Tumor Biol. DOI 10.1007/s13277-015-3107-x
RESEARCH ARTICLE
Epigenetic inactivation of SOX1 promotes cell migration in lung cancer Ning Li & Suyun Li
Received: 30 August 2014 / Accepted: 14 January 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract SOX1 is epigenetically inactivated in hepatocellular carcinoma. However, the expression and methylation status of SOX1 in non-small cell lung cancer (NSCLC) remains unknown. The aim of the current study was to investigate whether the promoter hypermethylation of SOX1 is involved in human lung carcinogenesis. We first detected the expression of SOX1 protein in a tissue microarray (TMA) of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. Methylation of the promoter region of SOX1 in lung cancer tissues was determined by bisulfite sequencing PCR (BSP). In the present study, we found that the SOX1 promoter was fully or partially methylated in 40 of 60 (66.7 %) tumor tissues but not in the majority 15 of 60 (25 %) of normal tissues. A statistically significant inverse association was found between SOX1 methylation status and expression of the SOX1 in tumor tissues (P=0.003). We further demonstrate that restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling. Our results suggest that SOX1 is epigenetically silenced in the majority of NSCLC and restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Introduction SOX1 encodes a transcription factor implicated in the regulation of embryonic development and in the determination of cell fate [1]. SOX1 was identified as a tumor suppressor gene in hepatocellular cancer [2]. SOX1 was frequently downregulated through promoter hypermethylation in hepatocellular carcinoma (HCC) cells and tissues [2, 3]. Promoter hypermethylation of SOX1 was also found in cervical cancer and ovarian cancer [4, 5]. In our previous work, we found that SOX1 silencing enhanced the cisplatin-mediated autophagy in NSCLC, and promoter methylation of SOX1 was induced by long-term cisplatin treatment [6]. However, the expression and methylation status of SOX1 in non-small cell lung cancer (NSCLC) remains unknown. In this study, we show that loss of SOX1 expression is associated with hypermethylation of key CpG sites within transcription factor binding domains and that expression can be restored after treatment with the demethylating agent, 5azacytidine. Moreover, assessment of primary tumor specimens confirmed that hypermethylation is as common in patient tumors as in cell lines. Finally, restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Keywords Non-small cell lung cancer . SOX1 . Methylation Material and methods Patient samples and cell lines
N. Li (*) : S. Li Department of Respiratory Medicine, The First Affiliated Hospital of Henan University of Traditional Chinese Medicine, Renmin Road 19, Zhengzhou 450000, China e-mail: [email protected]
Tumor samples were collected from biopsy specimens from 60 patients with lung cancer at the Department of Respiratory Medicine, The First Affiliated Hospital of Henan University of Traditional Chinese Medicine, China (Table 1). Non-tumor samples from the macroscopic tumor margin were isolated at the same time and used as the matched adjacent non-
Tumor Biol. Table 1 Clinical characteristics of NSCLC patients according to the expression status of SOX1 Group
SOX1 expression −
Cancer tissues Histology Differentiation
LN metastasis Size (cm) Smoking status
ADC SCC Well Moderate Poor Yes No 3 cm). All samples were obtained with informed consent and with institutional review board approval of the hospital. The three different established human lung cancer cell lines used in the study (A-1, H1299, and H1650) were maintained in DMEM with 10 % fetal bovine serum (FBS) and 1 % streptomycin/penicillin antibiotics. DNA methylation analysis of the SOX1 gene Genomic DNA (2 μg) was modified with sodium bisulfite using an EpiTect Bisulfite kit (Qiagen). Methylation status was analyzed by bisulfite genomic sequencing of the CpG islands using primers previously for SOX1 [4]. Amplified bisulfite sequencing PCR products were cloned into pMD18-T simple vector (Takara). We investigated the effect of a demethylating agent, 5′-aza-2′-deoxycytidine (DAC; Sigma), on the expression of SOX1 in NSCLC cells. Cells were plated at a density of 2×105 per well in six-well plates for 18 h and then treated with DAC at concentrations of 10 μM in duplicate. After treatment for 48 h, the cells were harvested. DNA from normal lymphocytes served as a positive control for unmethylated alleles and as a negative control for methylated alleles. Negative control samples without DNA were also included in each PCR set. Immunohistochemistry Immunohistochemistry was performed by a two-step method using primary antibody including heat-induced antigen retrieval procedures. Sections were incubated overnight at 37 °C with primary antibody; after the primary antibody was washed off, the components of the Envision detection system
were applied with an anti-rabbit polymer (EnVision1/HRP/ Mo, Dako, Glostrup, Denmark). Reaction products were observed by incubation with diaminobenzidine. The primary antibody used was SOX1 (1:100 dilution; Abcam). Negative controls were treated identically but with the primary antibody omitted. Scoring of expression of SOX1 Immunoreactivity was evaluated independently by three researchers who were blinded to patient outcome. The percentage of positive tumor cells was determined by each observer, and the average of three scores was calculated. We randomly selected ten high-power fields and counted 1000 cells in each core. When the mean of the percentage of positive cells is close to 0 or 100 %, the standard deviation (SD) is close to 0, and when the mean is approximately 50 %, the SD is approximately 5 %. Thus, the SD does not increase with the mean. The following categories were used for scoring: intensity of staining: none (0), mild (1), moderate (2), strong (3); percentage of the positive staining: 50 % (3). Combining intensity and percentage staining resulted in the following scores: 0–1, negative (−); 2–6, positive (+). RT-PCR To test SOX1 expression in lung cancer cell lines, reverse transcription PCR (RT-PCR) was carried out. The primers used in the RT-PCR were as follows: SOX1-F: 5′-AGACCA AGACGCTGCTCAAGAA GG-3′; SOX1-R: 5′-CAGCCG TTGACGTGCGCGTA-3′; actin-F: 5′- CGGT TCCGCTGC CCTGAG-3′; actin-R: 5′- TGGAGTTGAAGGTAGTTTCG GGAT-3′. RNA was reverse transcribed to cDNA using SuperScript III (Invitrogen), which was then used as a template for PCR. All the experiments were performed triplicate, and RT-PCR bands were analyzed by scanning densitometry. The relative quantity was calculated after normalizing to actin expression. Negative control samples without DNA were also included in each PCR set. Western blotting Cells were harvested and samples (20 μg) of the cell lysate were subjected to 10 % SDS-PAGE gel electrophoresis, after which the resolved proteins were transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were then blocked with 5 % non-fat milk and 0.1 % Tween 20 in Tris-buffered saline and probed with antibody, after which the blots were visualized using enhanced chemiluminescence (Amersham, Arlington Heights, IL).
