer cells [17–20]. Compounds 1, 2, and 3 are used as chemoprotective agents for cancer therapy with doxorubicin. In this paper, their effects on doxorubicin cytotoxicity were studied.
Results and Discussion ! " Fig. 2 shows the effects of 1, 2, and 3 on the cyl totoxic activity of doxorubicin in HepG2 cells. The cytotoxic activity of doxorubicin was attenuated by 1 and 2, which significantly improved the viability of HepG2 cells. At 1120 µM and 560 µM, the viability of HepG2 cells after treatment with a mixture of doxorubicin and 1 or 2 was increased to 89.2 % and 91.2 %, respectively. However, the cy-
Downloaded by: University of Connecticut. Copyrighted material.
70
Fig. 1
Chemical structures of compounds 1, 2, and 3.
totoxic activity of doxorubicin was enhanced by 3. When the concentration of 3 reached 17.0 µM, the viability of HepG2 cells remained at 4.8 % compared with the control. The results show that the cytotoxic activity of the combination of doxorubicin and 3 reached the maximal level. Lactate dehydrogenase (LDH) leakage, which is a marker of ne" Fig. 3 shows that HepG2 crotic cellular death, was measured. l cells after treatment with doxorubicin resulted in leakage of LDH. Compound 3 increased this leakage. However, 1 or 2 caused a decrease of the cytotoxic effects of doxorubicin and resulted in a decrease of LDH leakage compared to the doxorubicin-treated cancer cells. A recent study reported that caspase 3 played a central role as an " Fig. 4 shows that doxorubicin-treateffector of apoptosis [21]. l ed cells markedly increased the activity of caspase 3 compared with the control. On the contrary, 1 or 2 decreased caspase 3. However, the combination of 3 and doxorubicin significantly enhanced the caspase 3 activity leading to apoptosis of HepG2 cells.
As the concentration of 3 increased, the activity of caspase 3 increased gradually and reached the maximal level at 8.5 µM. " Figs. 2–4 show that 3 enhanced the activity of caspase 3 in l HepG2 cells resulting in cell death. However, 1 and 2 decreased the activity of caspase 3 resulting in the enhanced viability of the HepG2 cells. The antioxidative activity of 1, 2, and 3 was measured using DPPH, a stable free radical [22]. DPPH assay shows that the scavenging activity of 1 and 2 was concentration-dependent and reached a maximal level at a concentration of 560 µM and 28 µM, respectively. The IC50 values of 1 and 2 were 88.9 µM and 7.7 µM, respectively. However, the scavenging activity of 3 was lower than that of 1 and 2 and could not be determined even at the highest concentration (1700 µM). The level of ROS is believed to be associated with the cytotoxic properties of doxorubicin in the HepG2 cell line. " Fig. 5 shows that doxorubicin significantly increased the level l of ROS in the HepG2 cell line, which was reduced by 1 and 2. As the concentration increased, the amount of ROS was attenuated " Figs. 2 and 5 show that ROS reduced the cytotoxic by 1 or 2. l properties of doxorubicin. It was reported that 3 induced apoptosis and inhibited the proliferation and migration of cancer cells [23–25]. The present findings provide supportive evidences on the pharmacological activity of 3. It is believed that the excess amount of ROS generation in tumor cells causes cardiac toxicity [3]. Polyphenol compounds such as 1 and 2 could protect the heart through suppression of oxidative stress [26, 27]. However, 3 could attenuate the cardiac toxicity of doxorubicin through interactions with this drug. The combination of doxorubicin and 3 did not affect the level of ROS in cells [18, 19] and had no adverse impacts on the cytotoxic activity of doxorubicin. " Fig. 6 shows the gene expression of HepG2 cells after treatment l with 1, 2, and doxorubicin. After incubation with doxorubicin, NADPH oxidase 4 was increased 25-fold compared to untreated cells, while 1 and 2 decreased the NADPH oxidase 4 activity. The extent of reduction in activity was dose-dependent. At the concentrations of 560 µM (1) and 280 µM (2), the NADPH oxidase 4 expression decreased to 2.8- and 2.9-fold compared to untreated cells. After 6 h incubation, the SOD1 expression in doxorubicintreated cells was decreased to only 7.5 % of untreated cells. How-
Fig. 2 Effect of compounds 1, 2, and 3 on the cytotoxic activity of doxorubicin using the MTT assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Combinations of 1, 2, or 3 with doxorubicin (4.8 µM) were added to the assay. A, 1 (28 µM), 2 (14 µM), 3 (1.1 µM); B, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); C, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); D, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); E, 1 (560 µM), 2 (280 µM), 3 (17.0 µM); and F, 1 (1120 µM), 2 (560 µM), 3 (34.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
71
Downloaded by: University of Connecticut. Copyrighted material.
