Enumeration of Salmonellae in Table Eggs, Pasteurized Egg Products, and Egg-Containing Dishes by Using Quantitative Real-Time PCR
Updated information and services can be found at: http://aem.asm.org/content/80/5/1616 These include: SUPPLEMENTAL MATERIAL REFERENCES
CONTENT ALERTS
Supplemental material This article cites 31 articles, 12 of which can be accessed free at: http://aem.asm.org/content/80/5/1616#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Dziuginta Jakociune, Frédérique Pasquali, Cristiana Soares da Silva, Charlotta Löfström, Jeffrey Hoorfar, Günter Klein, Gerardo Manfreda and John Elmerdahl Olsen Appl. Environ. Microbiol. 2014, 80(5):1616. DOI: 10.1128/AEM.03360-13. Published Ahead of Print 20 December 2013.
Enumeration of Salmonellae in Table Eggs, Pasteurized Egg Products, and Egg-Containing Dishes by Using Quantitative Real-Time PCR Džiuginta Jakocˇiu ne˙,a Frédérique Pasquali,b Cristiana Soares da Silva,c Charlotta Löfström,d Jeffrey Hoorfar,d Günter Klein,c Gerardo Manfreda,b John Elmerdahl Olsena
Salmonellae are a major cause of food-borne outbreaks in Europe, with eggs and egg products being identified as major sources. Due to the low levels of salmonellae in eggs and egg products, direct quantification is difficult. In the present study, enrichment quantitative real-time PCR (qPCR) was employed for enumeration of salmonellae in different matrices: table eggs, pasteurized egg products, and egg-containing dishes. Salmonella enterica serovar Enteritidis and S. enterica serovar Tennessee were used to artificially contaminate these matrices. The results showed a linear regression between the numbers of salmonellae and the quantification cycle (Cq) values for all matrices used, with the exception of pasteurized egg white. Standard curves were constructed by using both stationary-phase cells and heat-stressed cells, with similar results. Finally, this method was used to evaluate the fate of salmonellae in two egg-containing dishes, long egg and tiramisu, at abused refrigeration temperatures, and results indicated the growth of bacteria over a 1-week period. In conclusion, enrichment qPCR was shown to be reliable for enumeration of salmonellae in different egg products.
S
almonella spp. are the second most commonly reported foodborne infections in Europe, and approximately 40% of human cases are egg related (1). A multistate outbreak of salmonellosis associated with shell eggs was reported in the United States in 2010 (2), and an outbreak associated with home-produced eggs was reported in Poland in 2011 (3). Dishes prepared with raw eggs, such as tiramisu, constitutes a particular problem, as illustrated by human outbreaks in the United Kingdom (4). Pasteurization of liquid egg products is used to reduce the risk of Salmonella infection; however, salmonellae may still be present in the final product due to insufficient killing or postpasteurization contamination (5). For example, chocolate mousse prepared with pasteurized egg white has been reported to be a source of an outbreak associated with Salmonella enterica serovar Enteritidis (6). As emphasized in a review by Malorny et al. (7), quantification of pathogens is essential for microbiological risk assessment. Usually, culture-based methods are used for this purpose, such as most-probable-number (MPN) analysis or direct plating onto selective media. Colony counts on selective plates can confidently quantify only higher levels of bacteria (⬎102 to 103 CFU/g) (7), while lower levels require a culture enrichment step in order to increase the numbers of bacteria detected, but only qualitative data are then obtained. Moreover, confirmation of colonies from selective plates is required (8), which can take several days and is expensive. For this reason, rapid and more user-friendly methods have to be introduced. During the last decade, a number of groups reported PCR as a useful method for detection of Salmonella in different foods (9– 11), including eggs (12–14). Moreover, quantitative real-time PCR (qPCR) combined with different pre-qPCR processing methods have been employed for quantification of salmonellae in various matrices (15–17). In a preliminary study, Seo et al. (18) used qPCR for detection and quantification of salmonellae in samples of pooled eggs and showed a detection limit of 103 CFU/ ml. The levels of salmonellae in eggs have been estimated to be
1616
aem.asm.org
⬍20 CFU/egg within 21 days at room temperature after laying (19), meaning that quantification using qPCR according to that method may not be achieved. Therefore, other approaches are needed. One such alternative is to include a short enrichment step that allows salmonellae to multiply to levels that are quantifiable (15). This approach has been reported for Salmonella in cork borer samples from pig carcasses, where it was concluded that quantification was possible down to a level of 1.4 CFU/sample and that a strict standardization of the method, including the time of enrichment, was crucial to obtain valid results (15). In the present study, the enrichment qPCR principle was employed for enumeration of salmonellae in table eggs, commercial egg products, and egg-containing dishes (long egg and tiramisu). The robustness and reproducibility of the method were assessed by testing in three different laboratories using different DNA extraction methods and PCR thermocyclers. Furthermore, this method was applied for studies of the survival capability of S. Enteritidis in egg-containing dishes during storage at abused refrigeration temperatures. MATERIALS AND METHODS Bacterial strains and culture conditions. S. Enteritidis strains MB2509 (20), RKI:05-5956 (Robert Koch Institut, Germany) (isolated from egg in 2005), and E2187 (21); Salmonella enterica serovar Tennessee strain 201060-1713-1 (national strain collection for food-borne pathogens at DTU
Applied and Environmental Microbiology
Received 9 October 2013 Accepted 18 December 2013 Published ahead of print 20 December 2013 Address correspondence to John Elmerdahl Olsen, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AEM.03360-13. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/AEM.03360-13
p. 1616 –1622
March 2014 Volume 80 Number 5
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Frederiksberg, Denmarka; Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia, Bologna, Italyb; Institute of Food Quality and Food Safety, University of Veterinary Medicine, Hannover, Germanyc; National Food Institute, Technical University of Denmark, Søborg, Denmarkd
qPCR for Salmonellae in Eggs
March 2014 Volume 80 Number 5
spiked products in a water bath at 48°C for 30 min (whole and yolk) or 10 min (white). Two independent experiments and three samples for each concentration were used. One milliliter of spiked egg samples was mixed with 9 ml of BPW (Merck) (1:10 dilution) and incubated at 37°C for 8 h ⫾ 5 min with shaking (additionally, 6-h and 10-h preenrichment periods were investigated for light-pasteurized egg white in preliminary experiments), or 0.1 ml of spiked product was mixed with 9.9 ml of BPW (1:100 dilution) and preenriched in the same way. To investigate a serovar other than S. Enteritidis, S. Tennessee strain 2010-60-1713-1 was used to spike light-pasteurized egg products and preenriched with a 1:100 dilution, as described above. One milliliter of preenriched sample was centrifuged at 15,000 ⫻ g, and pellets were used for DNA extraction. Nonspiked aliquots were used as negative controls. To obtain inactivated cells, a Salmonella suspension in saline of approximately 109 CFU/ml was boiled for 10 min, and 100 l was spread onto XLD agar for confirmation. Heat-killed Salmonella cells were then used to artificially inoculate light-pasteurized whole egg to reach final concentrations of 105 and 106 dead cells/ml. Samples were preenriched in duplicates in 1:100 dilutions and analyzed by qPCR in duplicates. To investigate the possible effect of competing flora on the preenrichment PCR method, light-pasteurized whole-egg samples containing approximately 102 CFU/ml of S. Enteritidis strain E2187 were additionally spiked with four levels of E. coli (approximately 101, 103, 105, and 107 CFU/ml). Samples were further preenriched, as described above, in 1:100 dilutions with two independent experiments and two repeats. (v) Long eggs. Samples of sliced long egg weighing 25 g were artificially inoculated with 100 l of a 10-fold dilution series to reach a final concentration of approximately 101 to 105 CFU/25 g of S. Enteritidis strain MB2509. Samples were stored at 4°C for 1 h before stomaching them in 225 ml of BPW for 1 min at normal speed. Samples were preenriched for 8 h ⫾ 5 min at 37°C with shaking. Standard curves were constructed from two independent experiments with three replicates for each inoculum level. Nonspiked aliquots were used as negative controls. Five milliliters of preenriched sample was centrifuged at 15,000 ⫻ g, and the pellets were used for DNA extraction. (vi) Standard curve in broth. An inoculum of S. Enteritidis strain E2187 was prepared and mixed with Luria-Bertani (LB) broth (Lennox; Becton, Dickinson and Company, Sparks, MD, USA) to a final concentration of approximately 101 to 105 CFU/ml and preenriched in BPW, as described above, with a 1:100 dilution. Pellets from 1 ml were used for DNA extraction. Two independent experiments and three samples for one concentration were used. (vii) Enumeration of salmonellae during different phases of growth. Cells of S. Enteritidis strain E2187 were inoculated in LB broth at a final concentration of approximately 102 CFU/ml and incubated at 37°C with shaking. Samples from five different time points (2, 3, 4, 5, and 6 h after inoculation) were taken to obtain a range of concentrations of cells during growth. In parallel, samples of cells were prepared as described above. Samples were preenriched, as described above, in 1:100 dilutions. Numbers of cells in the inoculum and in preenriched samples were determined by plating of appropriate dilutions onto XLD plates. Two independent experiments and three samples for each concentration were used. To obtain a standard curve for growing Salmonella cells in light-pasteurized whole egg, S. Tennessee strain 2010-60-1713-1 was used to spike the matrix to a final level of approximately 102 CFU/ml, which was then incubated at 37°C for 6 h. At time points from 2 to 6 h, samples were taken each hour, and the initial concentration was determined by plating onto XLD plates. Preenrichment of samples with a 1:100 dilution was performed for 6 h. Pellets from 1 ml were used for DNA extraction. DNA extraction. Two commercially available DNA extraction methods were used according to the instructions of the manufacturers: (i) DNA was extracted from pellets obtained from 5 ml of samples with the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany), and total DNA was eluted in 200 l of Tris-EDTA (TE) buffer, and (ii) 400 l PrepMan Ultra
aem.asm.org 1617