Tumor Biol.
Construction of plasmids and stable cell line generation
Statistical analysis
For construction of pCMV4-flag-SOX1, the SOX1 cDNA was generated by reverse transcription PCR using SOX1 forward primer (5′-ATGTACAGCATGATGATGGAGACCG-3′) and reverse primer (5′-CTAGATGTGCGTCAGGGGCACCGTG3′). The sequence was confirmed by DNA sequencing and ligated into pCMV-flag vector (Invitrogen). For transfection experiments, A-1 cells were plated into six-well plates 24 h before transfection. The cells were transfected with 5 μg/well of empty pCMV-flag and pCMV4-flag-SOX1 using SuperFect (Qiagen, Germany) according to the manufacturer’s instructions. For 48 h after transfection, the cells were passaged at 1:5 and cultured in a medium supplemented with G418 at 500 μg/ml for 4 weeks. Clones reexpressing SOX1 (A-1/SOX1) were selected for further study. As a control group, cells stably transfected with an empty vector pCMV-flag were also generated (A-1/Vector).
All data are given as the mean ± standard deviation (SD). Statistical analyses were conducted using two-tailed paired Student’s t tests. P < 0.05 was considered statistically significant.
Tumorigenicity assay Six-week-old male nude mice were housed under standard conditions. The cells were trypsinized, washed with phosphate-buffered saline (PBS), and suspended in RPMI 1640 without serum. A total of 2×106 cells were subcutaneously injected into the flanks of the nude mice. Tumor growth was measured every 2 days, and tumor volume was estimated as length×width2 ×0.52.
Results Expression profile of SOX1 in NSCLC We first detected the expression of SOX1 protein in a tissue microarray (TMA) of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. Representative examples of SOX1 protein expression in NSCLC and normal lung samples are shown in Fig. 1. We found a significant difference in SOX1 expression between NSCLC and normal lung tissue specimens (Fig. 2). Overall, expression of SOX1 was absent
Matrigel invasion assay Twenty-four hours after transfection, 4 × 104 cells were suspended in 0.25 ml of culture medium with 1 % FBS and plated in the top chamber with a Matrigel-coated membrane (24-well insert; pore size, 8 mm; Becton Dickinson). The cells were incubated for 48 h, after which the cells that did not invade through the pores were removed by a cotton swab. Cells on the lower surface of the membrane were stained with hematoxylin and eosine for visualization and counted. GTP-bound GTPase pull-down assays To measure GTP-Rac1, A-1/SOX1 and A-1/Vector cells were rinsed twice with ice-cold PBS and lysed in ice-cold RIPA buffer. GTP-bound Rac1 was isolated from whole cell lysates by incubation with PAK-1-binding domain agarose (Millipore) following the manufacturer’s instructions. Actin reorganization A-1/SOX1 and A-1/Vector cells were fixed in 4 % paraformaldehyde, stained with Rhodamine-phalloidin for 30 min, and mounted with DAPI. Fluorescent images were obtained using an OLYMPUS IX81 deconvolution microscope.
Fig. 1 Immunohistochemical staining for SOX1 with anti-SOX1 in the cancerous and normal tissues. Abundant expression of SOX1 was observed in the normal tissue (a), and undetected or weak expression of SOX1 was detected in the primary cancer tissues (b, c). Methylation patterns of individual bisulfite-sequenced clones of the SOX1 promoter are shown at the right. Black and white areas represent, respectively, the methylated and unmethylated CpG sites out of the colonies sequenced for each case
Tumor Biol.
Fig. 2 Total scores show a significant decreasing tendency from normal tissues to cancer tissues
in 50 of 60 lung cancer samples (83.3 %), whereas the expression of SOX1 in all normal lung tissues was detectable. SOX1 expression could be restored with 5′-Aza-dC treatment in lung cancer cell lines Methylation of the promoter region of SOX1 in lung cancer tissues was determined by bisulfite sequencing PCR (BSP). The area of the CpG-rich region around the transcription initiation site of the SOX1 gene which spanned 25 CpG sites was sequenced. The promoter methylation of the SOX1 gene was frequent in the lung cancer tissues, with 40 of 60 (66.7 %) samples positive. For the paired adjacent non-tumor tissue samples, 15 of 60 samples were positive (25 %). Representative examples of BSP are shown in Fig. 3. A statistically significant inverse association was found between SOX1 methylation status and expression of the SOX1 in tumor tissues (P=0.003). Methylation of the promoter region of SOX1 in lung cancer cell lines was also determined by BSP. As shown in Fig. 4a, most CpG dinucleotides were methylated in lung cancer cell lines. To confirm that CpG methylation is indeed responsible for the silencing of SOX1, we treated these
Fig. 4 a Methylation patterns of individual bisulfite-sequenced clones of the SOX1 promoter in lung cancer cell lines. Black and white areas represent, respectively, the methylated and unmethylated CpG sites out of the colonies sequenced for each case. b RT-PCR results for SOX1 expression in the lung cancer cell lines, with or without DAC treatment. Actin was coamplified as an internal control. Data shown are means ± SD of triplicates and have been repeated at least three times
heavily methylated and silenced cell lines with 5-Aza-dC, a methyltransferase inhibitor. SOX1 expression was markedly induced after the treatment in all the cell lines (Fig. 4b). Enforced expression of SOX1 inhibited cell migration and the in vivo metastatic abilities of NSCLC cells The more frequent silencing of SOX1 by methylation in NSCLC than in adjacent normal tissues suggests a potential tumor suppressor role of this gene. To assess whether SOX1 affects the biological behavior of NSCLC cells, we established
Fig. 3 Demonstration of SOX1 promoter methylation by BSP from one cancerous tissue and one normal tissue
Tumor Biol.