Original Papers
Original Papers
Fig. 3 Effects of doxorubicin and compounds 1, 2, and 3 on LDH leakage in HepG2 cells using the LDH assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2, or 3 with doxorubicin (4.8 µM) were added. A, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); B, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); C, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); and D, 1 (560 µM), 2 (280 µM), 3 (17.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Fig. 4 Effect of doxorubicin and compounds 1, 2, and 3 on caspase 3 expression in HepG2 cells using the caspase 3 assay. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2, or 3 with doxorubicin (4.8 µM) were added. A, 1 (56 µM), 2 (28 µM), 3 (2.1 µM); B, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); C, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); and D, 1 (560 µM), 2 (280 µM), 3 (17.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Fig. 5 Effects of doxorubicin and compounds 1, 2, and 3 on ROS formation in HepG2 cells using the ROS assay. Control: medium only. Doxorubicin concentration was kept at 10 µM. Different concentrations of 1, 2, or 3 with doxorubicin (10 µM) were added. A, 1 (140 µM), 2 (70 µM), 3 (4.3 µM); B, 1 (280 µM), 2 (140 µM), 3 (8.5 µM); C, 1 (560 µM), 2 (280 µM), 3 (17.0 µM); and D, 1 (1120 µM), 2 (560 µM), 3 (34.0 µM). Means ± SD, n = 4; * p < 0.05, ** p < 0.01 vs. doxorubicin.
ever, 1 and 2 can enhance the expression of SOD1 up to 66.5 % and 177.5 % compared to untreated cells at the concentrations of 560 µM (1) and 280 µM (2), respectively. NADPH oxidase is the key enzyme involved in ROS formation in doxorubicin-treated cells [28]. However, ROS could be eliminated
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
by SOD [29], resulting in the enhancement of cell viability. Compound 1 and 2 can enhance the activity of SOD in HepG2 cells and decrease the activity of NADPH oxidase, which results in HepG2 cell viability.
Downloaded by: University of Connecticut. Copyrighted material.
72
Original Papers
73
Table 1 Combination effects of doxorubicin and compound 3 at different concentrations. Drug concentration (µM)
Doxorubicin (IP, %) 3 (IP, %) Mix (IP, %) CI
1
2
3
4
5
10
20
50
100
18.6 ± 3.2 15.1 ± 3.3 55.0 ± 4.6 0.90
22.3 ± 1.9 19.5 ± 3.1 60.5 ± 4.3 0.89
28.9 ± 3.9 23.3 ± 6.7 70.1 ± 2.7 0.72
40.5 ± 3.5 29.9 ± 7.1 72.9 ± 3.5 0.72
54.6 ± 3.9 33.8 ± 3.3 75.0 ± 1.6 0.54
80.0 ± 2.9 58.0 ± 2.0 89.7 ± 1.0 0.40
80.2 ± 4.6 78.6 ± 3.4 94.8 ± 1.5 0.32
84.7 ± 2.7 82.5 ± 3.3 94.6 ± 0.9 0.63
85.9 ± 2.9 82.4 ± 3.7 94.8 ± 0.4 0.99
IP, inhibition percentage (%) of HepG2 cells compared to control; Mix, mixture of doxorubicin (4 µM) and different concentrations of 3; CI, combination index. Means ± SD, n = 6
Drug combination is widely used in treating cancer. The Chou-Talalay method was the procedure commonly employed to assess the combination effect of two drugs [30–31]. The combination of doxorubicin and 3 was assessed by combination index (CI). A CI value < 1 was considered to indicate synergism, CI value = 1 addi" Table 1 shows the syntive effect, and CI value > 1 antagonism. l ergistic effects of the combination of doxorubicin and 3 in the HepG2 cell line. The results show that the combination of doxorubicin (4 µM) and 3 exhibited a synergistic effect on cancer cells and suggest that this combination would improve the cytotoxicity of doxorubicin with less cardiotoxicity. Compounds 1 and 2, however, could influence the cytotoxic activity of doxorubicin because of their scavenging activity towards ROS in cancer cells [26, 27, 32]. The results suggest that the combination of 3 and doxorubicin could produce health benefits for cancer patients. Although 1 can also produce health benefits, it might cause harmful effects on cancer patients when administered with doxorubicin for chemotherapy. S. miltiorrhiza is a popular TCM used for treatment of cardiovascular disease and heart disease in China [33]. However, the administration of its aqueous extract