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Food, Denmark) (isolated from liquid egg white in 2010); and Escherichia coli strain MG1655 (22) were used. Strains were grown aerobically at 37°C with shaking in tryptone soy broth (TSB; Oxoid, Basingstoke, United Kingdom) or brain heart infusion (BHI) broth (Merck, Darmstadt, Germany) and harvested by centrifugation or on xylose-lysine-deoxycholate (XLD) agar (Oxoid) plates overnight, and colonies were harvested in physiological saline (0.9% NaCl) to an optical density (OD) value corresponding to a concentration of 109 CFU/ml. Appropriate dilutions were made in saline and used for spiking of different matrices. Viable counts were confirmed by plating appropriate dilutions onto plate count agar (PCA; Oxoid) or XLD agar. Egg products. Fresh, unfertilized table eggs were obtained from hens reared in conventional cages from a local poultry farm (Italy). Tiramisu (Italian dish prepared with non-heat-treated eggs) was prepared by mixing the raw egg content of six fresh table eggs, 500 g of mascarpone (Italian cheese), 100 g of sugar, three biscuits, and 10 ml of coffee from a local supermarket (Italy). Sliced frozen long egg (industrial egg product for preparation of egg slices for open sandwiches) and light-pasteurized egg products— egg white, egg yolk, and whole egg—were obtained from a commercial producer (Danæg, Roskilde, Denmark) and were defrosted for 24 h at 4°C before experiments were performed. Retail pasteurized egg products were obtained from a producer (Wiesenhof, Germany). Artificial inoculation and preenrichment of egg and egg products. (i) Table eggs. Each egg was washed with distilled deionized water (22°C to 25°C). Washed eggs were subsequently sanitized by dipping in ethanol (70%, vol/vol) for 30 min. Sanitized shell eggs were aseptically dried at room temperature for approximately 40 min before inoculation. Eggs were then broken, the egg contents were discarded, and the eggshells were spotted with 100 l of a serially 10-fold-diluted S. Enteritidis strain MB2509 suspension. S. Enteritidis was inoculated at five levels (approximately 101 to 105 CFU/egg) on 10 eggs per inoculum level. Sanitized, uncontaminated shell eggs were used as negative controls. The eggshells were aseptically dried at room temperature for approximately 1 h before dilution of the eggshells in 20 ml of buffered peptone water (BPW; Oxoid) and incubation at 37°C for 8 h ⫾ 5 min with shaking. A 5-ml aliquot of the preenriched sample was centrifuged for 5 min at 3,000 ⫻ g. The supernatant was discarded, and the pellet was washed twice with DNase- and RNase-free water. Pellets were used for DNA extraction. (ii) Tiramisu. Aliquots of 75 g of tiramisu were artificially inoculated with 300 l of a serially 10-fold-diluted S. Enteritidis strain MB2509 suspension prepared as described above. After inoculation, 75 g of tiramisu was homogenized by using a Stomacher 400 laboratory blender (Seward, Worthing, West Sussex, United Kingdom) for 1 min at normal speed and then divided into three portions of 25 g each with a final S. Enteritidis concentration of approximately 101 to 105 CFU/25 g tiramisu. Two independent experiments were performed. Nonspiked aliquots were used as negative controls. After 1 h, samples were diluted 1:10 in BPW and incubated for 8 h ⫾ 5 min at 37°C with shaking. Pellets for DNA extraction were obtained as described above. (iii) Pasteurized egg products. Ten milliliters of liquid pasteurized whole egg, egg yolk, and egg white was filled into sterile plastic bags without a filter. Samples of each product were then artificially inoculated with a 10-fold dilution series of S. Enteritidis strain RKI:05-5956 to reach a final concentration of approximately 100 to 106 CFU/ml, and 90 ml of BPW (Merck, Darmstadt, Germany) was added. Two independent experiments and three samples for each concentration were used. Nonspiked aliquots were used as negative controls. Samples were preenriched for 8 h ⫾ 5 min at 37°C in a shaking water bath. Thereafter, 5 ml of each sample was centrifuged for 10 min at 20,817 ⫻ g. Supernatants were discarded, and the pellets were used for DNA extraction. (iv) Light-pasteurized egg products. Samples of light-pasteurized egg products weighing 9.9 g were artificially inoculated with 100 l of a 10fold dilution series of S. Enteritidis strain E2187 to reach a final concentration of approximately 100 to 105 CFU/ml (higher concentrations were investigated in a few experiments). In parallel, heat stress was applied for
Jakocˇiu ne˙ et al.
RESULTS
Optimization of sample preparation. To optimize and validate that the previously reported enrichment qPCR protocol (15)
1618 aem.asm.org
FIG 1 Standard curve generated from quantification cycle numbers of a 10fold dilution series of an amplicon product of 86 bp cloned into a pCR 2.1 plasmid vector in DNase- and RNase-free water (ⱕ5.00 to 5.00 ⫻ 105 copies/ reaction). qPCR was performed with the Applied Biosystems 7500 Fast realtime PCR system. LG, log10.
worked with different types of egg products, DNA extraction methods, and PCR equipment, initial experiments were carried out. Artificially inoculated light-pasteurized egg white was used to establish the optimal time of enrichment in order to obtain a low detection level that still had a linear correlation with the number of CFU of salmonellae inoculated in the samples. Here, times of 6, 8, and 10 h were compared for the preenrichment time, and a time of 8 h was found to be optimal (data not shown). Detection limit of the real-time PCR assay. Before applying the method to egg matrices, the detection level and linear range of the real-time PCR assay were determined by using known numbers of cloned PCR targets. A preenrichment step was not included in this experiment. The detection level was determined to ⱕ5 gene copies/PCR, which was the lowest number tested, and the standard curve was linear over the tested concentration range of ⱕ5.00 to 5.00 ⫻ 105 gene copies/PCR (Fig. 1). Enumeration of salmonellae in spiked egg, commercial egg products, and egg-containing dishes by enrichment qPCR. In order to investigate the possibility of quantification of small numbers of salmonellae by using the enrichment qPCR procedure, table eggs, liquid commercial egg products, and egg-containing dishes were spiked with S. Enteritidis. A linear relation between the numbers of salmonellae and the quantification cycle (Cq) value was observed at inoculum level ranges of 4.68 ⫻ 100 to 3.24 ⫻ 104 CFU/sample for table eggs, 1.00 ⫻ 100 to 1.10 ⫻ 106 CFU/ml for pasteurized whole egg, 1.00 ⫻ 100 to 1.82 ⫻ 105 CFU/ml for pasteurized egg yolk, 1.23 ⫻ 100 to 9.55 ⫻ 104 CFU/ml for light-pasteurized egg products at a 1:10 dilution, 2.00 ⫻ 100 to 1.48 ⫻ 105 CFU/ml for light-pasteurized egg products at a 1:100 dilution (in preliminary experiments, the upper inoculum level of 105 CFU/ml was exceeded, but higher concentrations no longer gave a linear relation [data not shown]), 3.89 ⫻ 101 to 4.17 ⫻ 104 CFU/25 g for long eggs, and 1.60 ⫻ 101 to 1.60 ⫻ 105 CFU/25 g for tiramisu (see Table S1 in the supplemental material). Pasteurized egg white was the only matrix where data did not fit a linear correlation (P value of 0.013). Pasteurized egg yolk and whole egg showed a linear correlation but with lower R2 values than those of the other products (see Table S1 in the supplemental material). This observation could be explained by different com-
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
reagent (Applied Biosystems, Foster City, CA, USA) was used to extract DNA from pellets obtained from 1 ml of samples. Extracted DNA was stored at ⫺20°C until use. qPCR. A real-time PCR assay was applied for the specific amplification of an 86-bp sequence of the ttrRSBCA locus involved in tetrathionate respiration by using primers ttr-6 (CTCACCAGGAGATTACAACA TGG) and ttr-4 (AGCTCAGACCAAAAGTGACCATC) and an internal amplification control (IAC), as previously described (10). A locked nucleic acid (LNA) target probe (6-FAM [6-carboxyfluorescein]-CG⫹ACG GCG⫹AG⫹ACCG-BHQ1 [black hole quencher 1], where ⫹ indicates an LNA substitution) (Sigma-Proligo, Paris, France) and an IAC probe (JOE [(6-carboxy-4=,5=-dichloro-2=,7=-dimethoxyfluorescein)]-CACA CGGCGACGCGAACGCTTT-BHQ1) (Primm, Milan, Italy) were employed (23). Three slightly different protocols for cyclers were used. (i) Reaction mixtures consisted of 10 l of 2⫻ Fast TaqMan Universal Master mix (Applied Biosystems, Milan, Italy), 2 l of IAC (approximately 1,000 copies; Primm), 0.4 M each primer (ttr-6 and ttr-4; Primm), 0.24 M the LNA target probe, 0.24 M the IAC probe, and 5 l of template DNA in a 20-l total volume. The cycling conditions were 95°C for 20 s and then 45 cycles of 95°C for 3 s and 65°C for 30 s. All DNA samples were tested in triplicate in a Peltier-based real-time PCR instrument (Applied Biosystems 7500 Fast real-time PCR system). (ii) A 25-l PCR mixture contained 12.5 l of Fast qPCR Mastermix Plus–No ROX (Eurogentec, Seraing, Belgium); 1 l of IAC, kindly provided by the Bundesinstitut für Risikobewertung (BfR) (Federal Institute for Risk Assessment) (10); 0.4 M each primer (ttr4 and ttr-6; Eurofins MWG Operon, Germany); 0.24 M the LNA target probe; 0.24 M the IAC probe (Yakima Yellow-CAC ACGGCGACGCGAACGCTTT-BHQ1) (Eurogentec) (10); and 5 l of template DNA. All DNA samples were tested in triplicate with a Light Cycler 480 II instrument (Roche, Germany). Cycling conditions were 50°C for 2 min, 95°C for 5 min, and then 40 cycles of 95°C for 3 s, 65°C for 30 s, and 72°C for 10 s. No-template controls, consisting of 5 l of PCR gradient water instead of DNA, were included to detect contamination. (iii) Twenty-five-microliter PCR mixtures were prepared as described previously (23), with minor changes: the IAC probe was labeled with HEX (6-carboxy-2,4,4,5,7,7-hexachlorofluorescein), and 9 l of DNA template was used (24) on an Mx3005P thermocycler (Stratagene, La Jolla, CA, USA). Establishing the detection limit of the real-time PCR assay. In order to establish the detection limit, an amplicon product of 86 bp cloned into a pCR 2.1 plasmid vector (Eurofins MWG Operon, Ebersberg, Germany) was used. In two independent experiments, a total of five replicates per quantification level of the 10-fold serially diluted plasmid in DNase- and RNase-free water were analyzed in a range of ⱕ5 to 5 ⫻ 105 gene copies per PCR. Survival of salmonellae in egg-containing dishes during storage at abused refrigeration temperatures. Thirty aliquots of 25 g of tiramisu and long eggs were spiked with 100 l of a suspension of S. Enteritidis strain MB2509 to obtain a final Salmonella inoculum level of approximately 103 CFU/25 g. Samples were stored for 7 days at 8°C to 9°C or 10°C, respectively. At days 0, 3, and 7 postinoculation, 10 samples were tested by qPCR. Data analysis. Standard curves were constructed by using GraphPad Prism version 6.02 for Windows (GraphPad Software, La Jolla, CA, USA). Outliers were automatically excluded (Q ⫽ 1%) or detected by Grubb’s test with a P value of ⬍0.05 (GraphPad Software). A run test was performed to confirm that the data fit a straight-line model. For storage experiments, values were interpolated from a standard curve followed by comparisons of numbers of salmonellae in tiramisu after different incubation periods by one-way analysis of variance (ANOVA) and Tukey’s multiple-comparison test.