SOX1 expression plasmid and A-1/SOX1 which stably express SOX1. The expression of SOX1 in A-1/SOX1 cells was confirmed by Western analysis. Cell growth was analyzed using MTT assays which were performed in triplicate in 96well plates. Comparison of the growth rate between A-1/ SOX1 and A-1/Vector cells showed that SOX1 did not affect the cell proliferation rate (data not shown). Flow cytometry was performed to analyze the cell cycle phase distribution of these cells. Comparison of the cycle between A-1/SOX1 and A-1/Vector cells showed that SOX1 did not affect the cell cycle (Fig. 5). To assess whether SOX1 affects the biological behavior of lung cancer cells, we have established subcutaneous solid tumor models. All nude mice injected with A-1/ SOX1 and A-1/Vector cells developed palpable tumors
(Fig. 6a). There is no significant difference between A-1/SOX1 and A-1/Vector cells in cell proliferation rate, as A-1/SOX1 cells showed no growth advantage over A-1/Vector cells (Fig. 7). These results keep in line with the results that SOX1 did not affect the cell proliferation rate and cycle. However, we found that large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors (Fig. 6b). The invasion of cancer cells through the basement membrane is a key event during invasion and metastasis. Therefore, we used Matrigel assays to assess the effect of SOX1 overexpression on the ability of A-1 cells to invade the basement membrane. As shown in Fig. 6c, A-1/SOX1 cells
Fig. 5 Reexpression of SOX1 has no effect on the cell cycle in NSCLC cells. The graph represents means of three independent experiments ± standard deviations
Tumor Biol.
Fig. 6 a All nude mice injected with A-1/SOX1 and A-1/Vector cells developed palpable tumors. There is no significant difference between A-1/SOX1 and A-1/Vector cells in cell proliferation rate. b Large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors. c Reexpression of SOX1
suppresses cell invasion. Cells were placed on the Matrigel-coated twochamber Transwell insert, and the invasive cells were stained with Giemsa. Cells were counted under a light microscope. Representative pictures are shown. The graph represents means of three independent experiments ± standard deviations. * p < 0.05
exhibited significantly less (85 % decrease) invasion through Matrigel-coated filters than A-1/Vector cells.
plays an important role in cell migration. To examine the role of SOX1 in cytoskeletal reorganization, A-1/SOX1 and A-1/ Vector cells were stained with Rhodamine-phalloidin. As shown in Fig. 7a, restoration of SOX1 inhibited the formation of membrane protrusions, indicative of an increased migratory phenotype. During cell migration, Rac1 promotes actin polymerization and membrane protrusions. Membrane protrusions are generated by dynamic actin remodeling through multiple pathways, including the Cas/Crk/Rac1 signaling axis [7]. Because Rac1 activity is required for membrane protrusions, we next investigated whether SOX1 inhibited membrane protrusiveness through its ability to modulate Rac1 activity. To test this hypothesis, active GTP-bound Rac1 was measured in A-1/SOX1 and A-1/Vector cells. While total Rac1 expression was equivalent in A-1/SOX1 and A-1/Vector cells, Rac1-GTP levels were significantly decreased in A-1/SOX1 cells (Fig. 7b).
Enforced expression of SOX1 inhibited cytoskeletal reorganization We set out to determine the mechanism through which SOX1 inhibits lung cancer cell motility. Cytoskeletal reorganization
Discussion
Fig. 7 SOX1 inhibited actin cytoskeletal remodeling through its ability to modulate Rac1 activity. a Membrane protrusiveness is visualized by phalloidin staining. Restoration of SOX1 inhibited the formation of membrane protrusions. b Restoration of SOX1 inhibited the Rac1-GTP levels in A-1/SOX1 cells
Lung cancer is a leading cause of cancer mortality worldwide; it accounts for over a million deaths annually and still has a poor prognosis [8]. Non-small cell lung cancer (NSCLC) is the predominant form of lung cancer and consists of two major histological subtypes: squamous cell carcinoma and
Tumor Biol.