may attenuate the cytotoxicity of doxorubicin as well. It is therefore necessary to choose a suitable cardioprotective agent for chemotherapy with doxorubicin. The use of 1, 2, and other antioxidants such as vitamin C and E could result in the decrease of cytotoxicity of doxorubicin. At the concentrations of 200 and 400 µM of vitamin C, the activity of doxorubicin could be decreased 18.5 % and 30.8% compared to doxorubicin treatment alone in HepG2 cells. These values could increase to 38.2 % and 62.1 % for vitamin E. Although vitamin C and E can enhance the SOD activity [34, 35], their use may result in a decrease of doxorubicin cytotoxicity due to the enhancement of SOD activity in HepG2 cells. Phenolic compounds are widely distributed in plants and in many botanical drugs and healthy food. It is reported that the major mechanism of action of cancer drugs is via ROS generation [36, 37]. Besides 1 and 2, some other phenolic compounds could have a similar attenuating effect on ROS. It is therefore important to make a suitable choice of food and chemoprotective agents to be used along with cancer therapy.
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
Downloaded by: University of Connecticut. Copyrighted material.
Fig. 6 Expressions of NADPH oxidase 4 and SOD1 after compounds 1 and 2, and doxorubicin treatment in HepG2 cells. A NADPH oxidase 4 expression compared to control. B SOD1 expression compared to control. Control: medium only. Doxorubicin concentration was kept at 4.8 µM. Different concentrations of 1, 2 with doxorubicin (4.8 µM) were added. 1 (L), 1 (56 µM). 1 (M), (280 µM). 1 (H), (560 µM). 2 (L), (28 µM). 2 (M), (140 µM). 2 (H), (280 µM). Means ± SD, n = 3; * p < 0.05, ** p < 0.01 vs. doxorubicin.
Original Papers
Materials and Methods
acids, streptomycin (100 mg/mL), and penicillin (100 mg/mL). The cells were passaged at a split ratio of 1 : 3 every 2–3 days.
!
Plant materials and extraction procedures Lonicera japonica Thunb (batch No. 04082010) and S. miltiorrhiza (batch No. 02 052 012) were purchased from Kam Hing Hong Co. and identified by Dr. Shuguang Wang [Department of TCM, Shanghai Institute of Pharmaceutical Industry (SIPI), Shanghai, PRC]. The plant specimens (SIPI-12-008-JYH and SIPI-12-009DS) were deposited in the hebarium of SIPI. Compound 2 (purity over 99%) was prepared according to the previous method described [38]. Compounds 1 and 3 (purity over 98 %) were purified through the chromatography of microsphere resin NM100 (donated by SIPI). Firstly, 1 L of microsphere resin was washed with distilled water prior to filling the glass column (diameter 6 cm). The flowers of L. japonica (500 g) were ground into powder prior to soaking with 5 L of 95 % ethanol and stirring for 2 h. The mixture was filtered and concentrated by rotary evaporator at 45 °C to dryness. The residue was dissolved in 500 mL and adjusted to pH 6.5 before placing onto the column at 1 L/h. Distilled water was used to elute the column, and the effluent was collected by fraction. The elution of 1 (> 98 % purity) was collected and freeze-dried to powder. The dried roots of S. miltiorrhiza (500 g) in 4 L 80 % ethanol were decocted at 70 °C for 1 h prior to filtration. The filtrate was concentrated by rotary evaporator at 45 °C to dryness. The residue was dissolved in 500 mL 70% ethanol prior to placing it onto the column at 1 L/h. 90 % ethanol was used to elute the column, and the effluent with 3 (> 70 % purity) was collected. The fraction was pooled and crystallized with acetone and water (v : v = 3 : 1). The crystal of compound 3, with purity over 98 %, was collected and dried prior to use.
