epidermal growth factor nanofibrous scaffolds for wound healing.

XML Template (2015) [21.5.2015–9:57am] //blrnas3.glyph.com/cenpro/ApplicationFiles/Journals/SAGE/3B2/JBAJ/Vol00000/150041/APPFile/SG-JBAJ150041.3d

(JBA)

[1–13] [PREPRINTER stage]

Nanotechnology in Biomaterials

Evaluation of emulsion electrospun polycaprolactone/hyaluronan/epidermal growth factor nanofibrous scaffolds for wound healing

Journal of Biomaterials Applications 0(0) 1–13 ! The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/0885328215586907 jba.sagepub.com

Zhenbei Wang, Yuna Qian, Linhao Li, Lianhong Pan, Lucy W Njunge, Lili Dong and Li Yang

Abstract Wound healing scaffolds provide cells with structural integrity and can also deliver biological agents to establish a skin tissue-specific microenvironment to regulate cell functions and to accelerate the healing process. In this study, we fabricated biodegradable nanofibrous scaffolds with an emulsion electrospinning technique. The scaffolds were composed of polycaprolactone, hyaluronan and encapsulating epidermal growth factor. The morphology and core-sheath structure of the nanofibers were characterized by scanning electron microscopy and transmission electron microscopy. The scaffolds were also characterized for chemical composition and hydrophilicity with a Fourier-transform infrared analysis, energy dispersive spectroscopy and the water contact angle. An in vitro model protein bovine serum albumin and epidermal growth factor release study was conducted to evaluate the sustained release potential of the core-sheath structured nanofibers with and without the hyaluronan component. Additionally, an in vitro cultivation of human skin keratinocytes (HaCaT) and fibroblasts on polycaprolactone/hyaluronan and polycaprolactone/hyaluronan-epidermal growth factor scaffolds showed a significant synergistic effect of hyaluronan and epidermal growth factor on cell proliferation and infiltration. Furthermore, there was an up-regulation of the wound-healing-related genes collagen I, collagen III and TGF-b in polycaprolactone/hyaluronan/epidermal growth factor scaffolds compared with control groups. In the full-thickness wound model, the enhanced regeneration of fully functional skin was facilitated by epidermal regeneration in the polycaprolactone/hyaluronan/epidermal growth factor treatment group. Our findings suggest that bioactivity and hemostasis of the hyaluronan-based nanofibrous scaffolds have the capability to encapsulate and control the release of growth factors that can serve as skin tissue engineering scaffolds for wound healing. Keywords Emulsion electrospinning, hyaluronic acid/hyaluronan, epidermal growth factor, wound healing

Introduction The clinical treatment of wounds, burns and nonhealing ulcers remains a challenge, especially in the recovery of the full thickness of skin.1 Complete injury to the dermal and subdermal tissues can be caused by critical traumas, because there are no residual cells for regeneration, except at the wound boundaries.1 Accordingly, re-epithelialization must be accomplished over a long period of time and may be problematic through the formation of a scar.2 Recently, attempts have been made in tissue engineering to produce substitutes resembling human skin that would allow wound healing to proceed more quickly.3 Tissue engineering research has tried to mimic the structure,

composition and mechanical properties of native tissue in a controlled and regenerated manner to overcome the donor source restrictions of current medical therapies.4 The tissue engineering scaffold must be a biodegradable template that reproduces the natural

Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing, China Corresponding author: Li Yang, Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400030, China. Email: [email protected]

Downloaded from jba.sagepub.com at WESTERN OREGON UNIVERSITY on June 3, 2015


(JBA)


2

Journal of Biomaterials Applications 0(0)

skin microenvironment, containing both the barrier function of the epidermal component and the mechanical stability and elasticity of the dermal component.5 An important aspect of the scaffold design is to recreate the fibrous structure of the extracellular matrix (ECM).6 Native ECM comprises a complex network of structural and regulatory proteins arrayed in a fibrous matrix.7 Recently, considerable efforts have been made to develop polymeric fibers mimicking ECM at the submicron and nanometer scale.8,9 Electrospun nanofibrous scaffolds have recently been trialed as skin scaffolds, because they are nanoscale structures that are easily fabricated by an electrospinning process that does not require expensive or complex fabrication instruments.10 For skin tissue engineering, electrospun nanofibrous scaffolds have several advantages: they recapitulate the native ECM and have a high surface area to volume ratio, thus enhancing cell adhesion; the nanofibrous membrane acts as a protective barrier and can be modified for a controlled release of bioactive molecules for applications in tissue engineering; the membrane allows for efficient wound effluence release and oxygen permeability and inhibits pathogenic microorganism infiltration.11,12 Maintaining the biofunction of biomolecules incorporated in the nanofibers is important for the success of the bioactive scaffold in tissue regeneration.13 However, this is still a challenge due to external factors, such as enzymes, mechanical and chemical factors. To improve the efficacy of growth factors, several approaches have been reported, such as coaxial electrospinning and so on.14–17 Emulsion electrospinning is also known as core-shell electrospinning, and is a simple and efficient technology for the fabrication of scaffolds that can provide sustained release of incorporated growth factors.18–20 Polycaprolactone (PCL) has been widely used to produce many kinds of biomaterials in tissue engineering and drug delivery applications owing to its biocompatibility and favorable mechanical properties.21,22 However, due to its limited cell specificity and high hydrophobicity, pure PCL fails to provide the desired microenvironment for skin tissue regeneration. Incorporation of natural polymers such as silk fibroin, collagen and hyaluronan (HA) into PCL nanofibers have been shown to increase PCL biofunctionality and can modulate the interactions between cells and materials.23–26 HA is a linear glycosaminoglycan composed of repeating disaccharides of (1–3) and (1–4)-linked b-D-glucuronic acid and N-acetyl b-Dglucosamine monomers. HA is a major component of ECM that is ubiquitously distributed in the body.27 It is widely used in cosmetics and plastic surgery because it is able to retain water and reduce scar formation. Our previous research showed that HA can stimulate fibroblast cell infiltration and migration through the plasma