adenocarcinoma [9]. In our previous work, we found that SOX1 silencing enhanced the cisplatin-mediated autophagy in NSCLC, and promoter methylation of SOX1 was induced by long-term cisplatin treatment. However, the expression and methylation status of SOX1 in NSCLC remains unknown. SOX1 was frequently downregulated through promoter hypermethylation in HCC cells and tissues [2]. We detected the expression of SOX1 protein in a TMA of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. In the present study, we first determined the expression level of SOX1 in primary human NSCLC and adjacent non-cancer tissues by immunohistochemistry and RT-PCR. When compared to adjacent non-cancer tissues, SOX1 was found to be significantly downregulated in NSCLC. We also found that the promoter methylation of the SOX1 gene was frequent in the lung cancer tissues, with 40 of 60 66.7 % samples positive. For the paired adjacent non-tumor tissue samples, 15 of 60 samples were positive (25 %). Correlation of the promoter methylation with SOX1 expression showed a significantly lower expression level in the tumors with methylation compared to the tumors without methylation. Overexpression of SOX1 by a constitutive or inducible approach could suppress cell proliferation, colony formation, and invasion ability in HCC cell lines, as well as tumor growth in non-obese diabetic/severe combined immunodeficiency mice [3]. SOX1 could also interfere with Wnt/β-catenin signaling in the development of HCC [3]. To assess whether SOX1 affects the biological behavior of NSCLC cells, we established SOX1 expression plasmid and A-1/SOX1 which stably express SOX1. Our results showed that restoration of SOX1 did not affect the NSCLC cell proliferation rate and cycle, as well as tumor growth, in nude mice. However, we found that large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors, suggesting that SOX1 may play a role in cell migration. Matrigel assays confirmed that restoration of SOX1 inhibited cell migration. These results keep in line with the finding that SOX1 suppresses cell migration in cervical cancer by interfering with Wnt/β-catenin signaling [10]. The members of the Rho family of GTPases, such as Rac1, regulate actin cytoskeletal remodeling in different cellular compartments, controlling stress fiber assembly, focal adhesion formation, and the mode of motility in cancer cells [11–13]. During cell migration, Rac1 promotes actin polymerization and membrane protrusions. Membrane protrusions are generated by dynamic actin remodeling through multiple pathways, including the Cas/Crk/Rac1 signaling axis [7, 14]. Given that the establishment of membrane protrusions is a critical event of cell migration, and the loss of SOX1 has been
shown to enhance lung cancer cell motility [6, 15], we sought to determine the contribution of SOX1 to actin cytoskeletal remodeling. We found that restoration of SOX1 inhibited the formation of membrane protrusions, indicative of an increased migratory phenotype. We next investigated whether SOX1 inhibited membrane protrusiveness through its ability to modulate Rac1 activity. Our results demonstrated that restoration of SOX1 had the ability to suppress the Rac1activity.
Conclusions In this study, we show that loss of SOX1 expression is associated with promoter hypermethylation. Moreover, assessment of primary tumor specimens confirmed that hypermethylation is as common in patient tumors as in cell lines. Finally, restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Conflicts of interest None.
References 1. Kan L, Israsena N, Zhang Z, Hu M, Zhao LR, Jalali A, et al. Sox1 acts through multiple independent pathways to promote neurogenesis. Dev Biol. 2004;269(2):580–94. 2. Shih YL, Hsieh CB, Yan MD, Tsao CM, Hsieh TY, Liu CH, et al. Frequent concomitant epigenetic silencing of SOX1 and secreted frizzled-related proteins (SFRPs) in human hepatocellular carcinoma. J Gastroenterol Hepatol. 2013;28(3):551–9. 3. Tsao CM, Yan MD, Shih YL, Yu PN, Kuo CC, Lin WC, et al. SOX1 functions as a tumor suppressor by antagonizing the WNT/betacatenin signaling pathway in hepatocellular carcinoma. Hepatol Baltimore Md. 2012;56(6):2277–87. 4. Lai HC, Lin YW, Huang TH, Yan P, Huang RL, Wang HC, et al. Identification of novel DNA methylation markers in cervical cancer. Int J Cancer. 2008;123(1):161–7. 5. Su HY, Lai HC, Lin YW, Chou YC, Liu CY, Yu MH. An epigenetic marker panel for screening and prognostic prediction of ovarian cancer. Int J Cancer. 2009;124(2):387–93. 6. Li N, Li X, Li S, Zhou S, Zhou Q. Cisplatin-induced downregulation of SOX1 increases drug resistance by activating autophagy in nonsmall cell lung cancer cell. Biochem Biophys Res Commun. 2013;439(2):187–90. 7. Pu J, Mao Y, Lei X, Yan Y, Lu X, Tian J, et al. FERM domain containing protein 7 interacts with the Rho GDP dissociation inhibitor and specifically activates Rac1 signaling. PLoS One. 2013;8(8): e73108. 8. Koga T, Takeshita M, Yano T, Maehara Y, Sueishi K. CHFR hypermethylation and EGFR mutation are mutually exclusive and exhibit contrastive clinical backgrounds and outcomes in non-small cell lung cancer. Int J Cancer. 2011;128(5):1009–17. 9. Hong KM, Yang SH, Chowdhuri SR, Player A, Hames M, Fukuoka J, et al. Inactivation of LLC1 gene in nonsmall cell lung cancer. Int J Cancer. 2007;120(11):2353–8.
Tumor Biol. 10. Lin YW, Tsao CM, Yu PN, Shih YL, Lin CH, Yan MD. SOX1 suppresses cell growth and invasion in cervical cancer. Gynecol Oncol. 2013;131(1):174–81. 11. Gardberg M, Kaipio K, Lehtinen L, Mikkonen P, Heuser VD, Talvinen K, et al. FHOD1, a formin upregulated in epithelialmesenchymal transition, participates in cancer cell migration and invasion. PLoS One. 2013;8(9):e74923. 12. Wilson AL, Schrecengost RS, Guerrero MS, Thomas KS, Bouton AH. Breast cancer antiestrogen resistance 3 (BCAR3) promotes cell
motility by regulating actin cytoskeletal and adhesion remodeling in invasive breast cancer cells. PLoS One. 2013;8(6):e65678. 13. Ridley AJ. Life at the leading edge. Cell. 2011;145(7):1012–22. 14. Valderrama F, Thevapala S, Ridley AJ. Radixin regulates cell migration and cell-cell adhesion through Rac1. J Cell Sci. 2012;125(Pt 14): 3310–9. 15. Schlunck G, Damke H, Kiosses WB, Rusk N, Symons MH, Waterman-Storer CM, et al. Modulation of Rac localization and function by dynamin. Mol Biol Cell. 2004;15(1):256–67.