qPCR for Salmonellae in Eggs
FIG 2 Standard curves generated from quantification cycle numbers of 10fold dilution series of S. Enteritidis strain E2187 (squares) and S. Tennessee strain 2010-60-1713 (circles) in light-pasteurized egg white (101 to 105 CFU/ ml). Preenrichment was performed with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
positions of these products compared to light-pasteurized products but also by the different methods used for these products, and possibly, it was not as suitable as other methods used in this study. Additionally, we wanted to investigate if standard curves obtained for S. Enteritidis could be used for other types of salmonellae. For this reason, spiking was also performed with S. Tennessee, and linear regression was observed in the matrices tested (see Table S1 in the supplemental material). However, significant differences (P value of ⬍0.0001) were observed between standard curves obtained for artificially contaminated light-pasteurized egg white with the two serovars of Salmonella (Fig. 2). To investigate the possible influence of competing flora in egg products on the efficacy of the method, we used E. coli to spike light-pasteurized whole egg at four levels (approximately 101, 103, 105, and 107 CFU/ml). In the range of 101 to 105 CFU/ml, no significant differences were observed for quantification of salmonellae at a level of approximately 102 CFU/ml. However, the highest concentration of competing flora increased Cq values significantly (data not shown). Attempts to establish a common standard curve for quantification of salmonellae in light-pasteurized egg products. To assess the possibility of constructing one common standard curve that could be used for all the tested matrices, the standard curves for the different sample types were compared and supplemented with a standard curve constructed with cultures in LB broth instead of egg product. The results showed no significant differences (P value of 0.108) between S. Enteritidis and S. Tennessee; however, the curve did not well represent the standard curves obtained with egg matrices (Fig. 3). Based on these results, we conclude that a standard curve should be constructed for each matrix. Enumeration of salmonellae during different phases of growth, heat stress, and inactivation. The preenrichment PCR method relies on an assumption of a uniform lag phase of Salmonella in food products. To investigate different conditions and in order to assess the robustness of the method for enumeration of salmonellae during different growth stages and after heat stress and inactivation, appropriate experiments were done. Heatstressed cells were used in light-pasteurized egg products to con-
March 2014 Volume 80 Number 5
fold dilution series of S. Enteritidis strain E2187 and S. Tennessee strain 201060-1713 in light-pasteurized egg products (LPWE, light-pasteurized whole egg; LPEW, light-pasteurized egg white; LPEY, light-pasteurized egg yolk) and LB broth (101 to 105 CFU/ml). Preenrichment was performed with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
struct a PCR standard curve. Figure 4 shows a representative standard curve for heat-treated S. Tennessee in light-pasteurized whole egg, showing that Cq values were significantly higher than those for non-heat-treated cells (P value of 0.0002). In contrast, no significant difference was observed for S. Tennessee in light-pasteurized egg yolk preenriched with a 1:100 dilution (P value of 0.254) and for S. Enteritidis in light-pasteurized whole egg preenriched with a 1:100 dilution (P value of 0.075). When the growth of cells in exponential and stationary phase at the point of inoculation was compared, colony counts from exponentially growing cultures resulted in significantly higher final concentrations (P value of ⬍0.0001) than those from stationary cells (data not shown); this could lead to a loss of linearity after 8 h of preenrichment. Based on these results, a shorter duration (6 h) of preenrichment was employed, and a linear correlation was obtained in range of approximately 2.00 ⫻ 102 to 6.17 ⫻ 104 CFU/ml in lightpasteurized whole egg (see Fig. S1 in the supplemental material). When boiled suspensions of salmonellae in saline were added to light-pasteurized whole egg to a final concentration of 105 dead
FIG 4 Standard curves generated from quantification cycle numbers of 10fold dilution series of S. Tennessee strain 2010-60-1713 (circles) and heatstressed S. Tennessee strain 2010-60-1713 (squares) in light-pasteurized whole egg (101 to 105 CFU/ml). Samples were preenriched with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
aem.asm.org 1619
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
FIG 3 Standard curves generated from quantification cycle numbers of 10-
Jakocˇiu ne˙ et al.
by using the DNeasy Blood and Tissue kit, and qPCR was performed with the Applied Biosystems 7500 Fast real-time PCR system. Asterisks indicate significantly different numbers of bacteria, as determined by qPCR (*, P ⱕ 0.05; ****, P ⱕ 0.0001). LG, log10.
cells per ml, no signal was obtained by qPCR, while a signal from one experiment (Cq values above 34.14) was observed when 106 dead cells were added per ml. Application of the qPCR method for enumeration of salmonellae in egg-containing dishes stored at abused refrigeration temperatures. As an example of a practical application of this method, the survival of S. Enteritidis in egg-containing products (tiramisu and long eggs) stored at temperatures of 8°C to 9°C and 10°C, respectively, corresponding to abused refrigeration temperatures, was investigated. In both dishes, salmonellae were able to survive or even multiply. For tiramisu, a significant decrease (P value of 0.042) in the numbers of cells was observed after 3 days of storage, and a significant increase (P value of 0.018) was observed after 7 days (Fig. 5). For long eggs, enumeration of salmonellae was not possible after either 3 or 7 days of storage, because Cq values were lower than the ones used for generating the standard curve, showing that Salmonella cells were multiplying in the product to a level above 4.17 ⫻ 104 CFU/25 g. DISCUSSION
The use of qPCR for quantification of Salmonella in various foods was demonstrated previously (15, 25, 26). Seo et al. (18) used qPCR for quantification in pooled egg samples; however, the detection limit of 103 CFU/ml must be considered too high in order to be able to quantify naturally occurring levels of salmonellae in eggs (19). To lower the detection limit, other authors employed pre-qPCR processing methods such as preenrichment (27, 28) or matrix lysis (29), but these methods were reported to be qualitative, with only a potential for quantitative use. In the current study, we demonstrate that quantification of salmonellae in table eggs, pasteurized egg products, and commercially available eggcontaining dishes is not only possible by using qPCR after a short nonselective 8-h preenrichment but also highly reproducible. Many different genes have been suggested to be targets for Salmonella detection by PCR (30–33) and qPCR. For the latter, the ttr (10) and invA (34) genes have been the preferred ones. As described previously by Malorny et al. (10), the ttr operon, targeted
1620 aem.asm.org
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
FIG 5 Survival of S. Enteritidis strain MB2509 in tiramisu. DNA was extracted
for the design of primers in the current study, is present in all Salmonella strains, whereas other genes used for this purpose, such as inv, can be lost due to natural deletion (35). The evaluated pre-PCR processing principle was originally suggested by Krämer et al. (15) for enumeration of salmonellae on pig carcasses. This method significantly decreases the detection level of the qPCR method while maintaining the quantification ability. In the current study, a detection level of the enrichment qPCR assay of 100 CFU/ml was obtained. As demonstrated by Krämer et al. (15) and in the current investigation, the short preenrichment step does not interfere with quantification. This method was shown to be robust enough to allow quantification of salmonellae in egg and egg products in three laboratories using different matrices, Salmonella strains and serovars, DNA extraction methods, and qPCR equipment. The only exception was pasteurized egg white, where a linear correlation between the number of CFU and the Cq values was not obtained and, thus, only qualitative results could be obtained. To make it easier to apply this method to end users, such as the food industry, it would be desirable to obtain a common (average) curve of the relation between CFU and Cq values for all egg matrices. We tried to establish such an average relation based on bacteria cultured in laboratory media; however, the curve was found not to represent the relation between CFU and Cq for all the different egg products. Therefore, a specific standard curve should be constructed for each matrix, as previously emphasized by others (36, 37). We also conclude that individual standard curves should be constructed for different thermocyclers. Salmonellae present in food matrices are often stressed due to different treatments in the food chain. To ensure that stressed cells could also be quantified correctly by the enrichment qPCR method, heat-stressed salmonellae were used. Linear correlations were obtained, demonstrating that quantification was possible; however, for five out of seven conditions tested, the Cq values were significantly higher (with a range of P values of 0.0002 to ⬍0.0001) than for nonstressed cells. The use of a standard curve based on heat-stressed cells can therefore be a more adequate alternative if applying the method for enumeration of salmonellae after pasteurization, when cells are likely to be heat stressed. Further studies are needed to determine the effect of other types of stressors. We also observed that DNA released from dead cells did not play a role, since the detection limit was 106 CFU/ml. The current method was developed to quantify salmonellae in eggs and egg products in relation to food safety control. In this situation, salmonellae are normally nondividing, which helps to ensure a uniform (matrix-specific) lag phase, which is a prerequisite for the use of the short-preenrichment approach. However, in certain situations, samples could be drawn from a matrix where the physical and chemical conditions allow growth of Salmonella and where cells would be in an active stage of growth. When investigating this scenario, we found that salmonellae obtained from growing cultures resulted in higher counts after preenrichment than did resting cells (data not shown). This would lead to an overestimation of the number of cells when qPCR is used. A shorter preenrichment time eliminated this problem, showing that a specific setup will be needed to quantify actively growing cells. Further studies are needed to establish this relation in more food matrices. Finally, enrichment qPCR was applied for enumeration of salmonellae in egg-containing dishes during storage at abused refrig-
qPCR for Salmonellae in Eggs
ACKNOWLEDGMENTS We acknowledge Kirsten Michaëlis for excellent technical assistance. We thank K. Pedersen (DTU Food, Denmark) and W. Messens (EFSA, Parma, Italy) for providing bacterial strains and B. Malorny (BfR, Germany) for providing the IAC. Light-pasteurized egg products were kindly provided by Danæg, Roskilde, Denmark. This study was supported by the European Commission through the BASELINE project (grant agreement number 222738).