Reagents NaOH, ethanol, hydrochloride acid, and phosphoric acid were obtained from Sigma-Aldrich. HPLC grade acetonitrile was purchased from Tedia. All aqueous solutions were prepared using double distilled water. Doxorubicin (purity 98–102 %), vitamin C (purity 99%), and vitamin E (purity 95.5 %) were purchased from Sigma-Aldrich. Reference compounds of 1, 2, and 3 (purity over 98%) were purchased from Tauto Biotech Co. Ltd.
HPLC analysis The extraction and purification of 1, 2, and 3 were analyzed by the Agilent HP 1100 system with an autosampler and DAD detector. The liquid chromatography was performed on a reversedphase column (Zorbax 300SB‑C18, 4.6 × 250 mm, 5 µm; Agilent). The flow rate was at 0.8 mL/min. The column temperature was set at 20 °C. The mobile phase for 1 was composed of 0.5 % phosphoric acid and acetonitrile (87 : 13, v : v), and the detection wavelength was set at 327 nm. The mobile phase for 2 was composed of 0.5 % phosphoric acid and acetonitrile (70 : 30, v : v), and the wave length was set at 286 nm. The mobile phase for 3 was composed of water and acetonitrile (25 : 75, v : v), and the wavelength was set at 270 nm.
Cell line and culture Cultures of human hepatoma cell line HepG2 were obtained from ATCC and grown on Eagleʼs minimum essential medium (EMEM; GIBCO). It was supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 2 mM L-glutamine, MEM nonessential amino
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
Cell treatment and MTT assay HepG2 cells were seeded in 96-well plates at a concentration of 3 × 103 cells in 0.1 mL EMEM/well and incubated for 24 h at 37 °C under 5 % CO2. The cells were incubated for 24 h with doxorubicin (4.8 µM) alone and with different concentrations of compounds 1 (28–1120 µM), 2 (14–560 µM), and 3 (1.1–34.0 µM) with doxorubicin (4.8 µM). Cells were incubated with the fresh medium as the control. The medium was replaced with 100 µL fresh medium prior to the addition of 20 µL of MTT (5 mg/mL in PBS) per well after incubation. The plate was incubated for 2 h at 37 °C in a humidified 5% CO2 atmosphere. At the end of the incubation period, the medium was removed and 100 µL DMSO was added to each well. The plate was gently shaken to solubilize the purple-colored formazans. The MTT assay was performed on the microtiter plate reader according to the manufacturerʼs protocols (Spectramax 190; Molecular Devices).
LDH assay Following incubation, the media were analyzed for the LDH activity using an LDH cytotoxicity assay kit (Promega). Briefly, after 24 h of drug treatment, 50 µL of supernate from each well was transferred to a fresh 96-well plate prior to the addition of 50 µL of the substrate for 30 min. Subsequently, 50 µL of stop solution was added and the absorbance at 490 nm was examined by a microtiter plate reader (Spectramax 190; Molecular Devices). The results are expressed as the mean absorbance normalized to the percentage of the control value.
Caspase 3 assay The activity of the caspase 3 was determined using the assay kit from Promega. Briefly, after 10 h drug treatment, the medium was replaced by caspase 3 reagent and incubated for 3 h at room temperature. The fluorescence was recorded using a fluorescence microplate reader (TECAN infinite M200) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
DPPH (1,1-diphenyl-2-picrylhydrazyl radical 2,2-diphenyl-1-(2,4,6-trinitrophenyl)hydrazyl) radical scavenging assay The antioxidative ability of 1, 2, and 3 was measured using DPPH. The reaction mixture contained 10 µL of DPPH (1 mM in ethanol), 89.6 µL of ethanol (99%), and 0.4 µL of 1, 2, and 3 (in DMSO). The reaction mixture was kept in the dark for 30 min. The decrease in the absorption at 517 nm was measured. The scavenging activity was calculated and expressed as IC50, which is defined as the concentration of 1 (or 2 and 3) required for inhibition of half the DPPH radical.