membrane surface receptor CD44 that activates the TGF-b signal pathway.26 Several researchers have found that small fragment HAs can promote cell proliferation.28 Recently developed growth factor therapies hold tremendous potential to address the shortcomings of current wound care modalities. A supply of exogenous growth factors may induce faster re-epithelialization and reduces the risk of infection.29,30 Epidermal growth factor (EGF) is a potent stimulator of keratinocyte proliferation and migration. It has been reported that epidermal growth factor (EGF) can promote cell mitosis and chemotaxis to accelerate formation of granulation tissue and the epidermis.31 Currently, genetically engineered recombinant human epidermal growth factor has been used in clinical medicine.32 However, it was demonstrated that EGF must be applied in a sustained and localized fashion to be effective, due to the short half-life and rapid dilution of growth factors.34 Therefore, there is an urgent need to develop new devices that can effectively deliver growth factors at a stable concentration, while maintaining their active form. In this study, we developed a novel biodegradable nanofibrous scaffold by emulsion electrospinning. Water was added to an oil emulsion system to make the electrospinning solution. To keep the growth factor complex localized to the site of application, 10% PCL and 2% HA were blended in the oil phase with heat and EGF was dissolved in deionized water with bovine serum albumin (BSA) (a protective protein) to form a growth factor-containing core. We hypothesized that the successfully fabricated EGF and HA-loaded scaffold would act as a biomaterial delivery vehicle to accelerate wound closure and regenerate fully functional skin.

Materials and methods Materials HA (sodium salt, Mw ¼ 2.5 106 kDa from Streptococcus equi) and PCL (Mw ¼ 90 kDa) were purchased from Sigma-Aldrich, Co. BSA was purchased from Beyotime Institute of Biotechnology, China. EGF was purchased from Biovision Inc. (USA). Chloroform and formic acid were purchased from Dupont Chemical Co. (USA). Dulbecco’s Modified Eagle’s Media (DMEM), RPMI-1640 cell culture media (1640), fetal bovine serum (FBS) and antibiotics were purchased from Gibco Life Technology, Co. (USA). CellTiter 96-Aqueous one solution reagent (MTS) was purchased from Promega, Co. (USA). 40 -6diamidino-2-PCL/HA/EGF nylindole (DAPI) was purchased from Enzo Life Sciences International, Inc. (USA). The 24-well millicell was purchased from



(JBA)


Wang et al.

3

Millipore, Merck, Co. (Germany). Enzyme-linked immunosorbent assay (ELISA) kits for BSA, human EGF and human HA were purchased from NeoBioscience Technology, Co. (China). RevetAid first strand cDNA synthesis kit was purchased from Thermo Fisher Scientific Inc. (USA). SYBR Premix Ex Taq (containing DNA polymerase, dNTP, reaction buffer and SYBR Green I) was purchased from TaKaRa Biotechnology Corp. (Japan). Unless otherwise specified, all other reagents were purchased from Sigma-Aldrich.

Preparation of electrospun solutions PCL solution was prepared by dissolving 0.5 g of PCL into 5 ml chloroform to form 10% (w/v) solution. HA solution was prepared by dissolving 0.02 g HA into 1 ml chloroform /FA (V/V ¼ 2:1) to form 2% (w/v) solution. Then these two solutions were mixed in ratios of PCL:HA ¼ 10:1 (v/v) and stirred gently with 50 ml of span-80. The final solution was used as oil phase. The water phase was prepared by mixing 10 ml of EGF work solution (containing 10 mg of EGF) and 90 ml of 0.2% BSA aqueous solution. The emulsion solution for electrospinning EGF encapsulated scaffold was prepared by adding 0.1 ml water phase into 3 ml oil phase drop by drop with vigorous stirring for at least 2 h till uniform emulsion at room temperature.

Electrospinning

morphology of nanofibrous scaffolds with an accelerating voltage of 10 kV after coating with gold. The diameter of nanofibers and pore size of scaffolds was measured by image analysis software IPP (Image-Pro Plus, Media Cyber Netics, USA) and calculated by 100–150 fibers or pores selected randomly. Transmission electron microscopy (TEM; TECNAI10, Philips, Holland) was used to examine the inner structure of nanofibers with a voltage of 120 kV. Samples were prepared by depositing nanofibers directly onto a copper mesh. In order to examine the chemical and physical composition of scaffolds, Fourier-transform infrared (FTIR) spectroscopy over a range of 4000–400 cm1 and X-ray energy dispersive spectroscopy (EDS; Zeiss Auriga crossbeam system, Germany) were used. FTIR spectra of different samples were obtained by a Nicolet spectrometer system (System 2000, PerkinElmer) with a deuterated triglycine sulfate detector (DTGS) KBr detector. The sample for EDS was prepared same to FESEM and detected with an accelerating voltage of 20 kV.

Hydrophilicity determination and release profiles of BSA, EGF and HA Water contact angle was measured by a Model 200 video-based optical system (Future Scientific Ltd. Co., Taiwan, China) to investigate the hydrophilicity of different nanofibrous scaffolds. To evaluate the release profiles of BSA, EGF and HA of nanofibrous scaffolds, ELISA (Enzyme-linked immunosorbent assay) was performed according to the manufacturer’s protocol. The bioactive reagents-loaded nanofibrous scaffolds were cut into a rectangle shape (5 cm 5 cm) and then soaked in a 6-well plate with 3 ml phosphate-buffered saline (PBS) per well. The fibrous mats were protected from light and incubated at 37 C in a continuous horizontal shaker. At predetermined time points (1 h, 4 h, 8 h, 16 h, 24 h, 48 h, 4 day, 8 day, 15 day and 30 day) 1 ml of supernatant was retrieved and replenished with 1 ml of fresh PBS. The accumulation amount released (%) of HA and EGF was calculated by the equation below

The electrospinning process was performed as it has been described in our previous research.33 In brief, a polymer solution was ejected towards a rotary round collector by a syringe pump through a blunt stainless steel needle at a flow rate of 1.0 ml/h (Longer Precision Pump, Baoding, China). A voltage of 18 kV was applied to the syringe needle supplied by a high-voltage power supply (Dongwen High Voltage Power Supply Plant, Tianjin, China) for electrospinning. Randomly oriented fibrous scaffolds were collected on the d ¼ 15 cm open cage target rotating at 300 r/min. The distance between the syringe needle and rotary round collector was 12 cm. Relative humidity and temperature were adjusted by an air conditioner to maintain the room temperature no more than 25 C and humidity no more than 60%. Three kinds of different scaffolds were made: pure PCL, PCL/HA and PCL/HA/EGF. Besides, nanofibrous scaffolds PCL/BSA were fabricated and compared to PCL/HA to determine the function of HA in promoting release profiles of BSA.

where Mt is the weight of EGF released at time t and Mx is the total amount of EGF in the nanofibrous scaffolds theoretically. All experiments were tested in triplicate. All data were analyzed and graphed by Origin 8.5.1 (OriginLab. Co., USA).