RESEARCH ARTICLE
Epigenetic inactivation of SOX1 promotes cell migration in lung cancer Ning Li & Suyun Li
Received: 30 August 2014 / Accepted: 14 January 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015
Abstract SOX1 is epigenetically inactivated in hepatocellular carcinoma. However, the expression and methylation status of SOX1 in non-small cell lung cancer (NSCLC) remains unknown. The aim of the current study was to investigate whether the promoter hypermethylation of SOX1 is involved in human lung carcinogenesis. We first detected the expression of SOX1 protein in a tissue microarray (TMA) of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. Methylation of the promoter region of SOX1 in lung cancer tissues was determined by bisulfite sequencing PCR (BSP). In the present study, we found that the SOX1 promoter was fully or partially methylated in 40 of 60 (66.7 %) tumor tissues but not in the majority 15 of 60 (25 %) of normal tissues. A statistically significant inverse association was found between SOX1 methylation status and expression of the SOX1 in tumor tissues (P=0.003). We further demonstrate that restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling. Our results suggest that SOX1 is epigenetically silenced in the majority of NSCLC and restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Introduction SOX1 encodes a transcription factor implicated in the regulation of embryonic development and in the determination of cell fate [1]. SOX1 was identified as a tumor suppressor gene in hepatocellular cancer [2]. SOX1 was frequently downregulated through promoter hypermethylation in hepatocellular carcinoma (HCC) cells and tissues [2, 3]. Promoter hypermethylation of SOX1 was also found in cervical cancer and ovarian cancer [4, 5]. In our previous work, we found that SOX1 silencing enhanced the cisplatin-mediated autophagy in NSCLC, and promoter methylation of SOX1 was induced by long-term cisplatin treatment [6]. However, the expression and methylation status of SOX1 in non-small cell lung cancer (NSCLC) remains unknown. In this study, we show that loss of SOX1 expression is associated with hypermethylation of key CpG sites within transcription factor binding domains and that expression can be restored after treatment with the demethylating agent, 5azacytidine. Moreover, assessment of primary tumor specimens confirmed that hypermethylation is as common in patient tumors as in cell lines. Finally, restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Keywords Non-small cell lung cancer . SOX1 . Methylation Material and methods Patient samples and cell lines
N. Li (*) : S. Li Department of Respiratory Medicine, The First Affiliated Hospital of Henan University of Traditional Chinese Medicine, Renmin Road 19, Zhengzhou 450000, China e-mail: [email protected]
Tumor samples were collected from biopsy specimens from 60 patients with lung cancer at the Department of Respiratory Medicine, The First Affiliated Hospital of Henan University of Traditional Chinese Medicine, China (Table 1). Non-tumor samples from the macroscopic tumor margin were isolated at the same time and used as the matched adjacent non-
Tumor Biol. Table 1 Clinical characteristics of NSCLC patients according to the expression status of SOX1 Group
SOX1 expression −
Cancer tissues Histology Differentiation
LN metastasis Size (cm) Smoking status
ADC SCC Well Moderate Poor Yes No 3 cm). All samples were obtained with informed consent and with institutional review board approval of the hospital. The three different established human lung cancer cell lines used in the study (A-1, H1299, and H1650) were maintained in DMEM with 10 % fetal bovine serum (FBS) and 1 % streptomycin/penicillin antibiotics. DNA methylation analysis of the SOX1 gene Genomic DNA (2 μg) was modified with sodium bisulfite using an EpiTect Bisulfite kit (Qiagen). Methylation status was analyzed by bisulfite genomic sequencing of the CpG islands using primers previously for SOX1 [4]. Amplified bisulfite sequencing PCR products were cloned into pMD18-T simple vector (Takara). We investigated the effect of a demethylating agent, 5′-aza-2′-deoxycytidine (DAC; Sigma), on the expression of SOX1 in NSCLC cells. Cells were plated at a density of 2×105 per well in six-well plates for 18 h and then treated with DAC at concentrations of 10 μM in duplicate. After treatment for 48 h, the cells were harvested. DNA from normal lymphocytes served as a positive control for unmethylated alleles and as a negative control for methylated alleles. Negative control samples without DNA were also included in each PCR set. Immunohistochemistry Immunohistochemistry was performed by a two-step method using primary antibody including heat-induced antigen retrieval procedures. Sections were incubated overnight at 37 °C with primary antibody; after the primary antibody was washed off, the components of the Envision detection system
were applied with an anti-rabbit polymer (EnVision1/HRP/ Mo, Dako, Glostrup, Denmark). Reaction products were observed by incubation with diaminobenzidine. The primary antibody used was SOX1 (1:100 dilution; Abcam). Negative controls were treated identically but with the primary antibody omitted. Scoring of expression of SOX1 Immunoreactivity was evaluated independently by three researchers who were blinded to patient outcome. The percentage of positive tumor cells was determined by each observer, and the average of three scores was calculated. We randomly selected ten high-power fields and counted 1000 cells in each core. When the mean of the percentage of positive cells is close to 0 or 100 %, the standard deviation (SD) is close to 0, and when the mean is approximately 50 %, the SD is approximately 5 %. Thus, the SD does not increase with the mean. The following categories were used for scoring: intensity of staining: none (0), mild (1), moderate (2), strong (3); percentage of the positive staining: 50 % (3). Combining intensity and percentage staining resulted in the following scores: 0–1, negative (−); 2–6, positive (+). RT-PCR To test SOX1 expression in lung cancer cell lines, reverse transcription PCR (RT-PCR) was carried out. The primers used in the RT-PCR were as follows: SOX1-F: 5′-AGACCA AGACGCTGCTCAAGAA GG-3′; SOX1-R: 5′-CAGCCG TTGACGTGCGCGTA-3′; actin-F: 5′- CGGT TCCGCTGC CCTGAG-3′; actin-R: 5′- TGGAGTTGAAGGTAGTTTCG GGAT-3′. RNA was reverse transcribed to cDNA using SuperScript III (Invitrogen), which was then used as a template for PCR. All the experiments were performed triplicate, and RT-PCR bands were analyzed by scanning densitometry. The relative quantity was calculated after normalizing to actin expression. Negative control samples without DNA were also included in each PCR set. Western blotting Cells were harvested and samples (20 μg) of the cell lysate were subjected to 10 % SDS-PAGE gel electrophoresis, after which the resolved proteins were transferred to nitrocellulose membranes (Amersham Biosciences). The membranes were then blocked with 5 % non-fat milk and 0.1 % Tween 20 in Tris-buffered saline and probed with antibody, after which the blots were visualized using enhanced chemiluminescence (Amersham, Arlington Heights, IL).