ROS assay ROS in the cell line was measured according to the manufacturerʼs protocols using the ROS assay kit from Invitrogen. The dye chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM‑H2DCFDA), which is oxidized to fluorescent 2′,7′-dichlorofluorescin (CM‑DCF) by hydroperoxides, was used to measure the relative level of cellular peroxides. HepG2 cells were incubated with 10 mM dye at 37 °C for 1 h and washed with PB. Subsequently, 100 µL of fresh medium was added, incubated for 30 min with different concentrations of the compounds and incubated for another hour. The drug was removed and washed twice
Downloaded by: University of Connecticut. Copyrighted material.
74
with PBS. The fluorescence was measured using a fluorescence microplate reader (Tecan infinite M200) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm.
Quantitative real-time PCR RNA was extracted from the treated HepG2 cells with the RNeasy mini kit (Qiagen). The treating time for NADPH oxidase 4 and SOD1 was 12 h and 6 h, respectively. First strand cDNA was synthesized by PCR using a PrimeScript RT Master Mix (Takara). The expression level of NADPH oxidase 4 and SOD1 was measured using RT2 Realtime SYBR Green/ROX PCR Master Mix (SA Biosciences) with NADPH oxidase 4 and SOD1 primer (NADPH oxidase 4: 5′-GGAACACGACAATCAGCCTT‑3′ and 5′-TGGAAACCAAAGAGACCCTG‑3′. SOD1: 5′-CTGAAGGCCTGCATGGATTC‑3′ and 5′CCAAGTCTCCAACATGCCTCTC − 3′). A G3PDH primer (5′-ACCACAGTCCATGCCATCAC‑3′ and 5′-TCCACCCTGTTGCTGTA‑3′) was used as an endogenous control [39]. The real-time PCR was done in triplicate. The HotStart DNA polymerase was first activated at 95 °C for 10 min for 40 cycles, including denaturation at 95 °C for 15 s and annealing for 1 min. The data was analyzed using the 2–ΔΔCt method.
Combination effects of doxorubicin and 3 on the HepG2 Cell line Different concentrations of doxorubicin and 3 were added to the cell culture and incubated for 24 h at 37 °C under 5 % CO2 prior to the MTT assay. The combination effects of the two compounds were calculated as the CI value [30–31].
Statistical analysis Data represent means ± SD of at least three separate experiments (p < 0.05).
Acknowledgements !
This work was supported by grant No. 6903088 from Keenway Industries Ltd.
Conflict of Interest !
The authors declare that there are no conflicts of interest.
References 1 Schlumberger M, Parmentier C, Delisle MJ, Couette JE, Droz JP, Sarrazin D. Combination therapy for anaplastic giant cell thyroid carcinoma. Cancer 1991; 67: 564–566 2 Duggan ST, Keating GM. Pegylated liposomal doxorubicin: a review of its use in metastatic breast cancer, ovarian cancer, multiple myeloma and AIDS-related Kaposiʼs sarcoma. Drugs 2011; 71: 2531–2558 3 Singal PK, Li T, Kumar D, Danelisen I, Iliskovic N. Adriamycin-induced heart failure: mechanism and modulation. Mol Cell Biochem 2000; 207: 77–86 4 Barry E, Alvarez JA, Scully RE, Miller TL, Lipshultz SE. Anthracycline-induced cardiotoxicity: course, pathophysiology, prevention and management. Expert Opin Pharmacother 2007; 8: 1039–1058 5 Von Hoff DD, Layard MW, Basa P, Davis jr. HL, Von Hoff AL, Rozencweig M, Muggia FM. Risk factors for doxorubicin-induced congestive heart failure. Ann Intern Med 1979; 91: 710–717 6 Bahadir O, Citoglu GS, Coban T. Antioxidant activity of some Scorzonera species and quantitative analysis of chlorogenic acid. Planta Med 2010; 76: 1227