Characterization of nanofibrous scaffolds

Cell culture and proliferation assay

Field emission scanning electron microscopy (FESEM; Nova 400 NanoSEM, FEI) was used to characterize the

The normal human skin primary fibroblast cell line fibroblasts (FEK4) and normal human epidermal

Accumulation amount releasedð%Þ ¼ Mt=Mx 100%



(JBA)


4


immortalized keratinocyte cell line HaCaT (both kindly supplied by Dr. RM Tyrrell’s Lab, University of Bath, UK) are all derived from newborn foreskin explants. To study the cell proliferation capacity on different scaffolds, viable cells were planted and determined by colorimetric MTS assay. In details, FEK4 cells were cultured in DMEM with 10% FBS and 1% penicillin/ streptomycin. HaCaT cells were cultured in RPMI1640 cell culture media (1640) with 10% FBS and 1% penicillin/streptomycin. Cells were detached by trypsinEDTA when reaching 70% confluence, and then viable cells were counted by hemocytometer and seeded onto sterilized nanofibrous scaffolds. The nanofibrous scaffolds were sterilized by immersion into 75% ethanol for 1 h, dried under sterile conditions and exposed to UV radiation for 2 h, then washed with PBS with 4% peni-

for 15 min. Layer images (0–40 mm) were taken using confocal laser scanning microscopy (CLSM).

RNA extraction and the real-time PCR To determine the mRNA levels of collagen I, collagen III and TGF-b1 real-time RT-PCR reactions were performed according to the manufacturer’s instruction. Total RNA of the cells seeded on different nanofibrous scaffolds were isolated after culturing for 1, 5 and 10 days using an RNeasy Mini Kit (Qiagen Inc., USA) and then reverse transcribed into cDNA with a RevertAid first strand cDNA synthesis Kit. Glyceraldehyde-3-phosphate dehydrogenase (GAP DH) was detected as an internal control. The sequences of forward and reverse primers were shown below:

Gene

Forward

Reverse

Collagen I Collagen III TGF-b1 GAPDH

TCTCCACTCTTCTAGTTCCT TATTATAGCACCATTGAGA CCATACATTCCACATACTCCCACC GCACCGTCAAGGCTGAGAAC

TTGGGTCATTTCCACATGC TTATAAACCAACCTCTTCCT CCACAGTTCCACAGCAGTCCTC TGGTGAAGACGCCAGTGGA

cillin/streptomycin three times (5 min each time). Finally, the sterilized nanofibrous scaffolds were placed into a 24-well plate and incubated with DMEM (free serum) overnight before cell seeding. HaCaT cells (5000 cells/well) and FEK4 cells (10,000 cells/well) were seeded into the scaffolds. After culturing for 1, 3, 5 and 10 days onto nanofibrous scaffolds, cells were washed with PBS and incubated with 300 ml MTS reagent (60 ml MTS reagent with 300 ml serum-free culture media) per well for 3 h at 37 C in 5% CO2. Aliquots were pipetted into a 96-well plate and the absorbances of the solutions were measured at 490 nm using a spectrophotometric microplate reader (Model 680, Bio-Rad).

Cell infiltration evaluation in vitro The cell infiltration evaluation experiment was performed using a modified Transwell (24-Well Millicell, Millipore) system in a 24-well plate as described in our previous research.26 In brief, 5 103 cells were seeded on different scaffolds with 2% FBS/ DMEM at the upper chamber and the lower chamber was filled with 10% FBS/DMEM to serve as the chemoattractant. After seven days of cell seeding, the samples were fixed in 4% PFA and stained with DAPI

For real-time PCR reactions, a fluorescence quantitative PCR detection system (Bio-Rad, USA) was used. A 10 mL mixture consisting of SYBR Premix Ex Taq (containing DNA polymerase, dNTP, reaction buffer and SYBR Green I), cDNA and equal amounts of forward and reverse primers were used for each gene. PCR reaction conditions were 2 min at 50 C,10 min at 95 C and then 50 cycles at 95 C for 15 s, and 1 min at 60 C. Relative gene expression data were analyzed using the 2CT method. Each sample was analyzed in triplicate.

Grafting of scaffolds in vivo For animal tests, 3-month-old male Sprague Dawley (SD) rats (body weight 230–250 g) were chosen to shave a rectangle of a full-thickness defect wound under anaesthesia at a size of 18 mm 18 mm on the dorsum. Then we prepared rectangle shape scaffolds of the same size under sterile conditions as a wound dressing and fixed them with a self-adherent wrap. All animals were individually caged and housed in temperature and light-controlled rooms. All animals were allowed to acclimate to the feeding environment for 5–7 days before surgery and had free access to food and water. The rats were used conforming to the guiding



(JBA)


Wang et al.

5

(a)

Stirring

V

Organic/oil phase with emulsifier

Aqueous phase

Emulsion Electrospinning

Polymer solution

Span-80

(b)

Water

EGF

HA

(c)

Figure 1. (a) Schematic of the preparation of emulsion electrospun core-shell structure nanofiber scaffolds. (b) A uniform emulsion was formed after stirring for 2 h. (c) Observation of an emulsion droplet by inverted optical microscope. Scale bar ¼ 100 nm.

principles in the Care and Use of Animals for our Institute, and were approved by the Animal Care and Use Committee of our Institute. The wound-healing degree was determined by measuring the wound size, after surgery for 7, 14 and 28 days.

Immunohistochemical staining Fourteen days and 28 days post-surgery, the rats were sacrificed and the full-thickness defect dorsum skin was excised and fixed in 4% paraformaldehyde for 24 h at 4 C. Then samples were embedded into paraffin after being dried through a series of graded alcohol baths and in xylene. Next, the samples were sectioned into 10 mm thick slices. Finally, hematoxylin-eosin (HE) staining was performed to evaluate the structure of the regenerated skin. Three samples for each group were analyzed by an inverted light microscope (Olympus, IX71).