Tumor Biol.
Construction of plasmids and stable cell line generation
Statistical analysis
For construction of pCMV4-flag-SOX1, the SOX1 cDNA was generated by reverse transcription PCR using SOX1 forward primer (5′-ATGTACAGCATGATGATGGAGACCG-3′) and reverse primer (5′-CTAGATGTGCGTCAGGGGCACCGTG3′). The sequence was confirmed by DNA sequencing and ligated into pCMV-flag vector (Invitrogen). For transfection experiments, A-1 cells were plated into six-well plates 24 h before transfection. The cells were transfected with 5 μg/well of empty pCMV-flag and pCMV4-flag-SOX1 using SuperFect (Qiagen, Germany) according to the manufacturer’s instructions. For 48 h after transfection, the cells were passaged at 1:5 and cultured in a medium supplemented with G418 at 500 μg/ml for 4 weeks. Clones reexpressing SOX1 (A-1/SOX1) were selected for further study. As a control group, cells stably transfected with an empty vector pCMV-flag were also generated (A-1/Vector).
All data are given as the mean ± standard deviation (SD). Statistical analyses were conducted using two-tailed paired Student’s t tests. P < 0.05 was considered statistically significant.
Tumorigenicity assay Six-week-old male nude mice were housed under standard conditions. The cells were trypsinized, washed with phosphate-buffered saline (PBS), and suspended in RPMI 1640 without serum. A total of 2×106 cells were subcutaneously injected into the flanks of the nude mice. Tumor growth was measured every 2 days, and tumor volume was estimated as length×width2 ×0.52.
Results Expression profile of SOX1 in NSCLC We first detected the expression of SOX1 protein in a tissue microarray (TMA) of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. Representative examples of SOX1 protein expression in NSCLC and normal lung samples are shown in Fig. 1. We found a significant difference in SOX1 expression between NSCLC and normal lung tissue specimens (Fig. 2). Overall, expression of SOX1 was absent
Matrigel invasion assay Twenty-four hours after transfection, 4 × 104 cells were suspended in 0.25 ml of culture medium with 1 % FBS and plated in the top chamber with a Matrigel-coated membrane (24-well insert; pore size, 8 mm; Becton Dickinson). The cells were incubated for 48 h, after which the cells that did not invade through the pores were removed by a cotton swab. Cells on the lower surface of the membrane were stained with hematoxylin and eosine for visualization and counted. GTP-bound GTPase pull-down assays To measure GTP-Rac1, A-1/SOX1 and A-1/Vector cells were rinsed twice with ice-cold PBS and lysed in ice-cold RIPA buffer. GTP-bound Rac1 was isolated from whole cell lysates by incubation with PAK-1-binding domain agarose (Millipore) following the manufacturer’s instructions. Actin reorganization A-1/SOX1 and A-1/Vector cells were fixed in 4 % paraformaldehyde, stained with Rhodamine-phalloidin for 30 min, and mounted with DAPI. Fluorescent images were obtained using an OLYMPUS IX81 deconvolution microscope.
Fig. 1 Immunohistochemical staining for SOX1 with anti-SOX1 in the cancerous and normal tissues. Abundant expression of SOX1 was observed in the normal tissue (a), and undetected or weak expression of SOX1 was detected in the primary cancer tissues (b, c). Methylation patterns of individual bisulfite-sequenced clones of the SOX1 promoter are shown at the right. Black and white areas represent, respectively, the methylated and unmethylated CpG sites out of the colonies sequenced for each case
Tumor Biol.
Fig. 2 Total scores show a significant decreasing tendency from normal tissues to cancer tissues
in 50 of 60 lung cancer samples (83.3 %), whereas the expression of SOX1 in all normal lung tissues was detectable. SOX1 expression could be restored with 5′-Aza-dC treatment in lung cancer cell lines Methylation of the promoter region of SOX1 in lung cancer tissues was determined by bisulfite sequencing PCR (BSP). The area of the CpG-rich region around the transcription initiation site of the SOX1 gene which spanned 25 CpG sites was sequenced. The promoter methylation of the SOX1 gene was frequent in the lung cancer tissues, with 40 of 60 (66.7 %) samples positive. For the paired adjacent non-tumor tissue samples, 15 of 60 samples were positive (25 %). Representative examples of BSP are shown in Fig. 3. A statistically significant inverse association was found between SOX1 methylation status and expression of the SOX1 in tumor tissues (P=0.003). Methylation of the promoter region of SOX1 in lung cancer cell lines was also determined by BSP. As shown in Fig. 4a, most CpG dinucleotides were methylated in lung cancer cell lines. To confirm that CpG methylation is indeed responsible for the silencing of SOX1, we treated these
Fig. 4 a Methylation patterns of individual bisulfite-sequenced clones of the SOX1 promoter in lung cancer cell lines. Black and white areas represent, respectively, the methylated and unmethylated CpG sites out of the colonies sequenced for each case. b RT-PCR results for SOX1 expression in the lung cancer cell lines, with or without DAC treatment. Actin was coamplified as an internal control. Data shown are means ± SD of triplicates and have been repeated at least three times
heavily methylated and silenced cell lines with 5-Aza-dC, a methyltransferase inhibitor. SOX1 expression was markedly induced after the treatment in all the cell lines (Fig. 4b). Enforced expression of SOX1 inhibited cell migration and the in vivo metastatic abilities of NSCLC cells The more frequent silencing of SOX1 by methylation in NSCLC than in adjacent normal tissues suggests a potential tumor suppressor role of this gene. To assess whether SOX1 affects the biological behavior of NSCLC cells, we established
Fig. 3 Demonstration of SOX1 promoter methylation by BSP from one cancerous tissue and one normal tissue
Tumor Biol.