REFERENCES 1. European Food Safety Authority, European Centre for Disease Prevention and Control. 2012. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2010. EFSA J. 10:2597. http://dx.doi.org/10.2903/j.efsa.2012.2597. 2. Centers for Disease Control and Prevention. 2010. Investigation update: multistate outbreak of human Salmonella Enteritidis infections associated with shell eggs. CDC, Atlanta, GA. 3. Zielicka-Hardy A, Zarowna D, Szych J, Madajczak G, Sadkowska-Todys M. 2012. Ensuring safety of home-produced eggs to control salmonellosis in Poland: lessons from an outbreak in September 2011. Euro Surveill. 17(47): pii⫽20319. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId⫽20 319. 4. Calvert N, Murphy L, Smith A, Copeland D. 2007. A hotel-based outbreak of Salmonella enterica subsp. enterica serovar Enteritidis (Salmonella Enteritidis) in the United Kingdom, 2006. Euro Surveill. 12(3):pii⫽689. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId⫽689. 5. HPA. 2012. Salmonella Enteritidis PT1 associated with consumption of liquid egg product. Health protection report 6. Health Protection Agency, London, United Kingdom. http://www.hpa.org.uk/hpr/archives/2012 /hpr4212.pdf. 6. HPA. 2007. Two outbreaks of salmonellosis in the United Kingdom and Channel Islands putatively linked to imported pasteurised egg products. Health protection report 1. Health Protection Agency, London, United Kingdom. http://www.hpa.org.uk/hpr/archives/2007/hpr4507.pdf. 7. Malorny B, Löfström C, Wagner M, Krämer N, Hoorfar J. 2008. Enumeration of Salmonella bacteria in food and feed samples by real-time PCR for quantitative microbial risk assessment. Appl. Environ. Microbiol. 74:1299 –1304. http://dx.doi.org/10.1128/AEM.02489-07. 8. Anonymous. 2002. Microbiology of food and animal feeding stuffs. Horizontal method for the detection of Salmonella (EN ISO 6579:2002). International Organization for Standardization, Geneva, Switzerland. 9. Gonzalez-Escalona N, Hammack TS, Russell M, Jacobson AP, De Jesus AJ, Brown EW, Lampel KA. 2009. Detection of live Salmonella sp. cells in produce by a TaqMan-based quantitative reverse transcriptase real-time PCR targeting invA mRNA. Appl. Environ. Microbiol. 75:3714 –3720. http://dx.doi.org/10.1128/AEM.02686-08. 10. Malorny B, Paccassoni E, Fach P, Bunge C, Martin A, Helmuth R. 2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl. Environ. Microbiol. 70:7046 –7052. http://dx.doi.org/10.1128/AEM .70.12.7046-7052.2004. 11. Hein I, Flekna G, Krassnig M, Wagner M. 2006. Real-time PCR for the detection of Salmonella spp. in food: an alternative approach to a conventional PCR system suggested by the FOOD-PCR project. J. Microbiol. Methods 66:538 –547. http://dx.doi.org/10.1016/j.mimet.2006.02.008.
March 2014 Volume 80 Number 5
12. Malorny B, Bunge C, Helmuth R. 2007. A real-time PCR for the detection of Salmonella Enteritidis in poultry meat and consumption eggs. J. Microbiol. Methods 70:245–251. http://dx.doi.org/10.1016/j.mimet.2007 .04.013. 13. Woodward MJ, Kirwan SE. 1996. Detection of Salmonella enteritidis in eggs by the polymerase chain reaction. Vet. Rec. 138:411– 413. http://dx .doi.org/10.1136/vr.138.17.411. 14. Rijpens N, Herman L, Vereecken F, Jannes G, De Smedt J, De Zutter L. 1999. Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separation and PCR. Int. J. Food Microbiol. 46:37– 44. http://dx.doi.org/10.1016/S0168-1605(98)00171-8. 15. Krämer N, Löfström C, Vigre H, Hoorfar J, Bunge C, Malorny B. 2011. A novel strategy to obtain quantitative data for modelling: combined enrichment and real-time PCR for enumeration of salmonellae from pig carcasses. Int. J. Food Microbiol. 145(Suppl 1):S86 –S95. http://dx.doi.org /10.1016/j.ijfoodmicro.2010.08.026. 16. Löfström C, Schelin J, Norling B, Vigre H, Hoorfar J, Rådström P. 2011. Culture-independent quantification of Salmonella enterica in carcass gauze swabs by flotation prior to real-time PCR. Int. J. Food Microbiol. 145(Suppl 1):S103–S109. http://dx.doi.org/10.1016/j.ijfoodmicro.2010 .03.042. 17. Wolffs PF, Glencross K, Thibaudeau R, Griffiths MW. 2006. Direct quantitation and detection of salmonellae in biological samples without enrichment, using two-step filtration and real-time PCR. Appl. Environ. Microbiol. 72:3896 –3900. http://dx.doi.org/10.1128/AEM.02112-05. 18. Seo KH, Valentin-Bon IE, Brackett RE, Holt PS. 2004. Rapid, specific detection of Salmonella Enteritidis in pooled eggs by real-time PCR. J. Food Prot. 67:864 – 869. 19. Humphrey TJ, Whitehead A, Gawler AH, Henley A, Rowe B. 1991. Numbers of Salmonella enteritidis in the contents of naturally contaminated hens’ eggs. Epidemiol. Infect. 106:489 – 496. http://dx.doi.org/10 .1017/S0950268800067546. 20. De Reu K, Grijspeerdt K, Heyndrickx M, Messens W, Uyttendaele M, Debevere J, Herman L. 2006. Influence of eggshell condensation on eggshell penetration and whole egg contamination with Salmonella enterica serovar Enteritidis. J. Food Prot. 69:1539 –1545. 21. Olsen JE, Skov MN, Threlfall EJ, Brown DJ. 1994. Clonal lines of Salmonella enterica serotype Enteritidis documented by IS200-, ribo-, pulsed-field gel electrophoresis and RFLP typing. J. Med. Microbiol. 40: 15–22. http://dx.doi.org/10.1099/00222615-40-1-15. 22. Blattner FR, Plunkett G, III, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA, Goeden MA, Rose DJ, Mau B, Shao Y. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453– 1462. http://dx.doi.org/10.1126/science.277.5331.1453. 23. Josefsen MH, Krause M, Hansen F, Hoorfar J. 2007. Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat. Appl. Environ. Microbiol. 73:3040 –3048. http://dx.doi.org/10 .1128/AEM.02823-06. 24. Löfström C, Krause M, Josefsen MH, Hansen F, Hoorfar J. 2009. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella. BMC Microbiol. 9:85. http://dx.doi.org/10 .1186/1471-2180-9-85. 25. Seo KH, Valentin-Bon IE, Brackett RE. 2006. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods. J. Food Prot. 69:639 – 643. 26. Kumar R, Surendran PK, Thampuran N. 2010. Rapid quantification of Salmonella in seafood by real-time PCR assay. J. Microbiol. Biotechnol. 20:569 –573. http://dx.doi.org/10.4014/jmb.0904.04040. 27. Day JB, Basavanna U, Sharma SK. 2009. Development of a cell culture method to isolate and enrich Salmonella enterica serotype Enteritidis from shell eggs for subsequent detection by real-time PCR. Appl. Environ. Microbiol. 75:5321–5327. http://dx.doi.org/10.1128/AEM.02422-08. 28. Chen J, Zhang L, Paoli GC, Shi C, Tu SI, Shi X. 2010. A real-time PCR method for the detection of Salmonella enterica from food using a target sequence identified by comparative genomic analysis. Int. J. Food Microbiol. 137:168 –174. http://dx.doi.org/10.1016/j.ijfoodmicro.2009.12.004. 29. Mayrl E, Roeder B, Mester P, Wagner M, Rossmanith P. 2009. Broad range evaluation of the matrix solubilization (matrix lysis) strategy for direct enumeration of foodborne pathogens by nucleic acids technologies. J. Food Prot. 72:1225–1233. 30. Aabo S, Rasmussen OF, Rossen L, Sorensen PD, Olsen JE. 1993.
aem.asm.org 1621
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
eration temperatures. These results demonstrate the influence that temperatures just a few degrees above the recommended refrigeration temperature can have on the growth of Salmonella in ready-to-eat products. In conclusion, we demonstrate the ability of enrichment qPCR to enumerate salmonellae in different egg products. Due to the use of a short preenrichment step, quantitative data can be obtained faster than with culture-based methods, which is crucial for the food industry to be able to test and release products. Moreover, we applied the method to investigate the fate of salmonellae in eggcontaining dishes stored at abused refrigeration temperatures. It should be noted that enrichment qPCR needs a standard curve for each specific matrix, and the possibility of cells being stressed should be considered.
Jakocˇiu ne˙ et al.
31.
32. 33.
1622 aem.asm.org
cells in the air of livestock stables by real-time PCR. Ann. Occup. Hyg. 53:859 – 868. http://dx.doi.org/10.1093/annhyg/mep060. 35. Ginocchio CC, Rahn K, Clarke RC, Galan JE. 1997. Naturally occurring deletions in the centisome 63 pathogenicity island of environmental isolates of Salmonella spp. Infect. Immun. 65:1267–1272. 36. Schelin J, Andersson G, Vigre H, Norling B, Häggblom P, Hoorfar J, Rådström P, Löfström C. 24 September 2013, posting date. Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed. J. Appl. Microbiol. http://dx.doi.org /10.1111/jam.12337. 37. Cocolin L, Rajkovic A, Rantsiou K, Uyttendaele M. 2011. The challenge of merging food safety diagnostic needs with quantitative PCR platforms. Trends Food Sci. Technol. 22:S30 –S38. http://dx.doi.org/10.1016/j.tifs .2011.02.009.
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
34.
Salmonella identification by the polymerase chain reaction. Mol. Cell. Probes 7:171–178. http://dx.doi.org/10.1006/mcpr.1993.1026. Malorny B, Cook N, D’Agostino M, De Medici D, Croci L, Abdulmawjood A, Fach P, Karpiskova R, Aymerich T, Kwaitek K, Kuchta T, Hoorfar J. 2004. Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples. J. AOAC Int. 87:861– 866. Bej AK, Mahbubani MH, Boyce MJ, Atlas RM. 1994. Detection of Salmonella spp. in oysters by PCR. Appl. Environ. Microbiol. 60:368 –373. Cra˘ciunas¸ C, Keul AL, Flonta M, Cristea M. 2012. DNA-based diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and sef genes. J. Environ. Manage. 95(Suppl):S15–S18. http://dx.doi.org/10.1016 /j.jenvman.2010.07.027. Fallschissel K, Kampfer P, Jackel U. 2009. Direct detection of salmonella
Updated information and services can be found at: http://aem.asm.org/content/80/5/1616 These include: SUPPLEMENTAL MATERIAL REFERENCES
CONTENT ALERTS
Supplemental material This article cites 31 articles, 12 of which can be accessed free at: http://aem.asm.org/content/80/5/1616#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Dziuginta Jakociune, Frédérique Pasquali, Cristiana Soares da Silva, Charlotta Löfström, Jeffrey Hoorfar, Günter Klein, Gerardo Manfreda and John Elmerdahl Olsen Appl. Environ. Microbiol. 2014, 80(5):1616. DOI: 10.1128/AEM.03360-13. Published Ahead of Print 20 December 2013.