Statistical analysis All the experiments in this study were repeated three times and statistical analysis was performed using Student’s t-test as well as one-way analysis of variance (ANOVA) followed by the Tukey HSD test for

post-hoc comparison (OriginLab OriginV8.5.0 Software). Differences were considered significant when p < 0.05.

Results Morphology and inner structure We successfully fabricated core-shell nanofiber scaffolds. Briefly, the electrospinning process was performed after a stable emulsion formed (Figure 1). Figure 2 shows the nanofiber morphology and inner structure of the four different scaffolds. It was found that the scaffolds were porous and contained uniform fibers (Figure 2(a)). We also found an obvious coreshell structure in PCL/HA and PCL/HA/EGF that formed during the emulsion electrospinning, that we did not find in PCL scaffolds (Figure 2(b)). The inner dark core of the fibers was composed of a water phase that contained EGF and BSA or BSA alone. The relatively bright outer shell was composed of PCL and HA, the two components of the oil phase. Figure 2 shows the average diameter and pore size of the three different scaffolds. In detail, PCL had a diameter of 272 38 nm and a pore size of 0.56 0.19 mm2. PCL/HA and PCL/HA/EGF were



(JBA)


6

Journal of Biomaterials Applications 0(0) PCL

PCL/HA

PCL/HA/EGF

(a)

(b)

(c) 0.8

(d) 350

*

300

0.6

Fiber diameter (nm)

Scaffolds pore size (μm2)

0.7

0.5 0.4 0.3 0.2

*

250 200 150 100 50

0.1 0.0

0 PCL

PCL/HA

PCL/HA/EGF

PCL

PCL/HA

PCL/HA/EGF

Figure 2. Morphology and internal structure of nanofibrous scaffolds. (a) Representative FESEM (scale bar ¼ 10 mm; inset at a higher magnification image, scale bar ¼ 1 mm) and TEM (scale bar ¼ 500 nm). (b) Images of three different scaffolds showing the porous morphology and uniform internal structure of PCL, core-sheath structure of PCL/HA and PCL/HA/EGF. Quantitative comparison of (c) scaffold pore sizes and (d) fiber diameters of the three tested scaffolds. Measurements were obtained with the Image Pro Plus program 6.0 (IPP 6.0; *p < 0.05; data presented are mean SD, n ¼ 100). The fiber diameter and scaffold pore sizes significantly decreased with the addition of HA.

smaller both in diameter and pore size. PCL/HA had a diameter of 184 6 nm and a pore size of 0.16 0.02 mm2. PCL/HA/EGF had a diameter of 149 4.5 nm and a pore size 0.17 0.03 mm2.

Chemical group and element analysis FTIR was performed to assess the chemical composition of the nanofibrous PCL, PCL/HA and PCL/HA/ EGF scaffolds. As shown in Figure 3(a), the infrared absorption characteristic peaks of PCL were observed in the PCL/HA and PCL/HA/EGF scaffolds. These include asymmetric –CH2– stretching (2924 cm1), symmetric –CH2– stretching (2866 cm1) and carbonyl stretching (1727 cm1). HA powder has a strong absorbance peak at 1614 cm1 due to abundant acid

carboxyl groups. However, the absorbance peak of the carboxyl groups shifted to 1631 cm1 in the PCL/ HA and PCL/HA/EGF nanofibrous scaffolds. To determine the chemical constituents more accurately, EDS was performed to examine the basic composition of the nanofibrous scaffolds. Figure 3(b) shows the binding energy spectrum of the nanofibrous scaffolds and there is an apparent nitrogen absorbance peak in PCL/HA and PCL/HA/EGF that cannot be seen in PCL.

Hydrophilicity determination and in vitro release profile of BSA, EGF and HA The hydrophilicity of four different nanofibrous scaffolds is shown in Figure 4(a). The hydrophilicity of the




(JBA)

Wang et al.

7

(a) HA PCL

1614

PCL/HA PCL/HA/EGF

1631 2924

4000.0

(b)

3000

2000

1500

C

800

C

700

PCL

400.0

1200

PCL/HA

800

600

1000

600

C

1000

PCL/HA/EGF

800

500 400

600

400

300

400 200

200

N

0.2

0.4 0.6 0.8 Binding energy (keV)

O

200

N

0

0 0.0

O

O

100

0 0.0

0.2


0.0

0.2


Figure 3. (a) FTIR analysis of HA powder and electrospun nanofibrous scaffolds PCL, PCL/HA and PCL/HA/EGF. Apparent characteristic peaks of PCL and HA appeared in the PCL/HA and PCL/HA/EGF nanofibrous scaffolds. (b) EDS analysis of three tested nanofibrous scaffolds. An apparent nitrogen absorbance peak appeared in nanofibrous scaffolds PCL/HA and PCL/HA/EGF, but cannot be seen in PCL.

scaffolds was significantly increased after they were loaded with HA. An ELISA was performed to evaluate the release amount of BSA, EGF and HA. Figure 4(b) shows the release profiles of BSA from nanofibrous scaffolds loaded with or without HA. We found that the BSA release speed accelerated after the scaffold was loaded with HA. Both PCL/BSA and PCL/HA have the same burst release profile as BSA in the first four days (reaching 22.5 1.2% and 29.5 1.3%, respectively; Figure 4(b)). The BSA release speed of PCL/ HA significantly increased when compared to PCL/ BSA. The nanofibrous scaffolds PCL/HA/EGF were cut into 5 5 cm (L W) or approximately one-tenth of the entire nanofibrous scaffold which theoretically contained 10 mg EGF and 0.02 g HA based on our calculations. We estimated that the scaffolds examined for release contained 1 mg EGF and 2 mg HA. As Figure 4(c) shows, both scaffolds had an early burst release in four days (reaching 35 1.5 and 11 1.6% for HA and EGF, respectively). Then, the release profiles stabilized over the last 25 days of the experiment. The total release amount of EGF and HA reached 43.5 1.2% and 29.8 1.3%, respectively.