SOX1 expression plasmid and A-1/SOX1 which stably express SOX1. The expression of SOX1 in A-1/SOX1 cells was confirmed by Western analysis. Cell growth was analyzed using MTT assays which were performed in triplicate in 96well plates. Comparison of the growth rate between A-1/ SOX1 and A-1/Vector cells showed that SOX1 did not affect the cell proliferation rate (data not shown). Flow cytometry was performed to analyze the cell cycle phase distribution of these cells. Comparison of the cycle between A-1/SOX1 and A-1/Vector cells showed that SOX1 did not affect the cell cycle (Fig. 5). To assess whether SOX1 affects the biological behavior of lung cancer cells, we have established subcutaneous solid tumor models. All nude mice injected with A-1/ SOX1 and A-1/Vector cells developed palpable tumors
(Fig. 6a). There is no significant difference between A-1/SOX1 and A-1/Vector cells in cell proliferation rate, as A-1/SOX1 cells showed no growth advantage over A-1/Vector cells (Fig. 7). These results keep in line with the results that SOX1 did not affect the cell proliferation rate and cycle. However, we found that large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors (Fig. 6b). The invasion of cancer cells through the basement membrane is a key event during invasion and metastasis. Therefore, we used Matrigel assays to assess the effect of SOX1 overexpression on the ability of A-1 cells to invade the basement membrane. As shown in Fig. 6c, A-1/SOX1 cells
Fig. 5 Reexpression of SOX1 has no effect on the cell cycle in NSCLC cells. The graph represents means of three independent experiments ± standard deviations
Tumor Biol.
Fig. 6 a All nude mice injected with A-1/SOX1 and A-1/Vector cells developed palpable tumors. There is no significant difference between A-1/SOX1 and A-1/Vector cells in cell proliferation rate. b Large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors. c Reexpression of SOX1
suppresses cell invasion. Cells were placed on the Matrigel-coated twochamber Transwell insert, and the invasive cells were stained with Giemsa. Cells were counted under a light microscope. Representative pictures are shown. The graph represents means of three independent experiments ± standard deviations. * p < 0.05
exhibited significantly less (85 % decrease) invasion through Matrigel-coated filters than A-1/Vector cells.
plays an important role in cell migration. To examine the role of SOX1 in cytoskeletal reorganization, A-1/SOX1 and A-1/ Vector cells were stained with Rhodamine-phalloidin. As shown in Fig. 7a, restoration of SOX1 inhibited the formation of membrane protrusions, indicative of an increased migratory phenotype. During cell migration, Rac1 promotes actin polymerization and membrane protrusions. Membrane protrusions are generated by dynamic actin remodeling through multiple pathways, including the Cas/Crk/Rac1 signaling axis [7]. Because Rac1 activity is required for membrane protrusions, we next investigated whether SOX1 inhibited membrane protrusiveness through its ability to modulate Rac1 activity. To test this hypothesis, active GTP-bound Rac1 was measured in A-1/SOX1 and A-1/Vector cells. While total Rac1 expression was equivalent in A-1/SOX1 and A-1/Vector cells, Rac1-GTP levels were significantly decreased in A-1/SOX1 cells (Fig. 7b).
Enforced expression of SOX1 inhibited cytoskeletal reorganization We set out to determine the mechanism through which SOX1 inhibits lung cancer cell motility. Cytoskeletal reorganization
Discussion
Fig. 7 SOX1 inhibited actin cytoskeletal remodeling through its ability to modulate Rac1 activity. a Membrane protrusiveness is visualized by phalloidin staining. Restoration of SOX1 inhibited the formation of membrane protrusions. b Restoration of SOX1 inhibited the Rac1-GTP levels in A-1/SOX1 cells
Lung cancer is a leading cause of cancer mortality worldwide; it accounts for over a million deaths annually and still has a poor prognosis [8]. Non-small cell lung cancer (NSCLC) is the predominant form of lung cancer and consists of two major histological subtypes: squamous cell carcinoma and
Tumor Biol.