Enumeration of Salmonellae in Table Eggs, Pasteurized Egg Products, and Egg-Containing Dishes by Using Quantitative Real-Time PCR Džiuginta Jakocˇiu ne˙,a Frédérique Pasquali,b Cristiana Soares da Silva,c Charlotta Löfström,d Jeffrey Hoorfar,d Günter Klein,c Gerardo Manfreda,b John Elmerdahl Olsena
Salmonellae are a major cause of food-borne outbreaks in Europe, with eggs and egg products being identified as major sources. Due to the low levels of salmonellae in eggs and egg products, direct quantification is difficult. In the present study, enrichment quantitative real-time PCR (qPCR) was employed for enumeration of salmonellae in different matrices: table eggs, pasteurized egg products, and egg-containing dishes. Salmonella enterica serovar Enteritidis and S. enterica serovar Tennessee were used to artificially contaminate these matrices. The results showed a linear regression between the numbers of salmonellae and the quantification cycle (Cq) values for all matrices used, with the exception of pasteurized egg white. Standard curves were constructed by using both stationary-phase cells and heat-stressed cells, with similar results. Finally, this method was used to evaluate the fate of salmonellae in two egg-containing dishes, long egg and tiramisu, at abused refrigeration temperatures, and results indicated the growth of bacteria over a 1-week period. In conclusion, enrichment qPCR was shown to be reliable for enumeration of salmonellae in different egg products.
S
almonella spp. are the second most commonly reported foodborne infections in Europe, and approximately 40% of human cases are egg related (1). A multistate outbreak of salmonellosis associated with shell eggs was reported in the United States in 2010 (2), and an outbreak associated with home-produced eggs was reported in Poland in 2011 (3). Dishes prepared with raw eggs, such as tiramisu, constitutes a particular problem, as illustrated by human outbreaks in the United Kingdom (4). Pasteurization of liquid egg products is used to reduce the risk of Salmonella infection; however, salmonellae may still be present in the final product due to insufficient killing or postpasteurization contamination (5). For example, chocolate mousse prepared with pasteurized egg white has been reported to be a source of an outbreak associated with Salmonella enterica serovar Enteritidis (6). As emphasized in a review by Malorny et al. (7), quantification of pathogens is essential for microbiological risk assessment. Usually, culture-based methods are used for this purpose, such as most-probable-number (MPN) analysis or direct plating onto selective media. Colony counts on selective plates can confidently quantify only higher levels of bacteria (⬎102 to 103 CFU/g) (7), while lower levels require a culture enrichment step in order to increase the numbers of bacteria detected, but only qualitative data are then obtained. Moreover, confirmation of colonies from selective plates is required (8), which can take several days and is expensive. For this reason, rapid and more user-friendly methods have to be introduced. During the last decade, a number of groups reported PCR as a useful method for detection of Salmonella in different foods (9– 11), including eggs (12–14). Moreover, quantitative real-time PCR (qPCR) combined with different pre-qPCR processing methods have been employed for quantification of salmonellae in various matrices (15–17). In a preliminary study, Seo et al. (18) used qPCR for detection and quantification of salmonellae in samples of pooled eggs and showed a detection limit of 103 CFU/ ml. The levels of salmonellae in eggs have been estimated to be
1616
aem.asm.org
⬍20 CFU/egg within 21 days at room temperature after laying (19), meaning that quantification using qPCR according to that method may not be achieved. Therefore, other approaches are needed. One such alternative is to include a short enrichment step that allows salmonellae to multiply to levels that are quantifiable (15). This approach has been reported for Salmonella in cork borer samples from pig carcasses, where it was concluded that quantification was possible down to a level of 1.4 CFU/sample and that a strict standardization of the method, including the time of enrichment, was crucial to obtain valid results (15). In the present study, the enrichment qPCR principle was employed for enumeration of salmonellae in table eggs, commercial egg products, and egg-containing dishes (long egg and tiramisu). The robustness and reproducibility of the method were assessed by testing in three different laboratories using different DNA extraction methods and PCR thermocyclers. Furthermore, this method was applied for studies of the survival capability of S. Enteritidis in egg-containing dishes during storage at abused refrigeration temperatures. MATERIALS AND METHODS Bacterial strains and culture conditions. S. Enteritidis strains MB2509 (20), RKI:05-5956 (Robert Koch Institut, Germany) (isolated from egg in 2005), and E2187 (21); Salmonella enterica serovar Tennessee strain 201060-1713-1 (national strain collection for food-borne pathogens at DTU
Applied and Environmental Microbiology
Received 9 October 2013 Accepted 18 December 2013 Published ahead of print 20 December 2013 Address correspondence to John Elmerdahl Olsen, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AEM.03360-13. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/AEM.03360-13
p. 1616 –1622
March 2014 Volume 80 Number 5
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Department of Veterinary Disease Biology, Faculty of Health and Medical Sciences, University of Copenhagen, Frederiksberg, Denmarka; Department of Veterinary Medical Sciences, University of Bologna, Ozzano Emilia, Bologna, Italyb; Institute of Food Quality and Food Safety, University of Veterinary Medicine, Hannover, Germanyc; National Food Institute, Technical University of Denmark, Søborg, Denmarkd
qPCR for Salmonellae in Eggs
March 2014 Volume 80 Number 5
spiked products in a water bath at 48°C for 30 min (whole and yolk) or 10 min (white). Two independent experiments and three samples for each concentration were used. One milliliter of spiked egg samples was mixed with 9 ml of BPW (Merck) (1:10 dilution) and incubated at 37°C for 8 h ⫾ 5 min with shaking (additionally, 6-h and 10-h preenrichment periods were investigated for light-pasteurized egg white in preliminary experiments), or 0.1 ml of spiked product was mixed with 9.9 ml of BPW (1:100 dilution) and preenriched in the same way. To investigate a serovar other than S. Enteritidis, S. Tennessee strain 2010-60-1713-1 was used to spike light-pasteurized egg products and preenriched with a 1:100 dilution, as described above. One milliliter of preenriched sample was centrifuged at 15,000 ⫻ g, and pellets were used for DNA extraction. Nonspiked aliquots were used as negative controls. To obtain inactivated cells, a Salmonella suspension in saline of approximately 109 CFU/ml was boiled for 10 min, and 100 l was spread onto XLD agar for confirmation. Heat-killed Salmonella cells were then used to artificially inoculate light-pasteurized whole egg to reach final concentrations of 105 and 106 dead cells/ml. Samples were preenriched in duplicates in 1:100 dilutions and analyzed by qPCR in duplicates. To investigate the possible effect of competing flora on the preenrichment PCR method, light-pasteurized whole-egg samples containing approximately 102 CFU/ml of S. Enteritidis strain E2187 were additionally spiked with four levels of E. coli (approximately 101, 103, 105, and 107 CFU/ml). Samples were further preenriched, as described above, in 1:100 dilutions with two independent experiments and two repeats. (v) Long eggs. Samples of sliced long egg weighing 25 g were artificially inoculated with 100 l of a 10-fold dilution series to reach a final concentration of approximately 101 to 105 CFU/25 g of S. Enteritidis strain MB2509. Samples were stored at 4°C for 1 h before stomaching them in 225 ml of BPW for 1 min at normal speed. Samples were preenriched for 8 h ⫾ 5 min at 37°C with shaking. Standard curves were constructed from two independent experiments with three replicates for each inoculum level. Nonspiked aliquots were used as negative controls. Five milliliters of preenriched sample was centrifuged at 15,000 ⫻ g, and the pellets were used for DNA extraction. (vi) Standard curve in broth. An inoculum of S. Enteritidis strain E2187 was prepared and mixed with Luria-Bertani (LB) broth (Lennox; Becton, Dickinson and Company, Sparks, MD, USA) to a final concentration of approximately 101 to 105 CFU/ml and preenriched in BPW, as described above, with a 1:100 dilution. Pellets from 1 ml were used for DNA extraction. Two independent experiments and three samples for one concentration were used. (vii) Enumeration of salmonellae during different phases of growth. Cells of S. Enteritidis strain E2187 were inoculated in LB broth at a final concentration of approximately 102 CFU/ml and incubated at 37°C with shaking. Samples from five different time points (2, 3, 4, 5, and 6 h after inoculation) were taken to obtain a range of concentrations of cells during growth. In parallel, samples of cells were prepared as described above. Samples were preenriched, as described above, in 1:100 dilutions. Numbers of cells in the inoculum and in preenriched samples were determined by plating of appropriate dilutions onto XLD plates. Two independent experiments and three samples for each concentration were used. To obtain a standard curve for growing Salmonella cells in light-pasteurized whole egg, S. Tennessee strain 2010-60-1713-1 was used to spike the matrix to a final level of approximately 102 CFU/ml, which was then incubated at 37°C for 6 h. At time points from 2 to 6 h, samples were taken each hour, and the initial concentration was determined by plating onto XLD plates. Preenrichment of samples with a 1:100 dilution was performed for 6 h. Pellets from 1 ml were used for DNA extraction. DNA extraction. Two commercially available DNA extraction methods were used according to the instructions of the manufacturers: (i) DNA was extracted from pellets obtained from 5 ml of samples with the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany), and total DNA was eluted in 200 l of Tris-EDTA (TE) buffer, and (ii) 400 l PrepMan Ultra
aem.asm.org 1617
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