Cell proliferation and infiltration FEK4 human primary fibroblast cells and HaCaT human epidermal cells were seeded on nanofibrous scaffolds to evaluate the proliferation ability with an MTS assay on days 1, 3, 5, and 10. TCP was used as control. As shown in Figure 5, both FEK4 cells and HaCaT cells did not show any differences on the first day. On the third day, FEK4 cells still did not show any significant differences for each group. By the fifth day, both FEK4 cells and HaCaT cells seeded on PCL/HA/ EGF showed a significant increase compared to other groups. Interestingly, we found that both of the two kinds of cells seeded on the PCL/HA nanofibrous scaffolds had significantly lower proliferation abilities than the other groups. However, FEK4 cells seeded on PCL/ HA nanofibrous scaffolds caught up and surpassed the other two groups, except for the PCL/HA/EGF group, while the HaCaT cells did not proliferate after culturing for 10 days. Only FEK4 cells were examined for cell infiltration, because cell migration occurred mainly in the dermis. Cells were seeded on nanofibrous scaffolds punched



(JBA)


8

Journal of Biomaterials Applications 0(0) (a) 140

* Contact angle (degree)

120

*

100 80 60 40 20 PCL

(b) 35

PCL/HA

(c) 50 Accumulation amount (%)

PCL/HA PCL/BSA

30

Accumulation amount (%)

PCL/BSA

25 20 15 10 5

PCL/HA/EGF HA EGF

40

30

20

10

0

0 0

100

200

300

400

500

600

700

800

Time (hours)

0

100

200

300

400

500

600

700

800

Time (hours)

Figure 4. The addition of HA increased the hydrophilicity of the scaffold and increased the release speed of bioactive molecules. (a) Contact angles of the tested nanofibrous scaffolds. (b) In vitro release profiles of BSA from scaffolds with or without HA. (c) In vitro release profile of HA and EGF from nanofibrous scaffolds PCL/HA/EGF immersed in PBS (PH ¼ 7.4) and incubated at 37 C. (*p < 0.05; data presented are mean SD, n ¼ 4).

into a Transwell system in 24-well-plates and cultured for seven days. Then, CLSM was used to check the DAPI-stain had infiltrated into the cells at different depths (Figure 5(c)). The CLSM images show that the migration of FEK4 cells into the nanofibrous scaffolds was improved by the addition of HA and EGF. There are more cells in deeper positions (40 mm from the surface) of group PCL/HA and PCL/HA/EGF when compared to group PCL.

addition of EGF and HA can apparently stimulate collagen III and TGF-b1 expression, and leads to a little increase in the expression of collagen Iafter cultured for 5 days and 10 days. To our surprise, the collagen III expression level of the PCL/HA/EGF group tripled in the PCL/HA group after they were cultured for five days. Then it decreased to less than two times the collagen III expression of group PCL/HA.

Gene expression of collagen and TGF-1

In vivo test of wound dressings: Observation of wound closure and hematoxylin and eosin (H and E) staining

To find out the molecule mechanism of why HA- and EGF-containing nanofibrous scaffolds can accelerate wound healing, the gene expression levels of collagen I, collagen III and TGF-b1, which are three of the most important proteins for wound healing, were examined through qPCR (Figure 6). We have not found expression of the collagen gene in HaCaT cells. Collagen deposition mainly occurred in the dermal layer but there was an obvious increase of TGF-b1 (data not shown). We found that the

A full-thickness skin defect wound with a size of 18 mm 18 mm was shaved on the dorsum of rats. Nanofibrous scaffolds of the same size were spread on the wounds. Rats are known to have a strong self-healing capability, so it was necessary to create a control group without any additional treatment. As shown in Figure 7, the wound size of group PCL/HA/EGF was significantly smaller than in the other three groups one



(JBA)


Wang et al.

9

Absorbance at 490 nm

1.6 1.4 1.2

HaCaT Cell PCL PCL/HA PCL/HA/EGF TCP *

*

2.0 *

1.0 *

0.8

*

0.6 0.4

(b)

*

Absorbance at 490 nm

(a) 1.8

1.5

FEK4 Cell PCL PCL/HA PCL/HA/EGF TCP

*

*

* 1.0

0.5

*

0.2 0.0

0.0 1 Day

(c)

0 μm

3 Day

5 Day

10 Day

10 μm

1 Day

3 Day

20 μm

5 Day

10 Day

30 μm

PCL

PCL/HA

PCL/HA/EGF

Figure 5. Cell viability of (a) HaCaT cells and (b) FEK4 cells seeded on four nanofibrous scaffolds and TCP for 1 to 10 days (*p < 0.05; data presented are mean SD, n ¼ 3). (c) CLSM scanning images show the depth that FEK4 cells infiltrated in different nanofibrous scaffolds after being cultured for three days; scale bar ¼ 100 mm.

week after surgery. The three groups treated with nanofibrous scaffolds did not appear to have excessive inflammation or necrosis, even though the PCL group had a more severe inflammatory reaction than the control group. Two weeks after the scaffolds had been grafted, all of the wounds in the four groups had closed. The PCL/HA/EGF grafts had the fastest wound-healing rate when compared to the other groups (Figure 7(b)). The wound-healing process was complete four weeks after surgery. The regenerated skin on the PCL/HA/EGF grafts was smoother compared to the other grafts. HE staining was performed to determine the level of skin regeneration. As shown in Figure 7(c) the PCL/HA/EGF grafts had a significantly thicker epidermal layer than the other treatments and a relatively homogeneous dermis layer two weeks after surgery. Four weeks later, the complete epidermis could be observed in all of the treatment groups, whereas the thickest epidermis could be seen in the PCL/HA/EGF treatments and skin appendages, such

as hair follicle could only be observed in the PCL/HA/ EGF treatment group.