adenocarcinoma [9]. In our previous work, we found that SOX1 silencing enhanced the cisplatin-mediated autophagy in NSCLC, and promoter methylation of SOX1 was induced by long-term cisplatin treatment. However, the expression and methylation status of SOX1 in NSCLC remains unknown. SOX1 was frequently downregulated through promoter hypermethylation in HCC cells and tissues [2]. We detected the expression of SOX1 protein in a TMA of primary NSCLC and adjacent normal lung tissue specimens using immunohistochemical staining with a specific anti-SOX1 antibody. In the present study, we first determined the expression level of SOX1 in primary human NSCLC and adjacent non-cancer tissues by immunohistochemistry and RT-PCR. When compared to adjacent non-cancer tissues, SOX1 was found to be significantly downregulated in NSCLC. We also found that the promoter methylation of the SOX1 gene was frequent in the lung cancer tissues, with 40 of 60 66.7 % samples positive. For the paired adjacent non-tumor tissue samples, 15 of 60 samples were positive (25 %). Correlation of the promoter methylation with SOX1 expression showed a significantly lower expression level in the tumors with methylation compared to the tumors without methylation. Overexpression of SOX1 by a constitutive or inducible approach could suppress cell proliferation, colony formation, and invasion ability in HCC cell lines, as well as tumor growth in non-obese diabetic/severe combined immunodeficiency mice [3]. SOX1 could also interfere with Wnt/β-catenin signaling in the development of HCC [3]. To assess whether SOX1 affects the biological behavior of NSCLC cells, we established SOX1 expression plasmid and A-1/SOX1 which stably express SOX1. Our results showed that restoration of SOX1 did not affect the NSCLC cell proliferation rate and cycle, as well as tumor growth, in nude mice. However, we found that large tumors formed and tumor cells significantly invaded pulmonary tissues in the A-1/Vector groups. In contrast, mice injected with A-1/SOX1 cells had relatively fewer human lung tumors, suggesting that SOX1 may play a role in cell migration. Matrigel assays confirmed that restoration of SOX1 inhibited cell migration. These results keep in line with the finding that SOX1 suppresses cell migration in cervical cancer by interfering with Wnt/β-catenin signaling [10]. The members of the Rho family of GTPases, such as Rac1, regulate actin cytoskeletal remodeling in different cellular compartments, controlling stress fiber assembly, focal adhesion formation, and the mode of motility in cancer cells [11–13]. During cell migration, Rac1 promotes actin polymerization and membrane protrusions. Membrane protrusions are generated by dynamic actin remodeling through multiple pathways, including the Cas/Crk/Rac1 signaling axis [7, 14]. Given that the establishment of membrane protrusions is a critical event of cell migration, and the loss of SOX1 has been
shown to enhance lung cancer cell motility [6, 15], we sought to determine the contribution of SOX1 to actin cytoskeletal remodeling. We found that restoration of SOX1 inhibited the formation of membrane protrusions, indicative of an increased migratory phenotype. We next investigated whether SOX1 inhibited membrane protrusiveness through its ability to modulate Rac1 activity. Our results demonstrated that restoration of SOX1 had the ability to suppress the Rac1activity.
Conclusions In this study, we show that loss of SOX1 expression is associated with promoter hypermethylation. Moreover, assessment of primary tumor specimens confirmed that hypermethylation is as common in patient tumors as in cell lines. Finally, restoration of SOX1 inhibited cell migration by regulating actin cytoskeletal remodeling in NSCLC.
Conflicts of interest None.
References 1. Kan L, Israsena N, Zhang Z, Hu M, Zhao LR, Jalali A, et al. Sox1 acts through multiple independent pathways to promote neurogenesis. Dev Biol. 2004;269(2):580–94. 2. Shih YL, Hsieh CB, Yan MD, Tsao CM, Hsieh TY, Liu CH, et al. Frequent concomitant epigenetic silencing of SOX1 and secreted frizzled-related proteins (SFRPs) in human hepatocellular carcinoma. J Gastroenterol Hepatol. 2013;28(3):551–9. 3. Tsao CM, Yan MD, Shih YL, Yu PN, Kuo CC, Lin WC, et al. SOX1 functions as a tumor suppressor by antagonizing the WNT/betacatenin signaling pathway in hepatocellular carcinoma. Hepatol Baltimore Md. 2012;56(6):2277–87. 4. Lai HC, Lin YW, Huang TH, Yan P, Huang RL, Wang HC, et al. Identification of novel DNA methylation markers in cervical cancer. Int J Cancer. 2008;123(1):161–7. 5. Su HY, Lai HC, Lin YW, Chou YC, Liu CY, Yu MH. An epigenetic marker panel for screening and prognostic prediction of ovarian cancer. Int J Cancer. 2009;124(2):387–93. 6. Li N, Li X, Li S, Zhou S, Zhou Q. Cisplatin-induced downregulation of SOX1 increases drug resistance by activating autophagy in nonsmall cell lung cancer cell. Biochem Biophys Res Commun. 2013;439(2):187–90. 7. Pu J, Mao Y, Lei X, Yan Y, Lu X, Tian J, et al. FERM domain containing protein 7 interacts with the Rho GDP dissociation inhibitor and specifically activates Rac1 signaling. PLoS One. 2013;8(8): e73108. 8. Koga T, Takeshita M, Yano T, Maehara Y, Sueishi K. CHFR hypermethylation and EGFR mutation are mutually exclusive and exhibit contrastive clinical backgrounds and outcomes in non-small cell lung cancer. Int J Cancer. 2011;128(5):1009–17. 9. Hong KM, Yang SH, Chowdhuri SR, Player A, Hames M, Fukuoka J, et al. Inactivation of LLC1 gene in nonsmall cell lung cancer. Int J Cancer. 2007;120(11):2353–8.
Tumor Biol. 10. Lin YW, Tsao CM, Yu PN, Shih YL, Lin CH, Yan MD. SOX1 suppresses cell growth and invasion in cervical cancer. Gynecol Oncol. 2013;131(1):174–81. 11. Gardberg M, Kaipio K, Lehtinen L, Mikkonen P, Heuser VD, Talvinen K, et al. FHOD1, a formin upregulated in epithelialmesenchymal transition, participates in cancer cell migration and invasion. PLoS One. 2013;8(9):e74923. 12. Wilson AL, Schrecengost RS, Guerrero MS, Thomas KS, Bouton AH. Breast cancer antiestrogen resistance 3 (BCAR3) promotes cell
motility by regulating actin cytoskeletal and adhesion remodeling in invasive breast cancer cells. PLoS One. 2013;8(6):e65678. 13. Ridley AJ. Life at the leading edge. Cell. 2011;145(7):1012–22. 14. Valderrama F, Thevapala S, Ridley AJ. Radixin regulates cell migration and cell-cell adhesion through Rac1. J Cell Sci. 2012;125(Pt 14): 3310–9. 15. Schlunck G, Damke H, Kiosses WB, Rusk N, Symons MH, Waterman-Storer CM, et al. Modulation of Rac localization and function by dynamin. Mol Biol Cell. 2004;15(1):256–67.