7 Zhao Y, Wang J, Ballevre O, Luo H, Zhang W. Antihypertensive effects and mechanisms of chlorogenic acids. Hypertens Res 2012; 35: 370– 374 8 Wu WB, Hung DK, Chang FW, Ong ET, Chen BH. Anti-inflammatory and anti-angiogenic effects of flavonoids isolated from Lycium barbarum Linnaeus on human umbilical vein endothelial cells. Food Funct 2012; 3: 1068–1081 9 Ozcelik B, Kartal M, Orhan I. Cytotoxicity, antiviral and antimicrobial activities of alkaloids, flavonoids, and phenolic acids. Pharm Biol 2011; 49: 396–402 10 Lu Y, Foo LY. Polyphenolics of Salvia–a review. Phytochemistry 2002; 59: 117–140 11 Che XH, Park EJ, Zhao YZ, Kim WH, Sohn DH. Tanshinone II A induces apoptosis and S phase cell cycle arrest in activated rat hepatic stellate cells. Basic Clin Pharmacol Toxicol 2010; 106: 30–37 12 Zhang Y, Wei RX, Zhu XB, Cai L, Jin W, Hu H. Tanshinone IIA induces apoptosis and inhibits the proliferation, migration, and invasion of the osteosarcoma MG‑63 cell line in vitro. Anticancer Drug 2012; 23: 212–219 13 Lay IS, Chiu JH, Shiao MS, Lu WY, Wu CW. Crude extract of Salvia miltiorrhiza and salvianolic acid B enhance in vitro angiogenesis in murine SVR endothelial cell line. Planta Med 2003; 69: 26–32 14 Zhao Y, Hao Y, Ji H, Fang Y, Guo Y, Sha W, Zhou Y, Pang X, Southerland WM, Califano JA, Gu X. Combination effects of salvianolic acid B with low-dose celecoxib on inhibition of head and neck squamous cell carcinoma growth in vitro and in vivo. Cancer Prev Res 2010; 3: 787–796 15 Wang R, Yu XY, Guo ZY, Wang YJ, Wu Y, Yuan YF. Inhibitory effects of salvianolic acid B on CCl(4)-induced hepatic fibrosis through regulating NF-κB/IκBα signaling. J Ethnopharmacol 2012; 144: 592–598 16 Joe Y, Zheng M, Kim HJ, Kim S, Uddin MJ, Park C, Ryu do G, Kang SS, Ryoo S, Ryter SW, Chang KC, Chung HT. Salvianolic acid B exerts vasoprotective effects through the modulation of heme oxygenase-1 and arginase activities. J Pharmacol Exp Ther 2012; 341: 850–858 17 Su CC, Chen GW, Kang JC, Chan MH. Growth inhibition and apoptosis induction by tanshinone IIA in human colon adenocarcinoma cells. Planta Med 2008; 74: 1357–1362 18 Hong HJ, Liu JC, Chen PY, Chen JJ, Chan P, Cheng TH. Tanshinone IIA prevents doxorubicin-induced cardiomyocyte apoptosis through Akt-dependent pathway. Int J Cardiol 2012; 157: 174–179 19 Jiang B, Zhang L, Wang Y, Li M, Wu W, Guan S, Liu X, Yang M, Wang J, Guo DA. Tanshinone IIA sodium sulfonate protects against cardiotoxicity induced by doxorubicin in vitro and in vivo. Food Chem Toxicol 2009; 47: 1538–1544 20 Slusarczyk S, Zimmermann S, Kaiser M, Matkowski A, Hamburger M, Adams M. Antiplasmodial and antitrypanosomal activity of tanshinone-type diterpenoids from Salvia miltiorrhiza. Planta Med 2011; 77: 1594–1596 21 Boatright KM, Salvesen GS. Mechanisms of caspase activation. Curr Opin Cell Biol 2003; 15: 725–731 22 Rao YK, Geethangili M, Fang SH, Tzeng YM. Antioxidant and cytotoxic activities of naturally occurring phenolic and related compounds: a comparative study. Food Chem Toxicol 2007; 45: 1770–1776 23 Liu F, Yu G, Wang G, Liu H, Wu X, Wang Q, Liu M, Liao K, Wu M, Cheng X, Hao H. An NQO1-initiated and p 53-independent apoptotic pathway determines the anti-tumor effect of tanshinone IIA against non-small cell lung cancer. PLoS One 2012; 7: e42138 24 Tang C, Xue HL, Bai CL, Fu R. Regulation of adhesion molecules expression in TNF-α-stimulated brain microvascular endothelial cells by tanshinone IIA: involvement of NF-κB and ROS generation. Phytother