Discussion We successfully developed a novel electrospun nanofibrous scaffold capable of accelerating wound healing. Electrospinning is a fabrication technique used to structurally and biochemically mimic the native ECM.35,36 Structural proteins, proteoglycans and glycosaminoglycan are the major ECM components that influence cell behavior during wound healing, such as adhesion, proliferation, differentiation and migration.37,38 HA is a kind of glycosaminoglycan that exists in most organs of the human body. It plays a lubricating role due to its extreme hydrophilicity. By interacting with the cell surface receptor, HA has also been reported to modulate gene expression of some ECM proteins which plays critical roles in wound healing.39 EGF is a polypeptide that was first found in



(JBA)


10


PCL PCL/HA PCL/HA/EGF

3.0

*

2.5

*

2.0 1.5 1.0

(b) 8 Gene expression relative to PCL

Gene expression relative to PCL

(a) 3.5

*

* *

0.5 0.0

*


7 6 5

*

4

*

*

*

3

*

2 1 0

Collagen I

Collagen III 1 Day

(c) Gene expression relative to PCL

2.0

*


2.5

* *

Collagen III 5 Day

Collagen I

TGF-β1

*

TGF-β1

* *

1.5

1.0

0.5

0.0 Collagen I

Collagen III 10 Day

TGF-β1

Figure 6. Quantitative analysis of the gene expression of collagen I, collagen III and TGF-b1 in FEK4 after being cultured for (a) 1 day, (b) 5 days, and (c) 10 days (*p < 0.05; data presented are mean SD, n ¼ 4). Scaffolds with HA and EGF promoted the expression of collagen and TGF-b1.

mouse submandibular gland and has a robust ability to promote cell proliferation and migration.40 Several attempts have been made to encapsulate EGF and other growth factors for use in tissue engineering.41,42 In this study, we developed a new kind of electrospun nanofibrous scaffold that releases HA and EGF to accelerate wound healing. To determine whether EGF was successfully incorporated into the scaffold, FTIR and EDS assays were performed. The FTIR spectrum displayed a characteristic absorbance peak for PCL and HA in the PCL/HA and PCL/HA/EGF group. No characteristic absorbance peaks for protein were observed from the trace amount of EGF that was loaded. Consequently, the EDS assay was used to confirm the existence of nitrogen in the scaffolds. All scaffold groups except PCL showed a spectrum for nitrogen. In general, proteins contain some amount of nitrogen as a result of their amino acids. However, in synthetic polymers like PCL, nitrogen is absent. The assay verified that EGF was successfully incorporated into the scaffold and this was also demonstrated by the TEM and

MTS results. Designing a scaffold that mimics the native ECM is important for its successful application in tissue engineering. All scaffolds made in this study are at the nanoscale level, ranging from 150 to 300 nm. The diameter and pore size decreased significantly when HA was added. This phenomenon was due to the increased electrical conductivity with addition of negatively charged HA in the emulsion solution. HA is a polyanionic glycosaminoglycan. In the high voltage electric field, HA will be in the form of anion on the polymer surface, increasing the electrostatic force on the polymer so that the fiber diameter would decrease at a given flow rate and temperature. Nevertheless, FEK4 cells infiltrated farther into the PCL/HA/EGF and PCL/HA nanofibrous scaffolds in comparison to the PCL scaffolds. We hypothesized that HA plays an important role in cell infiltration. Due to the hydrophilic nature of HA, the scaffolds would swell after immersing them in culture media, thus causing an increase in the diameter and pore size. Subsequently, the HA released from the scaffolds would promote cell migration and



(JBA)


Wang et al.

11

(a)

(b) 3.5

0W

Control PCL

3.0

PCL/HA PCL

2.5

PCL/HA PCL/HA/EGF

1W

Wound size (cm2)

Control

PCL/HA/EGF

2.0 1.5 1.0

2W 0.5 0.0 4W

0

1

2

4

Time post-surgery (weeks)

(c)

Control

PCL

PCL/HA

PCL/HA/EGF

2W

4W

Figure 7. Macroscopic observations of skin wounds at 1–4 weeks’ post-surgery. (a) The nanofibrous scaffold PCL/HA/EGF accelerated wound closure, especially during the first week. (b) Wound size determination at 1–4 weeks post-surgery (*p < 0.05; data presented are mean SD, n ¼ 4). (c) Histological micrographs of wound sites at two and four weeks post-surgery. A thicker epidermis layer was observed in the PCL/HA/EGF nanofibrous scaffold two weeks after surgery and appendages only appeared in the PCL/HA/ EGF nanofibrous scaffold group four weeks post-surgery; scale bar ¼ 200 mm.

infiltration.43 Finally, we demonstrated that EGF could also enhance cell migration.44 We believe that EGF and HA synergistically promote cell infiltration into the scaffolds. An MTS assay was performed to determine cell proliferation on different scaffolds. We did not observe any significant differences between scaffolds of PCL and PCL/BSA (data not shown), which suggests that the incorporation of BSA did not influence cell behavior. BSA can be used as a protective protein during the electrospinning process. After the fifth day, scaffolds containing EGF showed an enhanced ability to promote cell proliferation for both cell types. This explains the accelerated wound closure and regeneration of a thicker epidermis layer in the PCL/HA/ EGF treatment. These results were corroborated by the synergistic release profile of EGF, wherein, there

was a burst release on the fifth day. Unexpectedly, the PCL/HA showed no significant increase in proliferation until the 10th day of culture. Previous studies have shown that the cell proliferation capacity decreases when the electrospun scaffold diameter decreases.45 Therefore, the PCL/HA scaffold with a smaller diameter fiber inhibited cell proliferation relative to other groups. However, the PCL/HA/EGF scaffold with a similar diameter size to the PCL/HA scaffold promoted cell proliferation. These results demonstrate that EGF has a robust ability to promote cell proliferation. Wound healing is a complex process that includes cell proliferation, ECM deposition, the formation of granulation tissue and remolding.46 The wound closure process mainly occurs through the deposition of collagen in the ECM.47 There are more than 20 different



(JBA)


12


types of collagen in human skin and it has been reported that collagen I and collagen III are among the most abundant collagen that provide mechanical support for skin.37 Collagen I is found in the skin of adults and infants, whereas collagen III is most abundant in fetus skin. Previous research has demonstrated that collagen III plays a critical role in the skin regeneration ability of the fetus.48 In this study, one of our goals was to increase the deposition of collagen during wound healing by releasing it from EGF and HA from nanofibrous scaffolds. Our results demonstrate that the addition of HA will increase the hydrophilicity of nanofibrous scaffolds and will promote the release of EGF. EGF would then up-regulate the gene expression of TGF-b1 to enhance the deposition of collagen. However, more collagen is not necessarily better because excessive collagen will induce scar formation.44 Our newly designed scaffold produced a relatively fast epithelialization rate, and successfully regenerated a fully functional skin with little scar formation.