Food, Denmark) (isolated from liquid egg white in 2010); and Escherichia coli strain MG1655 (22) were used. Strains were grown aerobically at 37°C with shaking in tryptone soy broth (TSB; Oxoid, Basingstoke, United Kingdom) or brain heart infusion (BHI) broth (Merck, Darmstadt, Germany) and harvested by centrifugation or on xylose-lysine-deoxycholate (XLD) agar (Oxoid) plates overnight, and colonies were harvested in physiological saline (0.9% NaCl) to an optical density (OD) value corresponding to a concentration of 109 CFU/ml. Appropriate dilutions were made in saline and used for spiking of different matrices. Viable counts were confirmed by plating appropriate dilutions onto plate count agar (PCA; Oxoid) or XLD agar. Egg products. Fresh, unfertilized table eggs were obtained from hens reared in conventional cages from a local poultry farm (Italy). Tiramisu (Italian dish prepared with non-heat-treated eggs) was prepared by mixing the raw egg content of six fresh table eggs, 500 g of mascarpone (Italian cheese), 100 g of sugar, three biscuits, and 10 ml of coffee from a local supermarket (Italy). Sliced frozen long egg (industrial egg product for preparation of egg slices for open sandwiches) and light-pasteurized egg products— egg white, egg yolk, and whole egg—were obtained from a commercial producer (Danæg, Roskilde, Denmark) and were defrosted for 24 h at 4°C before experiments were performed. Retail pasteurized egg products were obtained from a producer (Wiesenhof, Germany). Artificial inoculation and preenrichment of egg and egg products. (i) Table eggs. Each egg was washed with distilled deionized water (22°C to 25°C). Washed eggs were subsequently sanitized by dipping in ethanol (70%, vol/vol) for 30 min. Sanitized shell eggs were aseptically dried at room temperature for approximately 40 min before inoculation. Eggs were then broken, the egg contents were discarded, and the eggshells were spotted with 100 l of a serially 10-fold-diluted S. Enteritidis strain MB2509 suspension. S. Enteritidis was inoculated at five levels (approximately 101 to 105 CFU/egg) on 10 eggs per inoculum level. Sanitized, uncontaminated shell eggs were used as negative controls. The eggshells were aseptically dried at room temperature for approximately 1 h before dilution of the eggshells in 20 ml of buffered peptone water (BPW; Oxoid) and incubation at 37°C for 8 h ⫾ 5 min with shaking. A 5-ml aliquot of the preenriched sample was centrifuged for 5 min at 3,000 ⫻ g. The supernatant was discarded, and the pellet was washed twice with DNase- and RNase-free water. Pellets were used for DNA extraction. (ii) Tiramisu. Aliquots of 75 g of tiramisu were artificially inoculated with 300 l of a serially 10-fold-diluted S. Enteritidis strain MB2509 suspension prepared as described above. After inoculation, 75 g of tiramisu was homogenized by using a Stomacher 400 laboratory blender (Seward, Worthing, West Sussex, United Kingdom) for 1 min at normal speed and then divided into three portions of 25 g each with a final S. Enteritidis concentration of approximately 101 to 105 CFU/25 g tiramisu. Two independent experiments were performed. Nonspiked aliquots were used as negative controls. After 1 h, samples were diluted 1:10 in BPW and incubated for 8 h ⫾ 5 min at 37°C with shaking. Pellets for DNA extraction were obtained as described above. (iii) Pasteurized egg products. Ten milliliters of liquid pasteurized whole egg, egg yolk, and egg white was filled into sterile plastic bags without a filter. Samples of each product were then artificially inoculated with a 10-fold dilution series of S. Enteritidis strain RKI:05-5956 to reach a final concentration of approximately 100 to 106 CFU/ml, and 90 ml of BPW (Merck, Darmstadt, Germany) was added. Two independent experiments and three samples for each concentration were used. Nonspiked aliquots were used as negative controls. Samples were preenriched for 8 h ⫾ 5 min at 37°C in a shaking water bath. Thereafter, 5 ml of each sample was centrifuged for 10 min at 20,817 ⫻ g. Supernatants were discarded, and the pellets were used for DNA extraction. (iv) Light-pasteurized egg products. Samples of light-pasteurized egg products weighing 9.9 g were artificially inoculated with 100 l of a 10fold dilution series of S. Enteritidis strain E2187 to reach a final concentration of approximately 100 to 105 CFU/ml (higher concentrations were investigated in a few experiments). In parallel, heat stress was applied for
Jakocˇiu ne˙ et al.
RESULTS
Optimization of sample preparation. To optimize and validate that the previously reported enrichment qPCR protocol (15)
1618 aem.asm.org
FIG 1 Standard curve generated from quantification cycle numbers of a 10fold dilution series of an amplicon product of 86 bp cloned into a pCR 2.1 plasmid vector in DNase- and RNase-free water (ⱕ5.00 to 5.00 ⫻ 105 copies/ reaction). qPCR was performed with the Applied Biosystems 7500 Fast realtime PCR system. LG, log10.
worked with different types of egg products, DNA extraction methods, and PCR equipment, initial experiments were carried out. Artificially inoculated light-pasteurized egg white was used to establish the optimal time of enrichment in order to obtain a low detection level that still had a linear correlation with the number of CFU of salmonellae inoculated in the samples. Here, times of 6, 8, and 10 h were compared for the preenrichment time, and a time of 8 h was found to be optimal (data not shown). Detection limit of the real-time PCR assay. Before applying the method to egg matrices, the detection level and linear range of the real-time PCR assay were determined by using known numbers of cloned PCR targets. A preenrichment step was not included in this experiment. The detection level was determined to ⱕ5 gene copies/PCR, which was the lowest number tested, and the standard curve was linear over the tested concentration range of ⱕ5.00 to 5.00 ⫻ 105 gene copies/PCR (Fig. 1). Enumeration of salmonellae in spiked egg, commercial egg products, and egg-containing dishes by enrichment qPCR. In order to investigate the possibility of quantification of small numbers of salmonellae by using the enrichment qPCR procedure, table eggs, liquid commercial egg products, and egg-containing dishes were spiked with S. Enteritidis. A linear relation between the numbers of salmonellae and the quantification cycle (Cq) value was observed at inoculum level ranges of 4.68 ⫻ 100 to 3.24 ⫻ 104 CFU/sample for table eggs, 1.00 ⫻ 100 to 1.10 ⫻ 106 CFU/ml for pasteurized whole egg, 1.00 ⫻ 100 to 1.82 ⫻ 105 CFU/ml for pasteurized egg yolk, 1.23 ⫻ 100 to 9.55 ⫻ 104 CFU/ml for light-pasteurized egg products at a 1:10 dilution, 2.00 ⫻ 100 to 1.48 ⫻ 105 CFU/ml for light-pasteurized egg products at a 1:100 dilution (in preliminary experiments, the upper inoculum level of 105 CFU/ml was exceeded, but higher concentrations no longer gave a linear relation [data not shown]), 3.89 ⫻ 101 to 4.17 ⫻ 104 CFU/25 g for long eggs, and 1.60 ⫻ 101 to 1.60 ⫻ 105 CFU/25 g for tiramisu (see Table S1 in the supplemental material). Pasteurized egg white was the only matrix where data did not fit a linear correlation (P value of 0.013). Pasteurized egg yolk and whole egg showed a linear correlation but with lower R2 values than those of the other products (see Table S1 in the supplemental material). This observation could be explained by different com-
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
reagent (Applied Biosystems, Foster City, CA, USA) was used to extract DNA from pellets obtained from 1 ml of samples. Extracted DNA was stored at ⫺20°C until use. qPCR. A real-time PCR assay was applied for the specific amplification of an 86-bp sequence of the ttrRSBCA locus involved in tetrathionate respiration by using primers ttr-6 (CTCACCAGGAGATTACAACA TGG) and ttr-4 (AGCTCAGACCAAAAGTGACCATC) and an internal amplification control (IAC), as previously described (10). A locked nucleic acid (LNA) target probe (6-FAM [6-carboxyfluorescein]-CG⫹ACG GCG⫹AG⫹ACCG-BHQ1 [black hole quencher 1], where ⫹ indicates an LNA substitution) (Sigma-Proligo, Paris, France) and an IAC probe (JOE [(6-carboxy-4=,5=-dichloro-2=,7=-dimethoxyfluorescein)]-CACA CGGCGACGCGAACGCTTT-BHQ1) (Primm, Milan, Italy) were employed (23). Three slightly different protocols for cyclers were used. (i) Reaction mixtures consisted of 10 l of 2⫻ Fast TaqMan Universal Master mix (Applied Biosystems, Milan, Italy), 2 l of IAC (approximately 1,000 copies; Primm), 0.4 M each primer (ttr-6 and ttr-4; Primm), 0.24 M the LNA target probe, 0.24 M the IAC probe, and 5 l of template DNA in a 20-l total volume. The cycling conditions were 95°C for 20 s and then 45 cycles of 95°C for 3 s and 65°C for 30 s. All DNA samples were tested in triplicate in a Peltier-based real-time PCR instrument (Applied Biosystems 7500 Fast real-time PCR system). (ii) A 25-l PCR mixture contained 12.5 l of Fast qPCR Mastermix Plus–No ROX (Eurogentec, Seraing, Belgium); 1 l of IAC, kindly provided by the Bundesinstitut für Risikobewertung (BfR) (Federal Institute for Risk Assessment) (10); 0.4 M each primer (ttr4 and ttr-6; Eurofins MWG Operon, Germany); 0.24 M the LNA target probe; 0.24 M the IAC probe (Yakima Yellow-CAC ACGGCGACGCGAACGCTTT-BHQ1) (Eurogentec) (10); and 5 l of template DNA. All DNA samples were tested in triplicate with a Light Cycler 480 II instrument (Roche, Germany). Cycling conditions were 50°C for 2 min, 95°C for 5 min, and then 40 cycles of 95°C for 3 s, 65°C for 30 s, and 72°C for 10 s. No-template controls, consisting of 5 l of PCR gradient water instead of DNA, were included to detect contamination. (iii) Twenty-five-microliter PCR mixtures were prepared as described previously (23), with minor changes: the IAC probe was labeled with HEX (6-carboxy-2,4,4,5,7,7-hexachlorofluorescein), and 9 l of DNA template was used (24) on an Mx3005P thermocycler (Stratagene, La Jolla, CA, USA). Establishing the detection limit of the real-time PCR assay. In order to establish the detection limit, an amplicon product of 86 bp cloned into a pCR 2.1 plasmid vector (Eurofins MWG Operon, Ebersberg, Germany) was used. In two independent experiments, a total of five replicates per quantification level of the 10-fold serially diluted plasmid in DNase- and RNase-free water were analyzed in a range of ⱕ5 to 5 ⫻ 105 gene copies per PCR. Survival of salmonellae in egg-containing dishes during storage at abused refrigeration temperatures. Thirty aliquots of 25 g of tiramisu and long eggs were spiked with 100 l of a suspension of S. Enteritidis strain MB2509 to obtain a final Salmonella inoculum level of approximately 103 CFU/25 g. Samples were stored for 7 days at 8°C to 9°C or 10°C, respectively. At days 0, 3, and 7 postinoculation, 10 samples were tested by qPCR. Data analysis. Standard curves were constructed by using GraphPad Prism version 6.02 for Windows (GraphPad Software, La Jolla, CA, USA). Outliers were automatically excluded (Q ⫽ 1%) or detected by Grubb’s test with a P value of ⬍0.05 (GraphPad Software). A run test was performed to confirm that the data fit a straight-line model. For storage experiments, values were interpolated from a standard curve followed by comparisons of numbers of salmonellae in tiramisu after different incubation periods by one-way analysis of variance (ANOVA) and Tukey’s multiple-comparison test.