Res 2011; 25: 376–380 25 Lee WY, Cheung CC, Liu KW, Fung KP, Wong J, Lai PB, Yeung JH. Cytotoxic effects of tanshinones from Salvia miltiorrhiza on doxorubicin-resistant human liver cancer cells. J Nat Prod 2010; 73: 854–859 26 Chlopcikova S, Psotova J, Miketova P, Sousek J, Lichnovsky V, Simanek V. Chemoprotective effect of plant phenolics against anthracycline-induced toxicity on rat cardiomyocytes. Part II. caffeic, chlorogenic and rosmarinic acids. Phytother Res 2004; 18: 408–413 27 Jiang B, Zhang L, Li M, Wu W, Yang M, Wang J, Guo DA. Salvianolic acids prevent acute doxorubicin cardiotoxicity in mice through suppression of oxidative stress. Food Chem Toxicol 2008; 46: 1510–1515 28 Acharya S, Peters AM, Norton AS, Murdoch GK, Hill RA. NADPH oxidase-4 mediated ROS generation modulates C2C12 differentiation via ERK1/2 pathway. Pflugers Arch 2013; 465: 1181–1196
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
75
Downloaded by: University of Connecticut. Copyrighted material.
Original Papers
Original Papers
30
31 32
33
34
29 Cho YS, Uranio MF, Ambruosi B, Paternoster MS, Totaro P, Sardanelli AM, DellʼAquila ME. Intracellular Reactive Oxygen Species (ROS) level and total Superoxide Dismutase (SOD) activity in human oocytes. Hum Reprod 2011; 26: I184 Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 1984; 22: 27–55 Chou TC. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res 2010; 70: 440–446 Righeschi C, Eichhorn T, Karioti A, Bilia AR, Efferth T. Microarray-based mRNA expression profiling of leukemia cells treated with the flavonoid, casticin. Cancer Genom Proteom 2012; 9: 143–151 You JS, Pan TL, Lee YS. Protective effects of Danshen (Salvia miltiorrhiza) on adriamycin-induced cardiac and hepatic toxicity in rats. Phytother Res 2007; 21: 1146–1152 Ziaie S, Jamaati H, Hajimahmoodi M, Hashemian SM, Fahimi F, Farzanegan B, Moghaddam G, Radmand G, Vandani B, Nadji SA, Mousavi S, Hamishehkar H, Mojtahedzadeh M. The Relationship between vitamin E plasma and BAL concentrations, SOD activity and ventilatory support measures in critically Ill patients. Iran J Pharm Res 2011; 10: 953–960
35 de Jesus CCL, Atallah AN, Valente O, Trevisani VFM. Vitamin C and superoxide dismutase (SOD) for diabetic retinopathy. Cochrane Database Syst Rev 2008; DOI: 10.1002/14651858.CD006695.pub2 36 Collier AC, Pritsos KL, Pritsos CA. TCDD as a biological response modifier for Mitomycin C: oxygen tension affects enzyme activation, reactive oxygen species and cell death. Life Sci 2006; 78: 1499–1507 37 Herman S, Zurgil N, Deutsch M. Low dose methotrexate induces apoptosis with reactive oxygen species involvement in T lymphocytic cell lines to a greater extent than in monocytic lines. Inflamm Res 2005; 54: 273–280 38 Kan S, Li J, Huang W, Shao L, Chen D. Microsphere resin chromatography combined with microbial biotransformation for the separation and purification of salvianolic acid B in aqueous extract of roots of Salvia multiorrihza Bunge. J Chromatogr A 2009; 1216: 3881–3886 39 Suazo M, Olivares F, Mendez MA, Pulgar R, Prohaska JR, Arredondo M, Pizarro F, Olivares M, Araya M, Gonzalez M. CCS and SOD1 mRNA are reduced after copper supplementation in peripheral mononuclear cells of individuals with high serum ceruloplasmin concentration. J Nutr Biochem 2008; 19: 269–274
Downloaded by: University of Connecticut. Copyrighted material.
76
Kan S et al. Enhancement of Doxorubicin …
Planta Med 2014; 80: 70–76