Conclusions In this study, we developed a new kind of nanofibrous scaffold that can simultaneously release EGF and HA. EGF and HA were successfully incorporated into the scaffold through one-step emulsion electrospinning. Both EGF and HA were encapsulated in nanofibrous scaffolds and showed a burst release profile. HA can promote the release of EGF by increasing nanofiber hydrophilicity. In vitro experiments suggested that EGF and HA released from nanofibrous scaffolds can promote cell infiltration, up-regulate collagen and TGF-b1 gene expression and increase the ratio of collagen III to collagen I. In vivo experiments demonstrated that the nanofibrous PCL/HA/EGF scaffold has the benefit of accelerating epidermis regeneration in the early phases of wound healing. A thicker epidermis layer and an organized dermis layer were regenerated when the wound was treated with the PCL/HA/ EGF scaffold. Overall, our results demonstrate that the PCL/HA/EGF scaffold is a promising wound dressing for clinical applications. Acknowledgment We would like to thank Dr. Wei Xu, Junjie Liu, Guangwei Shi, Yangyang Zhao and Panpan Nan for their kind technical support in animal experiments.

Funding Thanks for the financial support by Innovation and Attracting Talents Program for College and University (‘‘111’’ Project) (B06023), National Natural Science Foundation of China (11032012, 30870608), the Key Science and Technology Program of CQ CSTC (CSTC,

2009AA5045), and the Program for New Century Excellent Talents in University (NCET-10-0879).

Declaration of conflicting interests None declared.

References 1. Boyar V, Handa D, Clemens K, et al. Clinical experience with Leptospermum honey use for treatment of hard to heal neonatal wounds: case series. J Perinatol 2014; 34: 161–163. 2. Jayarama Reddy V, Radhakrishnan S, Ravichandran R, et al. Nanofibrous structured biomimetic strategies for skin tissue regeneration. Wound Repair Regen 2013; 21: 1–16. 3. Gurtner GC, Werner S, Barrandon Y, et al. Wound repair and regeneration. Nature 2008; 453: 314–321. 4. Kamel RA, Ong JF, Eriksson E, et al. Tissue engineering of skin. J Am Coll Surg 2013; 217: 533–555. 5. Langer R and Vacanti JP. Tissue engineering. Science 1993; 260: 920–926. 6. Priya SG, Jungvid H and Kumar A. Skin tissue engineering for tissue repair and regeneration. Tissue Eng Part B Rev 2008; 14: 105–118. 7. Dutta RC and Dutta AK. Cell-interactive 3D-scaffold; advances and applications. Biotechnol Adv 2009; 27: 334–339. 8. Karuppuswamy P, Venugopal JR, Navaneethan B, et al. Functionalized hybrid nanofibers to mimic native ECM for tissue engineering applications. Appl Surf Sci 2014; 322: 162–168. 9. Park DY, Mun CH, Kang E, et al. One-stop microfiber spinning and fabrication of a fibrous cell-encapsulated scaffold on a single microfluidic platform. Biofabrication 2014; 6: 024108. 10. Darrell HR and Iksoo C. Nanometre diameter fibres of polymer, produced by electrospinning. Nanotechnology 1996; 7: 216. 11. Zhong SP, Zhang YZ and Lim CT. Tissue scaffolds for skin wound healing and dermal reconstruction. Wiley Interdiscip Rev Nanomed Nanobiotechnol 2010; 2: 510–525. 12. Bhardwaj N and Kundu SC. Electrospinning: a fascinating fiber fabrication technique. Biotechnol Adv 2010; 28: 325–347. 13. Richardson TP, Peters MC, Ennett AB, et al. Polymeric system for dual growth factor delivery. Nat Biotechnol 2001; 19: 1029. 14. Sun Z, Zussman E, Yarin AL, et al. Compound Core– Shell Polymer Nanofibers by Co-Electrospinning. Adv Mater 2003; 15: 1929–1932. 15. Gu M, Li Y, Li X, et al. In Situ TEM study of lithiation behavior of silicon nanoparticles attached to and embedded in a carbon matrix. ACS Nano 2012; 6: 8439–8447. 16. Kong H and Jang J. Antibacterial properties of novel poly(methyl methacrylate) nanofiber containing silver nanoparticles. Langmuir 2008; 24: 2051–2056.



(JBA)


Wang et al.

13

17. Sahoo S, Ang LT, Goh JC-H, et al. Growth factor delivery through electrospun nanofibers in scaffolds for tissue engineering applications. J Biomed Materi Res A 2010; 93 A: 1539–1550. 18. Tian L, Prabhakaran M, Ding X, et al. Emulsion electrospun vascular endothelial growth factor encapsulated poly(l-lactic acid-co-e-caprolactone) nanofibers for sustained release in cardiac tissue engineering. J Mater Sci 2012; 47: 3272–3281. 19. Valmikinathan CM, Defroda S and Yu X. Polycaprolactone and bovine serum albumin based nanofibers for controlled release of nerve growth factor. Biomacromolecules 2009; 10: 1084–1089. 20. Yang Y, Xia T, Zhi W, et al. Promotion of skin regeneration in diabetic rats by electrospun core-sheath fibers loaded with basic fibroblast growth factor. Biomaterials 2011; 32: 4243–4254. 21. Kweon H, Yoo MK, Park IK, et al. A novel degradable polycaprolactone networks for tissue engineering. Biomaterials 2003; 24: 801–808. 22. Yoon H and Kim G. A three-dimensional polycaprolactone scaffold combined with a drug delivery system consisting of electrospun nanofibers. J Pharm Sci 2011; 100: 424–430. 23. Ekaputra AK, Prestwich GD, Cool SM, et al. The threedimensional vascularization of growth factor-releasing hybrid scaffold of poly (e-caprolactone)/collagen fibers and hyaluronic acid hydrogel. Biomaterials 2011; 32: 8108–8117. 24. McClure MJ, Sell SA, Ayres CE, et al. Electrospinningaligned and random polydioxanone–polycaprolactone– silk fibroin-blended scaffolds: geometry for a vascular matrix. Biomed Mater 2009; 4: 055010. 25. Schnell E, Klinkhammer K, Balzer S, et al. Guidance of glial cell migration and axonal growth on electrospun nanofibers of poly-e-caprolactone and a collagen/polye-caprolactone blend. Biomaterials 2007; 28: 3012–3025. 26. Li L, Qian Y, Jiang C, et al. The use of hyaluronan to regulate protein adsorption and cell infiltration in nanofibrous scaffolds. Biomaterials 2012; 33: 3428–3445. 27. Collins MN and Birkinshaw C. Hyaluronic acid based scaffolds for tissue engineering – a review. Carbohydr Polym 2013; 92: 1262–1279. 28. Yan S, Zhang Q, Wang J, et al. Silk fibroin/chondroitin sulfate/hyaluronic acid ternary scaffolds for dermal tissue reconstruction. Acta Biomater 2013; 9: 6771–6782. 29. Brown GL, Nanney LB, Griffen J, et al. Enhancement of wound healing by topical treatment with epidermal growth factor. N Engl J Med 1989; 321: 76–79. 30. Barrientos S, Stojadinovic O, Golinko MS, et al. Growth factors and cytokines in wound healing. Wound Repair and Regen 2008; 16: 585–601. 31. Choi JS, Leong KW and Yoo HS. In vivo wound healing of diabetic ulcers using electrospun nanofibers immobilized with human epidermal growth factor (EGF). Biomaterials 2008; 29: 587–596. 32. Gonza´lez G, Crombet T, Catala´ M, et al. A novel cancer vaccine composed of human-recombinant epidermal