qPCR for Salmonellae in Eggs
FIG 2 Standard curves generated from quantification cycle numbers of 10fold dilution series of S. Enteritidis strain E2187 (squares) and S. Tennessee strain 2010-60-1713 (circles) in light-pasteurized egg white (101 to 105 CFU/ ml). Preenrichment was performed with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
positions of these products compared to light-pasteurized products but also by the different methods used for these products, and possibly, it was not as suitable as other methods used in this study. Additionally, we wanted to investigate if standard curves obtained for S. Enteritidis could be used for other types of salmonellae. For this reason, spiking was also performed with S. Tennessee, and linear regression was observed in the matrices tested (see Table S1 in the supplemental material). However, significant differences (P value of ⬍0.0001) were observed between standard curves obtained for artificially contaminated light-pasteurized egg white with the two serovars of Salmonella (Fig. 2). To investigate the possible influence of competing flora in egg products on the efficacy of the method, we used E. coli to spike light-pasteurized whole egg at four levels (approximately 101, 103, 105, and 107 CFU/ml). In the range of 101 to 105 CFU/ml, no significant differences were observed for quantification of salmonellae at a level of approximately 102 CFU/ml. However, the highest concentration of competing flora increased Cq values significantly (data not shown). Attempts to establish a common standard curve for quantification of salmonellae in light-pasteurized egg products. To assess the possibility of constructing one common standard curve that could be used for all the tested matrices, the standard curves for the different sample types were compared and supplemented with a standard curve constructed with cultures in LB broth instead of egg product. The results showed no significant differences (P value of 0.108) between S. Enteritidis and S. Tennessee; however, the curve did not well represent the standard curves obtained with egg matrices (Fig. 3). Based on these results, we conclude that a standard curve should be constructed for each matrix. Enumeration of salmonellae during different phases of growth, heat stress, and inactivation. The preenrichment PCR method relies on an assumption of a uniform lag phase of Salmonella in food products. To investigate different conditions and in order to assess the robustness of the method for enumeration of salmonellae during different growth stages and after heat stress and inactivation, appropriate experiments were done. Heatstressed cells were used in light-pasteurized egg products to con-
March 2014 Volume 80 Number 5
fold dilution series of S. Enteritidis strain E2187 and S. Tennessee strain 201060-1713 in light-pasteurized egg products (LPWE, light-pasteurized whole egg; LPEW, light-pasteurized egg white; LPEY, light-pasteurized egg yolk) and LB broth (101 to 105 CFU/ml). Preenrichment was performed with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
struct a PCR standard curve. Figure 4 shows a representative standard curve for heat-treated S. Tennessee in light-pasteurized whole egg, showing that Cq values were significantly higher than those for non-heat-treated cells (P value of 0.0002). In contrast, no significant difference was observed for S. Tennessee in light-pasteurized egg yolk preenriched with a 1:100 dilution (P value of 0.254) and for S. Enteritidis in light-pasteurized whole egg preenriched with a 1:100 dilution (P value of 0.075). When the growth of cells in exponential and stationary phase at the point of inoculation was compared, colony counts from exponentially growing cultures resulted in significantly higher final concentrations (P value of ⬍0.0001) than those from stationary cells (data not shown); this could lead to a loss of linearity after 8 h of preenrichment. Based on these results, a shorter duration (6 h) of preenrichment was employed, and a linear correlation was obtained in range of approximately 2.00 ⫻ 102 to 6.17 ⫻ 104 CFU/ml in lightpasteurized whole egg (see Fig. S1 in the supplemental material). When boiled suspensions of salmonellae in saline were added to light-pasteurized whole egg to a final concentration of 105 dead
FIG 4 Standard curves generated from quantification cycle numbers of 10fold dilution series of S. Tennessee strain 2010-60-1713 (circles) and heatstressed S. Tennessee strain 2010-60-1713 (squares) in light-pasteurized whole egg (101 to 105 CFU/ml). Samples were preenriched with 1:100 dilutions, DNA was extracted with PrepMan Ultra reagent, and qPCR was performed on an Mx3005P thermocycler. LG, log10.
aem.asm.org 1619
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
FIG 3 Standard curves generated from quantification cycle numbers of 10-
Jakocˇiu ne˙ et al.
by using the DNeasy Blood and Tissue kit, and qPCR was performed with the Applied Biosystems 7500 Fast real-time PCR system. Asterisks indicate significantly different numbers of bacteria, as determined by qPCR (*, P ⱕ 0.05; ****, P ⱕ 0.0001). LG, log10.
cells per ml, no signal was obtained by qPCR, while a signal from one experiment (Cq values above 34.14) was observed when 106 dead cells were added per ml. Application of the qPCR method for enumeration of salmonellae in egg-containing dishes stored at abused refrigeration temperatures. As an example of a practical application of this method, the survival of S. Enteritidis in egg-containing products (tiramisu and long eggs) stored at temperatures of 8°C to 9°C and 10°C, respectively, corresponding to abused refrigeration temperatures, was investigated. In both dishes, salmonellae were able to survive or even multiply. For tiramisu, a significant decrease (P value of 0.042) in the numbers of cells was observed after 3 days of storage, and a significant increase (P value of 0.018) was observed after 7 days (Fig. 5). For long eggs, enumeration of salmonellae was not possible after either 3 or 7 days of storage, because Cq values were lower than the ones used for generating the standard curve, showing that Salmonella cells were multiplying in the product to a level above 4.17 ⫻ 104 CFU/25 g. DISCUSSION
The use of qPCR for quantification of Salmonella in various foods was demonstrated previously (15, 25, 26). Seo et al. (18) used qPCR for quantification in pooled egg samples; however, the detection limit of 103 CFU/ml must be considered too high in order to be able to quantify naturally occurring levels of salmonellae in eggs (19). To lower the detection limit, other authors employed pre-qPCR processing methods such as preenrichment (27, 28) or matrix lysis (29), but these methods were reported to be qualitative, with only a potential for quantitative use. In the current study, we demonstrate that quantification of salmonellae in table eggs, pasteurized egg products, and commercially available eggcontaining dishes is not only possible by using qPCR after a short nonselective 8-h preenrichment but also highly reproducible. Many different genes have been suggested to be targets for Salmonella detection by PCR (30–33) and qPCR. For the latter, the ttr (10) and invA (34) genes have been the preferred ones. As described previously by Malorny et al. (10), the ttr operon, targeted
1620 aem.asm.org
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
FIG 5 Survival of S. Enteritidis strain MB2509 in tiramisu. DNA was extracted
for the design of primers in the current study, is present in all Salmonella strains, whereas other genes used for this purpose, such as inv, can be lost due to natural deletion (35). The evaluated pre-PCR processing principle was originally suggested by Krämer et al. (15) for enumeration of salmonellae on pig carcasses. This method significantly decreases the detection level of the qPCR method while maintaining the quantification ability. In the current study, a detection level of the enrichment qPCR assay of 100 CFU/ml was obtained. As demonstrated by Krämer et al. (15) and in the current investigation, the short preenrichment step does not interfere with quantification. This method was shown to be robust enough to allow quantification of salmonellae in egg and egg products in three laboratories using different matrices, Salmonella strains and serovars, DNA extraction methods, and qPCR equipment. The only exception was pasteurized egg white, where a linear correlation between the number of CFU and the Cq values was not obtained and, thus, only qualitative results could be obtained. To make it easier to apply this method to end users, such as the food industry, it would be desirable to obtain a common (average) curve of the relation between CFU and Cq values for all egg matrices. We tried to establish such an average relation based on bacteria cultured in laboratory media; however, the curve was found not to represent the relation between CFU and Cq for all the different egg products. Therefore, a specific standard curve should be constructed for each matrix, as previously emphasized by others (36, 37). We also conclude that individual standard curves should be constructed for different thermocyclers. Salmonellae present in food matrices are often stressed due to different treatments in the food chain. To ensure that stressed cells could also be quantified correctly by the enrichment qPCR method, heat-stressed salmonellae were used. Linear correlations were obtained, demonstrating that quantification was possible; however, for five out of seven conditions tested, the Cq values were significantly higher (with a range of P values of 0.0002 to ⬍0.0001) than for nonstressed cells. The use of a standard curve based on heat-stressed cells can therefore be a more adequate alternative if applying the method for enumeration of salmonellae after pasteurization, when cells are likely to be heat stressed. Further studies are needed to determine the effect of other types of stressors. We also observed that DNA released from dead cells did not play a role, since the detection limit was 106 CFU/ml. The current method was developed to quantify salmonellae in eggs and egg products in relation to food safety control. In this situation, salmonellae are normally nondividing, which helps to ensure a uniform (matrix-specific) lag phase, which is a prerequisite for the use of the short-preenrichment approach. However, in certain situations, samples could be drawn from a matrix where the physical and chemical conditions allow growth of Salmonella and where cells would be in an active stage of growth. When investigating this scenario, we found that salmonellae obtained from growing cultures resulted in higher counts after preenrichment than did resting cells (data not shown). This would lead to an overestimation of the number of cells when qPCR is used. A shorter preenrichment time eliminated this problem, showing that a specific setup will be needed to quantify actively growing cells. Further studies are needed to establish this relation in more food matrices. Finally, enrichment qPCR was applied for enumeration of salmonellae in egg-containing dishes during storage at abused refrig-
qPCR for Salmonellae in Eggs
ACKNOWLEDGMENTS We acknowledge Kirsten Michaëlis for excellent technical assistance. We thank K. Pedersen (DTU Food, Denmark) and W. Messens (EFSA, Parma, Italy) for providing bacterial strains and B. Malorny (BfR, Germany) for providing the IAC. Light-pasteurized egg products were kindly provided by Danæg, Roskilde, Denmark. This study was supported by the European Commission through the BASELINE project (grant agreement number 222738).