33.

34.

35.

36.

37.

38.

39.

40. 41.

42.

43.

44.

45.

46.

47.

48.

growth factor linked to a carrier protein: Report of a pilot clinical trial. Ann Oncol 1998; 9: 431–435. Li L, Li H, Qian Y, et al. Electrospun poly (varepsiloncaprolactone)/silk fibroin core-sheath nanofibers and their potential applications in tissue engineering and drug release. Int J Bio Macromol 2011; 49: 223–232. Hardwicke J, Schmaljohann D, Boyce D, et al. Epidermal growth factor therapy and wound healing – past, present and future perspectives. Surgeon 2008; 6: 172–177. Xu C, Inai R, Kotaki M, et al. Electrospun nanofiber fabrication as synthetic extracellular matrix and its potential for vascular tissue engineering. Tissue Eng 2004; 10: 1160–1168. Han D and Gouma P-I. Electrospun bioscaffolds that mimic the topology of extracellular matrix. Nanomedicine 2006; 2: 37–41. Hu MS, Maan ZN, Wu J-C, et al. Tissue engineering and regenerative repair in wound healing. Ann Biomed Eng 2014; 42: 1494–1507. Raghow R. The role of extracellular matrix in postinflammatory wound healing and fibrosis. FASEB J 1994; 8: 823–831. Zhao L, Gwon H-J, Lim Y-M, et al. Hyaluronic acid/ chondroitin sulfate-based hydrogel prepared by gamma irradiation technique. Carbohydr Polym 2014; 102: 598–605. Carpenter G and Cohen S. Epidermal growth factor. Ann Rev Biochem 1979; 48: 193–216. Richardson TP, Peters MC, Ennett AB, et al. Polymeric system for dual growth factor delivery. Nat Biotechnol 2001; 19: 1029–1034. Norouzi M, Shabani I, Ahvaz HH, et al. PLGA/gelatin hybrid nanofibrous scaffolds encapsulating EGF for skin regeneration. J Biomed Mater Res A 2014. Solis MA, Chen Y-H, Wong TY, et al. Hyaluronan regulates cell behavior: a potential niche matrix for stem cells. Biochem Res Int 2012; 2012: 346972. Choi JK, Jang J-H, Jang W-H, et al. The effect of epidermal growth factor (EGF) conjugated with low-molecular-weight protamine (LMWP) on wound healing of the skin. Biomaterials 2012; 33: 8579–8590. Badami AS, Kreke MR, Thompson MS, et al. Effect of fiber diameter on spreading, proliferation, and differentiation of osteoblastic cells on electrospun poly (lactic acid) substrates. Biomaterials 2006; 27: 596–606. Velnar T, Bailey T and Smrkolj V. The Wound Healing Process: An Overview of the Cellular and Molecular Mechanisms. J Int Med Res 2009; 37: 1528–1542. Ehrlich HP. Wound closure: evidence of cooperation between fibroblasts and collagen matrix. Eye 1988; 2: 149–157. Moura LIF, Dias AMA, Carvalho E, et al. Recent advances on the development of wound dressings for diabetic foot ulcer treatment – a review. Acta biomaterialia 2013; 9: 7093–7114.


Enhancement of skin wound healing with decellularized scaffolds loaded with hyaluronic acid and epidermal growth factor.

Enhancement of wound healing by epidermal growth factor.

Epidermal growth factor and corneal wound healing. A multicenter study.

Tissue engineered poly(caprolactone)-chitosan-poly(vinyl alcohol) nanofibrous scaffolds for burn and cutting wound healing.

Epidermal growth factor and the onset of epithelial epidermal wound healing.

Stability Studies of a Freeze-Dried Recombinant Human Epidermal Growth Factor Formulation for Wound Healing.

Expression of vascular permeability factor (vascular endothelial growth factor) by epidermal keratinocytes during wound healing.

Unwanted hair growth induced by topical epidermal growth factor during wound healing: true or myth?

Engineered Biopolymeric Scaffolds for Chronic Wound Healing.

Healing chronic wounds with epidermal growth factor.

Effect of salivary epidermal growth factor on wound healing of tongue in mice.

Epidermal growth factor accelerates connective tissue wound healing in the perforated rat mesentery.

Models of epidermal wound healing.

Photosensitive and biomimetic core-shell nanofibrous scaffolds as wound dressing.

Platelet-Derived Growth Factor Delivery via Nanofibrous Scaffolds for Soft-Tissue Repair.

Generation of Lactococcus lactis capable of coexpressing epidermal growth factor and trefoil factor to enhance in vitro wound healing.

Epidermal Stem Cells in Skin Wound Healing.

Basic Fibroblast Growth Factor in Scarless Wound Healing.

Role of platelet-derived growth factor in wound healing.

Acidic fibroblast growth factor accelerates dermal wound healing.

Current concepts in wound healing: growth factor and macrophage interaction.

Transforming growth factor alpha and epidermal growth factor in protection and healing of gastric mucosal injury.

Growth factors in wound healing.

Study of multi-functional electrospun composite nanofibrous mats for smart wound healing.