REFERENCES 1. European Food Safety Authority, European Centre for Disease Prevention and Control. 2012. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2010. EFSA J. 10:2597. http://dx.doi.org/10.2903/j.efsa.2012.2597. 2. Centers for Disease Control and Prevention. 2010. Investigation update: multistate outbreak of human Salmonella Enteritidis infections associated with shell eggs. CDC, Atlanta, GA. 3. Zielicka-Hardy A, Zarowna D, Szych J, Madajczak G, Sadkowska-Todys M. 2012. Ensuring safety of home-produced eggs to control salmonellosis in Poland: lessons from an outbreak in September 2011. Euro Surveill. 17(47): pii⫽20319. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId⫽20 319. 4. Calvert N, Murphy L, Smith A, Copeland D. 2007. A hotel-based outbreak of Salmonella enterica subsp. enterica serovar Enteritidis (Salmonella Enteritidis) in the United Kingdom, 2006. Euro Surveill. 12(3):pii⫽689. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId⫽689. 5. HPA. 2012. Salmonella Enteritidis PT1 associated with consumption of liquid egg product. Health protection report 6. Health Protection Agency, London, United Kingdom. http://www.hpa.org.uk/hpr/archives/2012 /hpr4212.pdf. 6. HPA. 2007. Two outbreaks of salmonellosis in the United Kingdom and Channel Islands putatively linked to imported pasteurised egg products. Health protection report 1. Health Protection Agency, London, United Kingdom. http://www.hpa.org.uk/hpr/archives/2007/hpr4507.pdf. 7. Malorny B, Löfström C, Wagner M, Krämer N, Hoorfar J. 2008. Enumeration of Salmonella bacteria in food and feed samples by real-time PCR for quantitative microbial risk assessment. Appl. Environ. Microbiol. 74:1299 –1304. http://dx.doi.org/10.1128/AEM.02489-07. 8. Anonymous. 2002. Microbiology of food and animal feeding stuffs. Horizontal method for the detection of Salmonella (EN ISO 6579:2002). International Organization for Standardization, Geneva, Switzerland. 9. Gonzalez-Escalona N, Hammack TS, Russell M, Jacobson AP, De Jesus AJ, Brown EW, Lampel KA. 2009. Detection of live Salmonella sp. cells in produce by a TaqMan-based quantitative reverse transcriptase real-time PCR targeting invA mRNA. Appl. Environ. Microbiol. 75:3714 –3720. http://dx.doi.org/10.1128/AEM.02686-08. 10. Malorny B, Paccassoni E, Fach P, Bunge C, Martin A, Helmuth R. 2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl. Environ. Microbiol. 70:7046 –7052. http://dx.doi.org/10.1128/AEM .70.12.7046-7052.2004. 11. Hein I, Flekna G, Krassnig M, Wagner M. 2006. Real-time PCR for the detection of Salmonella spp. in food: an alternative approach to a conventional PCR system suggested by the FOOD-PCR project. J. Microbiol. Methods 66:538 –547. http://dx.doi.org/10.1016/j.mimet.2006.02.008.
March 2014 Volume 80 Number 5
12. Malorny B, Bunge C, Helmuth R. 2007. A real-time PCR for the detection of Salmonella Enteritidis in poultry meat and consumption eggs. J. Microbiol. Methods 70:245–251. http://dx.doi.org/10.1016/j.mimet.2007 .04.013. 13. Woodward MJ, Kirwan SE. 1996. Detection of Salmonella enteritidis in eggs by the polymerase chain reaction. Vet. Rec. 138:411– 413. http://dx .doi.org/10.1136/vr.138.17.411. 14. Rijpens N, Herman L, Vereecken F, Jannes G, De Smedt J, De Zutter L. 1999. Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separation and PCR. Int. J. Food Microbiol. 46:37– 44. http://dx.doi.org/10.1016/S0168-1605(98)00171-8. 15. Krämer N, Löfström C, Vigre H, Hoorfar J, Bunge C, Malorny B. 2011. A novel strategy to obtain quantitative data for modelling: combined enrichment and real-time PCR for enumeration of salmonellae from pig carcasses. Int. J. Food Microbiol. 145(Suppl 1):S86 –S95. http://dx.doi.org /10.1016/j.ijfoodmicro.2010.08.026. 16. Löfström C, Schelin J, Norling B, Vigre H, Hoorfar J, Rådström P. 2011. Culture-independent quantification of Salmonella enterica in carcass gauze swabs by flotation prior to real-time PCR. Int. J. Food Microbiol. 145(Suppl 1):S103–S109. http://dx.doi.org/10.1016/j.ijfoodmicro.2010 .03.042. 17. Wolffs PF, Glencross K, Thibaudeau R, Griffiths MW. 2006. Direct quantitation and detection of salmonellae in biological samples without enrichment, using two-step filtration and real-time PCR. Appl. Environ. Microbiol. 72:3896 –3900. http://dx.doi.org/10.1128/AEM.02112-05. 18. Seo KH, Valentin-Bon IE, Brackett RE, Holt PS. 2004. Rapid, specific detection of Salmonella Enteritidis in pooled eggs by real-time PCR. J. Food Prot. 67:864 – 869. 19. Humphrey TJ, Whitehead A, Gawler AH, Henley A, Rowe B. 1991. Numbers of Salmonella enteritidis in the contents of naturally contaminated hens’ eggs. Epidemiol. Infect. 106:489 – 496. http://dx.doi.org/10 .1017/S0950268800067546. 20. De Reu K, Grijspeerdt K, Heyndrickx M, Messens W, Uyttendaele M, Debevere J, Herman L. 2006. Influence of eggshell condensation on eggshell penetration and whole egg contamination with Salmonella enterica serovar Enteritidis. J. Food Prot. 69:1539 –1545. 21. Olsen JE, Skov MN, Threlfall EJ, Brown DJ. 1994. Clonal lines of Salmonella enterica serotype Enteritidis documented by IS200-, ribo-, pulsed-field gel electrophoresis and RFLP typing. J. Med. Microbiol. 40: 15–22. http://dx.doi.org/10.1099/00222615-40-1-15. 22. Blattner FR, Plunkett G, III, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA, Goeden MA, Rose DJ, Mau B, Shao Y. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453– 1462. http://dx.doi.org/10.1126/science.277.5331.1453. 23. Josefsen MH, Krause M, Hansen F, Hoorfar J. 2007. Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat. Appl. Environ. Microbiol. 73:3040 –3048. http://dx.doi.org/10 .1128/AEM.02823-06. 24. Löfström C, Krause M, Josefsen MH, Hansen F, Hoorfar J. 2009. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella. BMC Microbiol. 9:85. http://dx.doi.org/10 .1186/1471-2180-9-85. 25. Seo KH, Valentin-Bon IE, Brackett RE. 2006. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods. J. Food Prot. 69:639 – 643. 26. Kumar R, Surendran PK, Thampuran N. 2010. Rapid quantification of Salmonella in seafood by real-time PCR assay. J. Microbiol. Biotechnol. 20:569 –573. http://dx.doi.org/10.4014/jmb.0904.04040. 27. Day JB, Basavanna U, Sharma SK. 2009. Development of a cell culture method to isolate and enrich Salmonella enterica serotype Enteritidis from shell eggs for subsequent detection by real-time PCR. Appl. Environ. Microbiol. 75:5321–5327. http://dx.doi.org/10.1128/AEM.02422-08. 28. Chen J, Zhang L, Paoli GC, Shi C, Tu SI, Shi X. 2010. A real-time PCR method for the detection of Salmonella enterica from food using a target sequence identified by comparative genomic analysis. Int. J. Food Microbiol. 137:168 –174. http://dx.doi.org/10.1016/j.ijfoodmicro.2009.12.004. 29. Mayrl E, Roeder B, Mester P, Wagner M, Rossmanith P. 2009. Broad range evaluation of the matrix solubilization (matrix lysis) strategy for direct enumeration of foodborne pathogens by nucleic acids technologies. J. Food Prot. 72:1225–1233. 30. Aabo S, Rasmussen OF, Rossen L, Sorensen PD, Olsen JE. 1993.
aem.asm.org 1621
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
eration temperatures. These results demonstrate the influence that temperatures just a few degrees above the recommended refrigeration temperature can have on the growth of Salmonella in ready-to-eat products. In conclusion, we demonstrate the ability of enrichment qPCR to enumerate salmonellae in different egg products. Due to the use of a short preenrichment step, quantitative data can be obtained faster than with culture-based methods, which is crucial for the food industry to be able to test and release products. Moreover, we applied the method to investigate the fate of salmonellae in eggcontaining dishes stored at abused refrigeration temperatures. It should be noted that enrichment qPCR needs a standard curve for each specific matrix, and the possibility of cells being stressed should be considered.
Jakocˇiu ne˙ et al.
31.
32. 33.
1622 aem.asm.org
cells in the air of livestock stables by real-time PCR. Ann. Occup. Hyg. 53:859 – 868. http://dx.doi.org/10.1093/annhyg/mep060. 35. Ginocchio CC, Rahn K, Clarke RC, Galan JE. 1997. Naturally occurring deletions in the centisome 63 pathogenicity island of environmental isolates of Salmonella spp. Infect. Immun. 65:1267–1272. 36. Schelin J, Andersson G, Vigre H, Norling B, Häggblom P, Hoorfar J, Rådström P, Löfström C. 24 September 2013, posting date. Evaluation of pre-PCR processing approaches for enumeration of Salmonella enterica in naturally contaminated animal feed. J. Appl. Microbiol. http://dx.doi.org /10.1111/jam.12337. 37. Cocolin L, Rajkovic A, Rantsiou K, Uyttendaele M. 2011. The challenge of merging food safety diagnostic needs with quantitative PCR platforms. Trends Food Sci. Technol. 22:S30 –S38. http://dx.doi.org/10.1016/j.tifs .2011.02.009.
Applied and Environmental Microbiology
Downloaded from http://aem.asm.org/ on March 27, 2014 by NATIONAL CHUNG HSING
34.
Salmonella identification by the polymerase chain reaction. Mol. Cell. Probes 7:171–178. http://dx.doi.org/10.1006/mcpr.1993.1026. Malorny B, Cook N, D’Agostino M, De Medici D, Croci L, Abdulmawjood A, Fach P, Karpiskova R, Aymerich T, Kwaitek K, Kuchta T, Hoorfar J. 2004. Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples. J. AOAC Int. 87:861– 866. Bej AK, Mahbubani MH, Boyce MJ, Atlas RM. 1994. Detection of Salmonella spp. in oysters by PCR. Appl. Environ. Microbiol. 60:368 –373. Cra˘ciunas¸ C, Keul AL, Flonta M, Cristea M. 2012. DNA-based diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and sef genes. J. Environ. Manage. 95(Suppl):S15–S18. http://dx.doi.org/10.1016 /j.jenvman.2010.07.027. Fallschissel K, Kampfer P, Jackel U. 2009. Direct detection of salmonella
